Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Eur J Biochem 269, 5137–5148 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03200.x Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue ´ ` Therese Hunter1, Joe V Bannister1,2 and Gary J Hunter1 Department of Physiology and Biochemistry, University of Malta, Msida, Malta; 2Cranfield Biotechnology Centre, Institute of BioScience and Technology, Cranfield University, Silsoe, Bedfordshire, UK The structurally homologous mononuclear iron and manganese superoxide dismutases (FeSOD and MnSOD, respectively) contain a highly conserved glutamine residue in the active site which projects toward the active-site metal centre and participates in an extensive hydrogen bonding network The position of this residue is different for each SOD isoenzyme (Q69 in FeSOD and Q146 in MnSOD of Escherichia coli) Although site-directed mutant enzymes lacking this glutamine residue (FeSOD[Q69G] and MnSOD[Q146A]) demonstrated a higher degree of selectivity for their respective metal, they showed little or no activity compared with wild types FeSOD double mutants (FeSOD[Q69G/A141Q]), which mimic the glutamine position in MnSOD, elicited 25% the activity of wild-type FeSOD while the activity of the corresponding MnSOD double mutant (MnSOD[G77Q/Q146A]) increased to 150% (relative to wild-type MnSOD) Both double mutants showed reduced selectivity toward their metal Differences exhibited in the thermostability of SOD activity was most obvious in the mutants that contained two glutamine residues (FeSOD[A141Q] and MnSOD[G77Q]), where the MnSOD mutant was thermostable and the FeSOD mutant was thermolabile Significantly, the MnSOD double mutant exhibited a thermal-inactivation profile similar to that of wild-type FeSOD while that of the FeSOD double mutant was similar to wild-type MnSOD We conclude therefore that the position of this glutamine residue contributes to metal selectivity and is responsible for some of the different physicochemical properties of these SODs, and in particular their characteristic thermostability Iron superoxide dismutases (FeSOD, E.C.1.15.1.1) and manganese superoxide dismutases (MnSOD) constitute a class of structurally equivalent metalloenzymes prevalent in prokaryotes and in eukaryotic mitochondria, respectively They exhibit a very high degree of homology in both sequence and structure (Fig 1) The SODs are active only in dimeric association and all share structural homology in this respect [1] The metal cofactors are required to catalyse the disproportionation of the superoxide radical into hydrogen peroxide and molecular oxygen [2] in a cyclic, two-stage oxidation-reduction mechanism: Correspondence to G J Hunter, Department of Physiology and Biochemistry, University of Malta, Msida, MSD 06, Malta Fax: + 356 21310577, Tel.: + 356 21316655, E-mail: gary.hunter@um.edu.mt Abbreviations: Fe[Q69G], Fe[A141Q] and Fe[Q69G/A141Q], Escherichia coli FeSOD mutated at glutamine 69 to glycine, alanine 141 to glutamine, or both, respectively; FeSOD, MnSOD, the iron- or manganese-containing SOD, respectively; FXa, active form of restriction protease factor X; GSH, reduced glutathione; GSt, glutathione S-transferase; IPTG, isopropyl thio-b-D-galactoside; Mn[G77Q], Mn[Q146A] and Mn[G77Q/Q146A], E coli MnSOD mutated at glycine 77 to glutamine, glutamine 146 to alanine, or both, respectively; SOD, superoxide dismutase; wt, wild type Enzymes: iron superoxide dismutase from E coli; SODF_ECOLI, manganese superoxide dismutase from E coli; SODM_ECOLI (E.C 1.15.1.1) (Received 11 March 2002, revised 10 July 2002, accepted 22 August 2002) Keywords: superoxide dismutase; site-directed mutagenesis; metal specificity; thermostability M3ỵ ỵ O ! M2ỵ ỵ O2 M2ỵ þ OÀ þ 2Hþ ! M3þ þ H2 O2 ð1Þ ð2Þ where M represents either iron or manganese Selectivity of the proteins for their metal cofactor has been demonstrated in vivo [3] and although apoenzymes of each type of SOD may be reconstituted by the addition of metals, the resulting enzyme is active only with the authentic metal at its active centre [4–7] A small number of cambialistic SODs have been shown to be active with either iron or manganese, though only those of Propionibacterium shermanii [8], Bacteroides gingivalis [9] and Bacteroides fragilis [10] demonstrate similar specific activities with either metal In all structures solved for the mononuclear SODs, the metal ion is held in place by an absolutely conserved quartet of residues comprising three histidines and one aspartic acid which act as ligands to the metal (H26, H81, D167 and H171 for Escherichia coli MnSOD, Fig 1B This numbering will be used throughout except where indicated) [11–21] This conservation is also reflected in all sequences elucidated for this large group of ubiquitous enzymes A fifth metal ligand, either water or hydroxide, present in all structures produces a trigonal-pyramidal geometry at the active site A distorted-octahedral geometry is assumed during catalytic turnover or inhibition, 5138 T Hunter et al (Eur J Biochem 269) Ó FEBS 2002 Fig Comparison of E coli mononuclear superoxide dismutase molecular features (Top) Stereo view of the superposition of the backbone peptide chain of one subunit of FeSOD (black) and MnSOD (grey) of E coli (coordinates taken from database entries 1ISB (10), chain A, and 1VEW [18], chain C, respectively) The iron ion is shown as a black sphere and amino acid sidechains are shown in ball and stick for FeSOD residues Q69 and A141, relevant to this study The corresponding sites in MnSOD are occupied by G77 and Q146, respectively (not shown) Superposition was calculated using the combinatorial extension method to maximize backbone contacts [42] Labels indicate the positions of the N- and C-termini, the iron ion and residues Q69 and A141 in FeSOD (Bottom) Stereo view of selected residues around the metal centres Superposition, orientation and colour are the same as above Metal and hydroxyl ions are shown as light coloured spheres (only those of FeSOD are labelled) and sidechains of residues relevant to mutation studies here are shown as ball and stick (FeSOD Q69, A141 and MnSOD G77, Q146) Hydrogen bonds and metal contacts between residues of FeSOD are shown as dashed lines where a sixth ligand, presumed to be hydroxide, is bound to the metal [11,22,23] ˚ Beyond the metal ligand residues and within 10 A of the metal there are few significant differences between iron- and manganese-containing SODs During catalysis substrate and products must pass through a ÔfunnelÕ made up of residues from each subunit [11,24] and include so-called Ôgateway residuesÕ His30, Tyr34, Trp169 and Glu170, the latter from the second subunit of the functional dimer [25] Studies of the highly conserved residues within this outer sphere have revealed structural or chemical roles for these residues and highlighted the importance of a hydrogenbonded network between various residues and the water (or hydroxide) coordinated to the metal ion (participating residues are shown in Fig 1B) Site-directed mutations of Y34 in E coli FeSOD [24,26], MnSOD [27] and human MnSOD [28] show that the phenolic hydroxyl is not necessary for maximal activity and mutants display no overall change in structure Importantly, Y34 can not be the sole source of protons for the dismutation reaction, although this residue has been shown to be a source of the pH dependence of FeSOD activity [26] Moreover, these mutants show an increased sensitivity to the inhibitor azide [24] and also, in the case of human MnSOD, to product inhibition [28], processes thought to be analogous Y34 is hydrogen bonded to Q146 and thus forms part of an extensive hydrogen-bonding network involving various residues as well as the coordinated solvent Q146 is of interest as it represents one of two residues originally identified to distinguish between FeSOD and MnSOD [7] The position of the glutamine residue, which is structurally equivalent in the enzymes, is contributed by the N domain of FeSODs (Q69) and the C domain of MnSODs (Q146) Exceptions to this scheme include the substitution of Gln by His in two MnSODs and some FeSODs which have substituted His at the equivalent position of A141 for the glutamine at position 69 of most other FeSODs Substitution of Q143 (equivalent to Q146) in human MnSOD with Asn drastically reduced enzymatic activity and effectively opened the active site of the enzyme by reducing the occupied internal volume, allowing the introduction of an extra water molecule [29] Replacement of the same residue by Ala similarly maintains the same characteristic enzyme fold but with a concomitant introduction of further water molecules, in this case two solvent molecules occupy positions equivalent to the Oe1 and Ne2 of the missing Gln30 Interestingly, replacement of this residue by Glu had little effect but replacement by Lys yielded an enzyme too unstable to purify [30] In E coli, MnSOD mutation of Q146 to Glu generated an apoprotein only, Ó FEBS 2002 whereas mutation to Leu or His reduced activity to less than 10% with little or no structural changes in the mutants [27] Although low with either metal, the Q146H mutation was reported to give similar activities with either iron or manganese in the reconstituted enzyme [27] Double mutations have been introduced into P gingivalis and E coli SODs with the intention of altering their metal specificities In the former cambialistic enzyme, mutations Q70G/A142Q reduced the iron-supported activity of the enzyme and altered the ratio of Mn : Fe from 1.4 to 3.5 [31] In the latter MnSOD, the equivalent mutation G77Q/Q146A was demonstrated to reduce specific activity to 71% and introduce an iron-supported SOD activity which did not exist in the wild-type enzyme, though this was only 6% of manganese-supported activity in the wild type [32] Here we present data for FeSOD mutations Q69G and A141Q, both single and double mutations, and a comparison with data on equivalent mutations in MnSOD (G77Q and Q146A), which change in vivo metal selectivity, specific activity and thermal stability of these isoenzymes MATERIALS AND METHODS Active-site glutamines in SODs (Eur J Biochem 269) 5139 Oligonucleotide synthesis Oligonucleotides were synthesized on an Applied Biosystems model 392 DNA synthesizer and purified by preparative gel electrophoresis in 20% polyacrylamide gel containing M urea Before use in mutagenesis protocols the oligonucleotides were first used as primers in dideoxy sequencing [37] to confirm the position of their unique binding site within the sodA or sodB gene (see below) Dideoxy DNA sequencing DNA sequencing was carried out by the dideoxy method [37] using ABI prism dye-terminator DNA sequencing reagents and an Applied Biosystems model 800 Catalyst sequencing station followed by detection and analysis on an Applied Biosystems model 373A automated DNA sequencer The cloned wild-type and mutant sod genes were fully sequenced in both directions using the sequencing primers PGEXPLUS, d(5¢-GTTTGGTGGTGGCGACCATCCT) and PGEXMINUS, d(5¢-GAGGCAGATCGTCAGCAG TCA) and various mutagenic primers (see below) Chemicals and enzymes Construction of pGH-MnSOD and pGH-FeSOD Superoxide dismutases (iron-containing or manganesecontaining enzymes from E coli) were purchased from Sigma (Poole, Dorset, UK) Xanthine oxidase (from cow milk), all restriction endonucleases (used according to the manufacturers instructions in the buffers provided) and protease factor Xa cleavage and removal kit, were purchased from Boehringer Mannheim (Mannheim, Germany) Nitro Blue tetrazolium and isopropyl thio-b-D-galactoside (IPTG) were obtained from United States Biochemicals (Cleveland, Ohio USA) T4 DNA ligase (FPLCpure) and reduced glutathione (GSH)-sepharose were purchased from Pharmacia Biotech (Vienna, Austria) Wild-type sodA and sodB genes were isolated by PCR FeSOD was cloned using the primers ECF-5¢ d(5¢-TCATT CGAATTACCTGCACTAC) and ECF-3¢ d(5¢-TTATGC AGCGAGATTTTTCGCT) and the sodB plasmid, pHS1-8 (supplied by D Touati, Institut Jacques Monod, Paris, France) as template DNA MnSOD was cloned using the primers ECM-5¢ d(5¢-AGCTATACCCTGCCATCCCTG) and ECM-3¢ d(5¢-TTATTTTTTCGCCGCAAAACGTG) and E coli genomic DNA as template PCR was carried out using Amplitaq enzyme according to the manufacturer’s instructions (Perkin-Elmer corporation) although the extension reaction was omitted Instead, the DNA products were incubated in the presence of Unit of Klenow DNA polymerase enzyme for 30 at 30 °C This step greatly improved the efficiency of blunt-end cloning of the PCR products into the vector [36] Constructs were designated pGH-FeSOD and pGH-MnSOD Visualization and analysis of molecular structures Molecular structures whose coordinates were obtained from the RCSB database were visualized using the programs MOLMOL [33] or GeneMine [34] Additionally, POVRAY (http://www.povray.org) was used to produce Fig Structural alignment of SODs was maximized using the combinatorial extension program CE [35] while mutational analyses were carried out using the CARA and ENCAD algorithms included in the GENEMINE program Bacterial strains and vectors The mutagenesis and expression phagemid, pGHX(–) was produced in our laboratory and is described elsewhere [36] E coli K12 strain TG1 [sup E, hsd D5, thi, D(lac– proAB), F¢(tra D36 pro A+B+ lac Iq lac ZDM15)], was supplied with the Sculptor Oligonucleotide-Directed In Vitro Mutagenesis System kit obtained from Amersham International, UK, which was used to generate site-directed mutations E coli OX326A (DsodA DsodB) was kindly supplied by H Steinman, Albert Einstein College of Medicine, New York, USA In vitro site-directed mutagenesis Oligonucleotide site-directed mutagenesis was carried out by the phosphorothioate DNA method of Eckstein [38] utilized in the Sculptor in vitro mutagenesis kit from Amersham International, UK Single-stranded DNA template was produced from the pGH-SOD constructs using VCS-M13 helper phage (Stratagene) One microgram was utilized in mutagenesis reactions together with oligonucleotides ECF-Q69G d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF-A141Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q146A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s instructions (mutagenic nucleotide are underlined) Mutated plasmids were designated pGHFeSOD[Q69G], pGH-FeSOD[A141Q], pGH-MnSOD [G77Q] and pGH-MnSOD[Q146A] ssDNA produced from cells harbouring pGH-FeSOD[Q69G] and Ó FEBS 2002 5140 T Hunter et al (Eur J Biochem 269) pGH-MnSOD[G77Q] was used as the template for the production of the double mutants using oligonucleotides ECF-A141Q and ECM-Q146A, respectively Induced expression of SOD E coli OX326A (DsodA DsodB) harbouring the pGH-SOD plasmids was grown at 30 °C with shaking in L culture flasks containing 500 mL 2TY medium (1.6% tryptone, 1% yeast extract and 0.5% sodium chloride) supplemented with 100 lgỈmL)1 ampicillin, sodium salt, 50 lM iron(III) sulfate and 50 lM manganese sulfate When the D600 of the culture reached a value of 0.4, IPTG was added to a final concentration of 10 mM and the culture incubated for a further h Protein purification Cells from IPTG-induced cultures were harvested by lowspeed centrifugation and resuspended in approximately 35 mL of NaCl/Pi buffer (20 mM sodium phosphate buffer pH 7.2, 150 mM sodium chloride) containing SDS (0.03%) and Triton X-100 (1%) All sample volumes were then adjusted to give an equal D600 Resuspended cells were lysed by passage through a French pressure cell (Amicon) at 16 000 psi The cell lysates were clarified by centrifugation at 10 000 r.p.m (SS-34 rotor, Sorval RC-5C centrifuge) for 20 and supernatants were mixed by gentle shaking in batch at °C overnight with 3–5 mL of GSH-sepharose resin prewashed with buffer The resin was then packed into columns and the unbound protein washed through the column with 25 mL NaCl/Pi followed by mL GSH (10 mM in 50 mM Tris/HCl pH 8.0) GSH was used to elute the bound fusion protein which usually eluted in the first 6– 10 mL Buffer-exchange using KP buffer (50 mM potassium phosphate, 0.1 mM EDTA, pH 7.8) and concentration was carried out using Microcon 30 (Amicon) centrifugal concentrators and recovered proteins were stored at )80 °C To obtain pure SOD enzymes with authentic N-termini, the glutathione S-transferase (GST)-fusion proteins (50 lg) were diluted into Tris/HCl buffer (50 mM, pH 8.3) containing calcium chloride (2 mM) and incubated overnight with the active form of restriction protease factor X (FXa; lg, biotinylated) at 4–22 °C in a final volume of 100 lL The digest was subjected to a further round of GSH-sepharose affinity chromatography after addition of protein A-agarose (50 lL) to remove FXa, the purified SOD being present in the through-wash Buffer exchange and concentration was performed as described above Assay for superoxide dismutase activity The specific activity of SOD was measured spectrophotometrically by its inhibitory action on the superoxidedependent reduction of cytochrome c by xanthine-xanthine oxidase as described by McCord and Fridovich [39] and Ysebaert-Vanneste and Vanneste [40] The reduction of cytochrome c was followed at a wavelength of 550 nm using a Beckman Diode Array DU7500 spectrophotometer in KP buffer at 25 °C and a final volume of mL A blank measurement was recorded in the absence of sample over (Vb) SOD proteins were diluted 200- to 6000-fold depending on the activity of the enzyme and cytochrome c reduction was followed over (Vs) for a range of sample dilutions (200 lL sample per reaction) The slope of a plot of the reciprocal of the sample volume against Vb/Vs was used to calculate SOD activity [40] All assay constituents were dissolved in KP buffer before use and the amount of xanthine oxidase required was adjusted to give a blank value (Vb) of approximately 0.025 Dmin)1 All spectrophotometric measurements were used after subtraction of a blank containing SOD sample but no xanthine oxidase to ensure lack of interference with the assay constituents by mutant proteins For activity measurements at different temperatures or in the presence of sodium azide, an initial dilution of SOD was adjusted to give Vs equal to half Vb (equal to unit of SOD activity under standard conditions) After incubation of aliquots at the required temperature or after addition of sodium azide at the required concentration, Vs was measured again Activities were expressed as a percentage of SOD activity at 25 °C without azide For measurements of hydrogen peroxide inactivation, the SOD sample (1.6 mL) was incubated at 23 °C with 0.25 mM (FeSODs) or mM (MnSODs) hydrogen peroxide Aliquots (200 lL) were added to catalase (100 U, lL) and then used to measure SOD activity as described above, SOD concentrations having been calculated to yield U SOD activity in a standard mL assay Activities were expressed as a percentage of SOD activity at 25 °C without hydrogen peroxide Blanks were performed with hydrogen peroxide and catalase to ensure there were no adverse effects on the SOD assay Polyacrylamide gel electrophoresis (PAGE) Native 8% polyacrylamide gels (acrylamide : N,N¢-methylenebisacrylamide, 29 : 1, w/w) containing NaCl/Tris, pH 8.8 utilized a Tris/glycine electrophoresis buffer system consisting of 25 mM Tris, 250 mM glycine, pH 8.3 Samples contained 50 mM Tris/HCl, pH 6.8, 0.1% bromophenol blue and 10% glycerol prior to gel application Denaturing polyacrylamide gel electrophoresis (SDS/PAGE) was carried out in 15% polyacrylamide gels essentially by the procedure of Laemmli [41] utilizing a 5% stacking gel Samples were pretreated by boiling for in 100 mM Tris/HCl, pH 6.8, 100 mM dithiothreitol, 2% SDS, 0.1% bromophenol blue and 10% glycerol prior to application to the gel Superoxide dismutase activity stain Native PAGE (8%) gels were stained for SOD activity by the Nitro Blue tetrazolium reaction as described by Beauchamp and Fridovich [42] Protein concentration Estimation of the concentration of purified protein or in the lysates was by the method of Bradford using BSA as standard [43] Protection against paraquat-induced stress Overnight cultures (5 mL) of E coli OX326A transformed with the appropriate plasmid were diluted : 100 in 2TY medium to a final volume of mL, grown with shaking at Ó FEBS 2002 Active-site glutamines in SODs (Eur J Biochem 269) 5141 37 °C for 1–2 h and used to inoculate 50 mL of 2TY media containing 100 lgỈmL)1 ampicillin, 50 lM ferric sulfate, 50 lM manganese sulfate, 250 lM paraquat and 0.1 mM IPTG to an initial D600 of 0.03 Cultures were grown in 250 mL flasks with shaking at 37 °C and mL aliquots were removed regularly to measure optical density Metal analysis Concentrations of iron and manganese in protein samples were determined by atomic absorbance with a Hitachi Z-9000 atomic spectrophotometer (Showa Woman’s University, Japan) by Professor F Yamakura (Juntendo University School of Medicine, Japan) and Professor T Matsumoto (Showa Woman’s University) RESULTS Mutation of FeSOD and MnSOD The sodB and sodA genes of E coli were amplified by PCR from either the sodB-containing plasmid pHS1-8 or E coli genomic DNA, respectively, and subcloned (by blunt-end ligation) into the novel expression vector pGHX(–) [36] Single-stranded DNA was produced from pGH-SOD clones and used to carry out site-directed mutagenesis (Materials and methods) The introduction of the correct unique mutations was confirmed by dideoxy DNA sequencing of the entire SOD-coding region of each expression construct (results not shown) Expression of pGH-SOD derivatives In pGHX(–), SOD gene expression is under the control of the powerful tac promoter [44] We developed this vector specifically to be able to purify authentic SOD proteins via a GST fusion protein intermediate similar to that reported previously [24] Authenticity of the N-terminal amino acid residues is ensured by the inclusion of a factor Xa cleavage site appropriately situated with respect to the SalI cloning site in this vector Our oligonucleotide primers utilized for PCR were designed to encode the SODs from the second codon (i.e after the ATG start codon) When cloned into pGHX(–) as described these SOD genes are rendered in-frame with the GST gene, separated by the FXa recognition sequence Expression of GST-SOD proteins was high, corresponding to approximately 40% of the total cell protein (results not shown) Single column purification on glutathionesepharose yielded proteins of the expected size (47 300 Da for GST-FeSOD and 49 000 Da for MnSOD, Fig 2A) Purity of the fusion proteins was estimated to be 98% as measured by laser densitometry of Coomassie-stained SDS/ PAGE gels (results not shown) Perhaps surprisingly, the GST-SOD fusion proteins exhibited SOD activity on native PAGE (Fig 2B), although only GST-FeSOD[wt] (wild type), GST-Mn[wt] and GST-Mn[G77Q/Q146A] showed any appreciable activity on native gels and higher protein concentrations were required to visualize SOD activity of GST-Fe[A141Q] and GST-Mn[G77Q] (Fig 2B) This result suggests the formation of active dimers between the SOD domains of the fusion proteins products Slower-migrating bands also visualized by SOD activity staining may have Fig Purification and superoxide dismutase activity of FeSOD and MnSOD mutants (A) SDS/PAGE (15%) of GST-SOD fusion proteins from single-column affinity purification Lanes 1–8 are Fe[wt], Fe[Q69G], Fe[A141Q], Fe[Q69G/A141Q], Mn[wt], Mn[G77Q], Mn[Q146A] and Mn[G77Q/Q146A], respectively (B) Native-PAGE (8%) stained for superoxide dismutase activity Lanes 1–8 as for A (8 lg per lane), lanes 9–12 are Fe[A141Q], Fe[Q69G/A141Q], Mn[G77Q] and Mn[G77Q/Q146A] (20 lg per lane) (C) Cleavage and purification of authentic SODs SDS/PAGE (15%) of GST-SOD fusion proteins (examples shown are Fe[A141Q], Fe[Q69G/A141Q], Mn[G77Q] and Mn[G77Q/Q146A] in lanes 1–4, respectively) were cleaved by treatment with the restriction protease FXa (lanes 5–8, samples as for lanes 1–4 after FXa treatment), Samples subjected to further affinity chromatography to remove uncut fusion protein and released GST, to leave pure, authentic SOD (lanes 9–12 as for lanes 1– 4, and 10, lg each, 11 and 12, lg each) Lane 13 contains FeSOD and MnSOD (from Sigma, lg each) (D) Native-PAGE (8%) of purified SOD samples stained for SOD activity Lane contains FeSOD and MnSOD markers (from Sigma, arrowed, lg each), lanes 2–9 as for lanes A1 to A8, lanes 10–13 as for lanes C1 to C4 been derived from further interactions of the fusion protein GST domains (Fig 2B) Although not visualized in these zymograms, all of the fusion proteins had detectable SOD activity in a spectrophotometric assay (Table 1) Purification of authentic SOD Utilization of the pGHX(–) vector enabled the purification of SOD proteins containing authentic N-terminal amino acid residues SOD is released from GST-SOD fusion proteins by cleavage with FXa (Fig 2C) Although this method is less efficient than cleavage by thrombin [24] the released SOD proteins contain no additional N-terminal Ó FEBS 2002 5142 T Hunter et al (Eur J Biochem 269) Table Specific activities of mutant superoxide dismutases Results are expressed as the mean from at least three individual measurements (duplicate measurements were within 5% of each other) Mn[Q146A] gave no discernible activity even at high protein concentrations SOD expressed GST-SOD activity SOD activitya (unitsỈmg)1) Iron superoxide dismutase mutants Fe[wt] Fe[Q69G] Fe[A141Q] Fe[Q69G/A141Q] 1100 (100) 86 (7.8) 122 (11) 363 (33) 3048 (100) 241 (8) 366 (12) 801 (26) 2605 227 457 965 (100) (8) (17) (37) 3500 1620 5285 4929 4153 8257 (100) (84) (0) (167) a Manganese superoxide dismutase mutants Mn[wt] 1560 (100) Mn[G77Q] 650 (42) Mn[Q146A] (0.5) Mn[G77Q/Q146A] 2190 (140) SOD activityb (unitsỈmetal ion)1) (100) (46) (0) (151) a Activity of SOD as measured by the xanthine-xanthine oxidase assay with percentage activity relative to wild type in parentheses Activity of SOD expressed on a per-iron metal basis (iron superoxide dismutase mutants) and per-manganese metal basis (manganese superoxide dismutase mutants) b amino acid residues sometimes present due to cloning [36] The efficiency of FXa cleavage varied between 50% and 70% as measured by laser densitometry (results not shown) Biotinylated FXa was removed by the addition of protein A-agarose to the digest prior to further affinity chromatography on GSH-sepharose which then removes both undigested GST-SOD and released GST proteins (Fig 2C) All purified SOD mutants comigrated on SDS/PAGE with authentic FeSOD or MnSOD obtained from Sigma Chemical Company, Poole, UK (Fig 2C and results not shown) Samples of pure SOD exhibited a similar pattern of SOD activity on native-PAGE as the GST-SOD fusion proteins (Fig 2D) Higher protein concentrations were necessary to visualize Fe[A141Q], Fe[Q69G/A141Q] and Mn[G77Q], however, both Fe[A141Q] and Mn[G77Q] were observed to stain a light red colour rather than achromatically as is the case for SOD in this system (Fig 2D) This aberrant staining has been observed before with high protein concentrations in the system used [24] Enzyme activity and metal content The specific activity of superoxide dismutase mutants was measured in a spectrophotometric assay Both fusion and purified proteins reflect the same differences in activity between the mutant enzymes Assay results for GST-SOD fusion derivatives are lower than for pure SOD proteins but are proportional to the difference in size between the proteins (Table 1) Wild-type SODs show a similar level of specific activity (per mg protein basis) while mutants lacking a glutamine at the active site (Fe[Q69G] and Mn[Q146A]) exhibit a large reduction, the manganese enzyme being reduced to an undetectable level (Table 1) The addition of a second glutamine to the active site location of the iron enzyme (Fe[A141Q]) has a very similar effect to removal of the existing glutamine and SOD activities are reasonably similar between the two mutants In contrast, however, addition of a second glutamine residue to the manganese enzyme (Mn[G77Q]) leaves the mutant with about half the specific activity of the wild-type enzyme A final contrast can be seen between the double mutant enzymes where the glutamine residue has been removed from the wild-type location and replaced by a glutamine at the location corresponding structurally to the position found in its isoenzyme (Fe[Q69G/A141Q] and Mn[G77Q/Q146A]) In this case the FeSOD demonstrates a reduction in activity to about a quarter of its wild-type level but the MnSOD increases by half as much again (Table 1) We measured the metal content of the mutant proteins by atomic absorbance spectroscopy The results of this analysis are presented in Table 2, with both iron and manganese levels reported for each mutant as the number of metal ions present per subunit of protein In wild-type enzymes, the metal sites of the purified proteins are either completely (FeSOD, 1.17) or nearly fully occupied by the metal ion from which the SOD derives, and very little of the contrary metal is present (Table 2) This result demonstrates the selectivity of each of the wild-type enzymes for its respective Table Metal contents of mutant superoxide dismutases Metal content was measured by atomic absorbance and is given as the number of metal ions per subunit protein Metal content expressed (mol metalỈmol SOD)1) SOD Iron superoxide dismutase Fe[wt] Fe[Q69G] Fe[A141Q] Fe[Q69G/A141Q] Iron mutants 1.17 1.06 0.80 0.83 Manganese Ratioa 0.07 0.02 0.05 0.16 16 49 15 Manganese superoxide dismutase mutants Mn[wt] 0.03 0.71 Mn[G77Q] 0.04 0.39 Mn[Q146A] 0.00 0.50 Mn[G77Q/Q146A] 0.23 0.87 23 10 100 a Ratio is given as Fe : Mn content (iron superoxide dismutase mutants) and Mn : Fe content (manganese superoxide dismutase mutants) Ó FEBS 2002 Active-site glutamines in SODs (Eur J Biochem 269) 5143 0.8 A B OD600 0.6 0.4 0.2 0.0 0.0 2.5 5.0 7.5 10.0 0.0 Time (Hr) 2.5 5.0 7.5 10.0 Fig Effect of GST-SODs expressed in E coli OX326A DsodA, DsodB cells under paraquat-induced oxidative stress E coli OX326A (DsodA, DsodB) cells harbouring the appropriate plasmid were grown to exponential phase and used to inoculate media containing IPTG (0.1 mM) and paraquat (250 lM) Cell growth was then followed by measuring the optical density at 600 nm (A) FeSOD samples Cells expressing GST-SOD fusion proteins for GST-Fe[wt] (h), GST-Fe[A141Q] (n), GST-Fe[Q69G] (e) and GST-Fe[Q69G/A141Q] (s) or the pGHX(–) vector alone (·) (B) MnSOD samples Cells expressing GST-SOD fusion proteins for Mn[wt] (j), Mn[G77Q] (m), Mn[Q146A] (r) and Mn[G77Q/Q146A] (d) or the pGHX(–) vector alone (·) metal in vivo and corresponds to a ratio around 20 times in favour of the ÔcorrectÕ metal This ratio of correct to incorrect metal in the active site of the enzyme is greatly increased by more than two fold to greater than 50 times when the active-site glutamine residue is removed (Fe[Q69G] and Mn[Q146A], Table 2) Although all of the sites are metallated in the Fe[Q69G] mutant, only half of the sites appear to be occupied in the Mn[Q146A] mutant Selectivity for metal is somewhat reduced in Mn[G77Q] and similar to wild type in Fe[A141Q] but is greatly reduced in the double mutants Fe[Q69G/A141Q] and Mn[G77Q/ Q146A] where the ratio of correct to incorrect metal is lower than (Table 2) As SODs are active only when a metal ion is present in at least one active site of the dimeric enzyme, we recalculated the specific activity of each mutant enzyme on a Ôper metal ionÕ basis using values obtained for the correct metal Relative results not vary significantly from the specific activities on a Ôper mg proteinÕ basis, except for Mn[G77Q] which was not very well metallated and its specific activity becomes very similar to that of the wild-type enzyme (Table 1) Protection against paraquat-induced stress As the GST-SOD fusion proteins are active SODs, we tested the ability of the mutant enzymes to protect SOD minus E coli cells from the effects of oxidative stress The herbicide paraquat was used to induce oxidative stress in E coli and acts via the electron transport chain to produce superoxide anions intracellularly [45] Both stress and protein expression were induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG used for the experiment presented were chosen empirically to give differential growth rates between the mutant enzymes Expression of each mutant SOD was similar (approximately 40% of total protein) and did not change throughout the time course of the experiment, being similar to expression levels observed in overnight cultures (results not shown) As illustrated in Fig 3A,B, growth rates of OX326A (DsodA DsodB) cells harbouring the expression vector are very slow under the selected conditions As can be seen by comparison of Fig 3A with Fig 3B, increases in growth rates of the induced cultures varies similarly between the different mutants of FeSOD and MnSOD, although absolute growth rates are somewhat different (results not shown) Cells harbouring the double mutants (Fe[Q69G/A141Q] and Mn[G77Q/ Q146A]) grow with the fastest rates (circles, Fig 3), with wild-type enzymes and SODs lacking a glutamine residue (Fe[Q69G] and Mn[Q146A]) demonstrating equivalent growth rates representative of the slowest of the SODcontaining cells (squares and diamonds, respectively, Fig 3) SOD mutants which contain an extra glutamine (Fe[A141Q] and Mn[G77Q]) exhibit growth rates between wild-type and double mutants (triangles, Fig 3) This is a somewhat surprising result as we had previously shown that under equivalent conditions, cellular growth rates are proportional to the specific activity of the SOD being expressed by the cell type [24] In this experiment, this is clearly not the case Several repeated experiments under slightly different conditions lead to the same conclusive result Effect of hydrogen peroxide on enzyme activity Hydrogen peroxide, the product of the SOD reaction, is an inhibitor of SODs and an inactivator of FeSOD It is often used to distinguish between the two types of isoenzyme, particularly in conjunction with native PAGE gels stained for SOD activity, where mM concentrations inhibit FeSODs but leave MnSODs virtually unaffected [46] We found that there was very little difference between any of three active MnSOD types when incubated with hydrogen peroxide at a concentration of mM prior to spectrophotometric assay of SOD activity (Materials and methods and Fig 4) FeSOD mutants, however, could be distinguished by their different sensitivities to 0.25 mM Ó FEBS 2002 5144 T Hunter et al (Eur J Biochem 269) 100 80 80 Residual Activity (%) Residual SOD Activity (%) 100 60 40 20 0 10 20 30 Time (min.) 40 50 Fig Effect of hydrogen peroxide on the activity of SODs Samples of purified SOD were incubated with hydrogen peroxide (0.25 mM for FeSODs and mM for MnSODs) at 22 °C At the indicated times, aliquots were removed for analysis These were calculated to give unit of SOD activity in the standard SOD assay conditions used and all values were normalized to this At least three independent measurements were made for each data point Samples shown are Fe[wt] (h), Fe[A141Q] (n), Fe[Q69G] (e) Fe[Q69G/A141Q] (s), Mn[wt] (j), Mn[G77Q] (m) and Mn[G77Q/Q146A] (d) Mn[Q146A] is not represented due to its lack of measurable activity even at high protein concentration hydrogen peroxide (Fig 4) Most sensitive was the mutant containing two glutamines, Fe[A141Q] (50% inhibited after min), wild-type FeSOD was similarly inhibited to 50% after min, the double mutant Fe[Q69G/A141Q] after and the least sensitive was Fe[Q69G] (50% inhibited after 11 min) (Fig 4) Hydrogen peroxide inactivates FeSODs via a Fenton reaction with the iron metal at the active site The presence of iron is therefore a prerequisite for its effect and suggests that the absence of reactivity with the MnSOD mutants is due to the lack of activity in these mutants with iron at the active site, despite there being some 20% iron in the Mn[G77Q/Q146A] mutant (Tables and 2) The differential effects of hydrogen peroxide on the FeSOD mutants may be explained by an alteration of reactivity induced by the electronic configuration of active site residues, in this case glutamine 69 (or 141) Sensitivity to hydrogen peroxide was observed to increase in the order: no glutamine < Q141 < Q69 < two glutamines Effect of azide on enzyme activity Azide has similarly been used to discriminate between different SOD types [47], FeSOD exhibiting a higher sensitivity than MnSODs In our assay procedure (Materials and Methods) there appeared to be little to distinguish any of the FeSOD mutants from the wild-type enzyme, exhibiting a Ki of between 1.0 and 2.0 mM (Fig 5) All the FeSOD mutants, however, appeared to be more inhibited at 60 40 20 0 Sodium Azide (mM) 10 Fig Effect of azide on the activity of SOD Samples of purified SODs were adjusted to give unit of SOD activity under standard assay conditions Changes in the observed activity in the presence of azide were normalized to this as a percentage Aliquots of each SOD were added to sodium azide at the appropriate concentration to yield the required concentration of azide in the complete assay solution, and assayed immediately At least three independent measurements were made for each data point Samples shown are Fe[wt] (h), Fe[A141Q] (n), Fe[Q69G] (e), Fe[Q69G/A141Q] (s), Mn[wt] (j), Mn[G77Q] (m) and Mn [G77Q/Q146A] (d) Mn[Q146A] is not represented due to its lack of measurable activity even at high protein concentrations higher azide concentrations than did wild type (Fig 5) Fe[Q69G] was inhibited to a greater degree at lower azide concentrations than other FeSODs, but was not affected to the same extent at 10 mM azide, a concentration which virtually eliminated any activity from Fe[A141Q] or Fe[Q69G/A141Q] (Fig 5) Although not affected to the same extent as FeSOD derivatives, the Mn[G77Q/Q146A] mutant showed a similar sensitivity to azide as Mn[wt] (Ki approx 12.0 mM), and Mn[Q146A] was apparently the least sensitive of all SODs tested (Ki approx 40 mM, results not shown and Fig 5) Effect of temperature on enzyme activity The thermostability of the enzymatic activity of the SOD mutants was investigated at 50 °C (Fig 5) Mn[wt] is inherently less thermostable than Fe[wt], as shown in Fig 6, where the relative activity of Fe[wt] takes 50 to reduce to 50% while Mn[wt] takes only The most dramatic differences in thermostability were observed for those enzymes that have gained a second glutamine residue Mn[G77Q] was found to be the most thermostable of the enzymes studied, and maintained almost full activity for over one hour (Fig 6) In contrast, Fe[A141Q] was found to be the most thermolabile of the enzymes Its SOD activity was reduced by half within of incubation at 50 °C and reducing to zero within 20 (Fig 6) The Fe[Q69G] mutation demonstrated a thermal stability profile very similar to that of Fe[wt], and Ó FEBS 2002 Active-site glutamines in SODs (Eur J Biochem 269) 5145 Residual SOD activity (%) 100 80 60 40 20 0 20 40 60 Time (min.) 80 Fig Effect of temperature on SOD activity Samples of SOD at the appropriate concentrations were incubated at 50 °C for the indicated times Aliquots were removed for analysis of SOD activity and were calculated to give unit of SOD activity in the standard SOD assay conditions used and all values were normalized to this At least three independent measurements were made for each data point Samples shown are Fe[wt] (h), Fe[A141Q] (n), Fe[Q69G] (e) Fe[Q69G/ A141Q] (s), Mn[wt] (j), Mn[G77Q] (m) and Mn[G77Q/Q146A] (d) Mn[Q146A] is not represented due to its lack of measurable activity even at high protein concentration the Mn[Q146A] mutant could not be assayed due to its lack of activity Most significantly, however, the double mutant enzymes demonstrated thermal profiles similar to their isoenzyme counterpart Fe[Q69G/A141Q] exhibited a half-time of similar to Mn[wt], and Mn[G77Q/Q146A] exhibited a half-time of 50 similar to that of Fe[wt] (Fig 6) These results suggest a structural role for these glutamine residues in the mononuclear SODs DISCUSSION The basis for metal cofactor selectivity in vivo and metal ion reaction specificity in the homologous FeSODs and MnSODs has been difficult to ascertain by comparative analyses of sequence and/or structural information Several MnSODs and FeSODs have been crystallized [11–21], MnSOD has been crystallized containing an iron ion [48] and cambialistic SOD holoenzyme structures have been compared reconstituted with different metals [21] Furthermore, a plethora of SOD sequences is available from the DNA and protein sequence databases There appears, therefore to be no obvious sequence or structural signal that determines selectivity or specificity in this important class of metalloenzymes Despite recent reports of changes in metal specificity in engineered SOD enzymes [31,32], the results have been unspectacular, resulting in small increases in enzyme activity in SOD holoenzymes reconstituted with the ÔwrongÕ metal Unfortunately, the H145E mutation of Mycobacterium tuberculosis FeSOD which produces an active MnSOD [49] bears no relevance to the central question of specificity as no other SODs with this mutation exist naturally The nature of this phenomenon still remains elusive Metal specificity may be considered as consisting of two, presumably distinct, stages First, selectivity in vivo of the proteins for their metal cofactor is a prerequisite, as the proteins must fold de novo about their corresponding metal ion Even at this stage it is unclear as to whether the enzymes utilize a divalent or trivalent metal ion during folding, or whether, like their copper- and zinc-containing SOD counterparts, they utilize a chaperone to transfer only the correct metal [50] Mononuclear SODs appear to fold with only the correct metal when presented with both, whether in vivo or in vitro [3,4] Second, specificity of the reaction is determined by the metal ion: the enzyme is active only with the ÔcorrectÕ metal Although, in the complete absence of the ÔcorrectÕ metal, each type of SOD may be forced to fold with the ÔincorrectÕ metal at its active centre, the resulting enzyme is no longer an active SOD [3,4] Here we report differences in metal selectivity in mutations that affect residues which contribute to the hydrogen bonding network around the metal and metal-ligand residues (Table 2) Selectivity appears to follow a pattern dependent upon the presence and orientation of the activesite Q69 (FeSOD) or Q146 (MnSOD) The ratio of metals incorporated into SOD mutants examined showed a reduction in selectivity in the order: no glutamine > one glutamine[wt] > two glutamines > one glutamine (the double mutants) Thus the presence and position of this residue affects in vivo, the selectivity for metal ion (Table 2) Changes in metal selectivity were not apparently related to the activity of the mutant enzymes (Table 1) Mutants lacking a glutamine residue showed the highest selectivity but either low or no discernible SOD activity Double mutants showed reasonable levels of activity, with the Mn[G77Q/Q146A] mutant actually exceeding that of wildtype MnSOD to 150% (Table 1) This is in contrast to the activity of the same mutant reported previously as 75% [32] However, methodological differences exist in these two studies which make accurate and direct comparisons extremely unreliable Also, these authors observed an iron-supported activity in this mutant of some 7% We have observed no changes in the hydrogen peroxide sensitivity of this mutant compared to wild type (Fig 3), though the high manganese-supported activity may mask any changes in our experiments Furthermore, in vivo experiments which produced iron-containing enzymes Fe[wt], Fe[Q69G/A141Q], Mn[wt] and Mn[G77Q/Q146A] using anaerobic culture conditions in the presence of iron and absence of manganese salts [3], generated only active Fe[wt] and Fe[Q69G/A141Q] enzymes (results not shown) Both Mn[wt] and Mn[G77Q/Q146A] were inactive when cultured under these conditions which favour the insertion of iron into the active site of SODs [3] (results not shown) Hydrogen peroxide inhibits MnSOD as it is the product of the enzymatic dismutation of the superoxide radical In addition to this, however, FeSODs are inactivated by hydrogen peroxide [46] A Fenton reaction with the coordinated iron produces a peroxide radical which then attacks critical residues near the iron active centre This residue has been shown to be a tryptophan in other SODs [46,51–53] Reduction of SOD activity at relatively low Ó FEBS 2002 5146 T Hunter et al (Eur J Biochem 269) levels of hydrogen peroxide has therefore been used as an indicative marker for the presence of iron at the active site and, indeed, is frequently used to determine the type of SOD isoenzyme present in a sample [49] Both wild-type and mutant MnSODs were affected to some extent by hydrogen peroxide but showed no significant differences (Fig 3) FeSODs were affected to differing degrees, but in general all demonstrated a similar inactivation to wild type The least affected was Fe[Q69G] followed by Fe[Q69G/A141Q], Fe[wt] with Fe[A141Q] being the most affected (Fig 3) Although steric effects may need to be considered, the glutamine appears to play a role in hydrogen peroxide sensitivity (the presence of two glutamine residues generates a more sensitive enzyme, whereas the absence of any glutamine residue in the active site renders the enzyme more sensitive) The reason for this is unclear Azide, like hydrogen peroxide, is also often used to discriminate between FeSOD and MnSODs as the latter are usually much less sensitive to its inhibitory action [47] The effect of azide, a substrate analogue, showed no prominently different behaviour between mutant SODs, though Mn[G77Q/Q146A] was significantly less sensitive to azide than wild type or Mn[G77Q] In addition, all FeSOD mutants were significantly, though only slightly, more sensitive to azide than wild type The order in which azide effects the FeSOD mutant proteins may reflect the accessibility of the active site to this compound (Fe[wt] < Fe[Q69G/A141Q] < Fe[A141Q] < Fe[Q69G], Fig 4) as this trend matches the degree of steric hindrance to be expected from these mutations, if azide were to approach the active site via the substrate funnel The orientation of azide bound in the active site appears to be different for FeSOD and MnSOD enzymes [11] Bound azide is contained within a pocket formed by no less than six ˚ ˚ residues all within A (azide N1 comes within 2.1 A of the metal ion) Azide binding residues include the three His metal ligands (H26, H81 and H171) and gateway residues H30 and H34 A further gateway residue, H31, is involved in FeSOD but not in MnSOD Only in MnSOD is the active site glutamine (Q146) also in proximity to the bound azide Azide binding could therefore be affected by electrostatic interactions as well as steric interference by the mutational changes studied The most striking change in physical characteristics of the mutant SODs was revealed in temperature-sensitivity studies (Fig 5) These showed that double mutations in each enzyme (Fe[Q69G/A141Q] and Mn[G77Q/Q146A]) endowed the mutant with a similar temperature-deactivation profile to that of its opposing wild-type enzyme (Mn[wt] and Fe[wt], respectively) We show therefore that the position of this glutamine residue in the active site is responsible for this behaviour, presumably primarily through its participation in a hydrogen-bonding network involving other residues and solvent molecules An unexpected result was the extremely high thermostability of Mn[G77Q] and the very low thermostability of Fe[A141Q] (Fig 5) Each of these mutants has two glutamine residues in their active sites; one from the Ônaturally occurringÕ residue, the other engineered to mimic its counterpart Molecular modelling [34] indicates that the active sites of both MnSOD and FeSOD would most probably not be able to accommodate a second glutamine residue (results not shown) The most stable conformations of these mutants leave one glutamine extended away from the active site and stabilized by hydrogen bonding to an Asn residue Q77 is capable of hydrogen bonding with N74 or Q146 with N73 As the numbering indicates, N73 and N74 lie adjacent to each other, and both are conserved in FeSOD and MnSOD sequences Simulation suggests that Q77 bonding to N74 also disrupts the active site residues, causing a shift in the position of Y34 and a twist in the ring of the metalbinding H81 Thermostability is not a new phenomenon amongst SODs; those isolated from hyperthermophilic organisms, for example, exhibit similarly high thermostability [16,17,54,55] Recent mutational studies of the FeSOD from Aquifex pyrophilus demonstrate the importance of hydrogen bonding patterns on thermal stability [54] It is not possible to predict which of the glutamine residues will be distorted out of the active site, or for which of the mutants, but it may be more likely that the FeSOD[A141Q] with lowest activity has the largest disruption around the active site Although hydrogen bond pairs and bond strengths may have been altered in the mutations discussed, other effects due to repackaging of the active site around the hydrophobic stem of this residue and the corresponding alanine replacement also should not be ignored Nor too should the possible inclusion of water molecules into the active site as has been reported for human MnSOD[Q143A] [30] Extension of these effects through the dimer interface via local residues may also be important, though all these possibilities remain highly speculative at this time Elucidation of the structures of the mutants presented here should help to explain the chemical nature of the physical effects observed It seems certain, however, that metal selectivity and specificity in the mononuclear SODs is not governed by one or even two residues, but is most likely accomplished by the concerted effects of a combination of key residues Further analysis of these and other mutant SODs is currently underway ACKNOWLEDGEMENTS We are indebted to G Peplow, F Yamakura and T Matsumoto for the analyses of iron and manganese in protein samples We also wish to thank H Steinman for the gift of E coli OX326A We finally thank Mr M Farrugia for photographic assistance REFERENCES Jackson, S.M & Cooper, J.B (1998) An analysis of structural similarity in the iron and manganese superoxide dismutases based on known structures and sequences Biometals 11, 159–173 Bannister, J.V., Bannister, W.H & Rotilio, G (1987) Aspects of the structure, function, and applications od superoxide dismutase Crit Rev Biochem 22, 111–180 Beyer, W.F & Fridovich, I (1991) In vivo competition between iron and manganese for the occupancy of the active site region of the manganese-superoxide dismutase of Escherichia coli J Biol Chem 266, 303–308 Ose, D.E & Fridovich, I (1979) Manganese-containing superoxide dismutase from Escherichia coli: reversible resolution and metal replacements Arch Biochem Biophys 194, 360–364 Brock, C.J & Harris, J.L (1977) Superoxide dismutase from Bacillus stearothermophilus: reversible removal of manganese and its replacement by other metals Biochem Soc Trans 5, 1533– 1539 Ó FEBS 2002 Yamakura, F & Suzuki, K (1980) Cadmium, chromium and manganese replacement for iron in iron-superoxide dismutase from Pseudomonas ovalis J Biochem 88, 191–196 Parker, M.W., Blake, C.C.F., Barra, D., Bossa, F., Schinina, M.E., Bannister, W.H & Bannister, J.V (1987) Structural identity between the iron- and manganese-containing superoxide dismutases Protein Eng 1, 393–397 Meier, B., Sehn, A.P., Schinina, M.E & Barra, D (1994) In vivo incorporation of copper into the iron-exchangeable and manganese-exchangeable superoxide dismutase from Propionibacterium shermanii Amino acid sequence and identity of the protein moieties Eur J Biochem 219, 463–468 Amano, A., Shizukuishi, S., Tamagawa, H., Iwakura, K., Tsunasawa, S & Tsunemitsu, A (1990) Characterization of superoxide dismutases purified from either anaerobically maintained or aerated Bacteroides gingivalis J Bacteriol 172, 1457–1463 10 Chen, Y & Gregory, E.M (1991) In vivo metal substitution in Bacteroides fragilis superoxide dismutase Free Rad Res Commun 12, 313–318 11 Lah, M.S., Dixon, M.M., Pattridge, K.A., Stallings, W.C., Fee, J.A & Ludwig, M.L (1995) Structure-function in Escherichia coli iron superoxide dismutase: comparisons with the manganese enzyme from Thermus thermophilus Biochemistry 34, 1646–1660 12 Cooper, J.B., McIntyre, K., Badasso, M.O., Wood, S.P., Zhang, Y., Garbe, T.R & Young, D (1995) X-ray structure analysis of iron-dependent superoxide dismutase from Mycobacterium tuberculosis at 2.0 Angstroms resolution reveals novel dimer– dimer interactions J Mol Biol 246, 531–544 13 Parker, M.W & Blake, C.F (1988) Crystal structure of manganese superoxide dismutase from Bacillus stearothermophilus at 2.4 ˚ A resolution J Mol Biol 199, 649–661 14 Ludwig, M.L., Metzger, A.L., Pattridge, K.A & Stallings, W.C (1991) Manganese superoxide dismutase from Thermus thermophilus A structural model refined at 1.8 Angstrom resolution J Mol Biol 219, 335–358 15 Sugio, S., Hiraoka, B.Y & Yamakura, F (2000) Crystal structure of cambialistic superoxide dismutase from porphyromonas gingivalis Eur J Biochem 267, 3487–3495 16 Knapp, S., Kardinahl, S., Hellgren, N., Tibbelin, G., Schafer, G & Ladenstein, R (1999) Refined crystal structure of a superoxide dismutase from the hyperthermophilic archaeon Sulfolobus ˚ acidocaldarius at 2.2 A resolution J Mol Biol 285, 689–702 17 Ursby, T., Adinolfi, B.S., Al-Karadaghi, S., De Vendittis, E & Bocchini, V (1999) Iron superoxide dismutase from the archaeon Sulfolobus solfataricus: analysis of structure and thermostability J Mol Biol 286, 189–205 18 Bond, C.J., Huang, J., Hajduk, R., Flick, K.E., Heath, P.J & Stoddard, B.L (2000) Cloning, sequence and crystallographic structure of recombinant iron superoxide dismutase from Pseudomonas ovalis Acta Crystallogr D Biol Crystallogr 56, 1359– 1366 19 Lim, J.H., Yu, Y.G., Han, Y.S., Cho, S., Ahn, B.Y., Kim, S.H & Cho, Y (1997) The crystal structure of an Fe-superoxide dismutase from the hyperthermophile Aquifex pyrophilus at 1.9 A resolution: structural basis for thermostability J Mol Biol 270, 259–274 20 Edwards, R.A., Baker, H.M., Jameson, G.B., Whittaker, M.M., Whittaker, J.W & Baker, E.N (1998) Crystal structure of ˚ Escherichia coli manganese superoxide dismutase at 2.1 A resolution J Biol Inorg Chem 3, 161–171 21 Schmidt, M., Meier, B & Parak, F (1996) X-ray structure analysis of the cambialistic superoxide dismutase from Propionibacterium shermanii active with Fe or Mn J Biol Inorg Chem 1, 532–541 22 Borgstahl, G.E., Pokross, M., Chehab, R., Sekher, A & Snell, E.H (2000) Cryo-trapping the six-coordinate, distorted-octahedral active site of manganese superoxide dismutase J Mol Biol 296, 951–959 Active-site glutamines in SODs (Eur J Biochem 269) 5147 23 Tierney, D.L., Fee, J.A., Ludwig, M.L & Pennerhahn, J.E (1995) X-ray absorption spectroscopy of the iron site in Escherichia coli Fe(III) superoxide dismutase Biochemistry 34, 1661–1668 24 Hunter, T., Ikebukuro, K., Bannister, W.H., Bannister, J.V & Hunter, G.J (1997) The conserved residue tyrosine 34 is essential for maximal activity of iron-superoxide dismutase from Escherichia coli Biochemistry 36, 4925–4933 25 Edwards, R.A., Whittaker, M.M., Whittaker, J.W., Baker, E.N & Jameson, G.B (2001) Removing a hydrogen bond in the dimer interface of Escherichia coli manganese superoxide dismutase alters structure and reactivity Biochemistry 40, 4622–4632 26 Sorkin, D.L., Duong, D.K & Miller, A.F (1997) Mutation of tyrosine 34 to phenylalanine eliminates the active site pK of reduced iron-containing superoxide dismutase Biochemistry 36, 8202–8208 27 Edwards, R.A., Whittaker, M.M., Whittaker, J.W., Baker, E.N & Jameson, G.B (2001) Outer sphere mutations perturb metal reactivity in manganese superoxide dismutase Biochemistry 40, 15–27 28 Hearn, A.S., Tu, C., Nick, H.S & Silverman, D.N (1999) Characterization of the product-inhibited complex in catalysis by human manganese superoxide dismutase J Biol Chem 274, 24457–24460 29 Hsieh, Y., Guan, Y., Tu, C., Bratt, P.J., Angerhofer, A., Lepock, J.R., Hickey, M.J., Tainer, J.A., Nick, H.S & Silverman, D.N (1998) Probing the active site of human manganese superoxide dismutase: the role of glutamine 143 Biochemistry 37, 4731–4739 30 Leveque, V.J., Stroupe, M.E., Lepock, J.R., Cabelli, D.E., Tainer, J.A., Nick, H.S & Silverman, D.N (2000) Multiple replacements of glutamine 143 in human manganese superoxide dismutase: effects on structure, stability, and catalysis Biochemistry 39, 7131– 7137 31 Hiraoka, B.Y., Yamakura, F., Sugio, S & Nakayama, K (2000) A change of the metal-specific activity of a cambialistic superoxide dismutase from Porphyromonas gingivalis by a double mutation of Gln-70 to Gly and Ala-142 to Gln Biochem J 345, 345–350 32 Schwartz, A.L., Yikilmaz, E., Vance, C.K., Vathyam, S., Koder, R.L & Miller, A.F (2000) Mutational and spectroscopic studies of the significance of the active site glutamine to metal ion specificity in superoxide dismutase J Inorg Biochem 80, 247–256 33 Koradi, R., Billeter, M & Wuthrich, K (1996) MOLMOL: a program for display and analysis of macromolecular structures J Mol Graph 14, 29–32 34 Lee, C & Irizarry, K (2001) The GeneMine system for genome/ proteome annotation and collaborative data mining IBM Systems J 40, 592–603 35 Shindyalov, I.N & Bourne, P.E (2001) A database and tools for 3-D protein structure comparison and alignment using the Combinatorial Extension (CE) algorithm Nucleic Acids Res 29, 228– 229 36 Hunter, T & Hunter, G.J (1998) GST fusion protein expression vector for in-frame cloning and site-directed mutagenesis Biotechniques 24, 194 37 Sanger, F., Nicklen, S & Coulson, A.R (1977) DNA sequencing with chain-terminating inhibitors Proc Natl Acad Sci USA 74, 5463–5467 38 Taylor, J.W., Ott, J & Eckstein, F (1985) The rapid generation of oligonucleotide-directed mutations at high frequency using phosphorothioate-modified DNA Nucleic Acids Res 13, 8764–8785 39 McCord, J.M & Fridovich, I (1969) Superoxide dismutase: an enzymic function for erythrocuprein (hemocuprein) J Biol Chem 244, 6049–6055 40 Ysebaert-Vanneste, M & Vanneste, W.H (1980) Quantitative resolution of Cu,Zn- and Mn-superoxide dismutase activities Anal Biochem 107, 86–95 41 Laemmli, U (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685 Ó FEBS 2002 5148 T Hunter et al (Eur J Biochem 269) 42 Beauchamp, C & Fridovich, I (1971) Superoxide dismutase; improved assays and an assay applicable to acrylamide gels Anal Biochem 44, 276–287 43 Bradford, M.M (1976) A rapid and sensitive method for quantitation of microgram quantities of protein utilising the principle of protein binding Anal Biochem 72, 248–254 44 Amann, E., Ochs, B & Abel, K.-J (1988) Tightly regulated tac promotor vectors useful for the expression of unfused and fused proteins in Escherichia coli Gene 69, 301–315 45 Hassan, H.M & Fridovich, I (1978) Superoxide radical and the oxygen enhancement of the toxicity of paraquat in Escherichia coli J Biol Chem 253, 8143–8148 46 Beyer, W.F Jr & Fridovich, I (1987) Effect of hydrogen peroxide on the iron-containing superoxide dismutase of Escherichia coli Biochemistry 26, 1251–1257 47 Misra, H.P & Fridovich, I (1978) Inhibition of superoxide dismutase by azide Arch Biochem Biophys 189, 317 48 Edwards, R.A., Whittaker, M.M., Whittaker, J.W., Jameson, G.B & Baker, E.N (1998) Distinct metal environment in Fesubstituted manganese superoxide dismutase provides a structural basis of metal specificity J Am Chem Soc 120, 9684 49 Bunting, K., Cooper, J.B., Badasso, M.O., Tickle, I.J., Newton, M., Wood, S.P., Zhang, Y & Young, D (1998) Engineering a change in metal-ion specificity of the iron-dependent superoxide dismutase from Mycobacterium tuberculosis – X-ray structure analysis of site-directed mutants Eur J Biochem 251, 795–803 50 Portnoy, M.E., Rosenzweig, A.C., Rae, T., Huffman, D.L., O’Halloran, T.V & Culotta, V.C (1999) Structure-function 51 52 53 54 55 analyses of the ATX1 metallochaperone J Biol Chem 274, 15041–15045 Meier, B., Sehn, A.P., Michel, C & Saran, M (1994) Reactions of hydrogen peroxide with superoxide dismutase from Propionibacterium shermanii – an enzyme which is equally active with iron or manganese ) are independent of the prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G.A., Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and destruction of conserved Trp159 of Fesuperoxide dismutase from Porphyromonas gingivalis by hydrogen peroxide Eur J Biochem 253, 49–56 Gabbianelli, R., Battistoni, A., Capo, C., Polticelli, F., Rotilio, G., Meier, B & Desideri, A (1997) Effect of Val73 fi Trp mutation on the reaction of ÔcambialisticÕ superoxide dismutase from Propionibacterium shermanii with hydrogen peroxide Arch Biochem Biophys 345, 156–159 Lim, J.H., Hwang, K.Y., Choi, J., Lee, D.Y., Ahn, B.Y., Cho, Y., Kim, K.S & Han, Y.S (2001) Mutational effects on thermostable superoxide dismutase from Aquifex pyrophilus: understanding the molecular basis of protein thermostability Biochem Biophys Res Commun 288, 263–268 Kardinahl, S., Anemuller, S & Schafer, G (2000) The hyperthermostable Fe-superoxide dismutase from the Archaeon Acidianus ambivalens: characterization, recombinant expression, crystallization and effects of metal exchange Biol Chem 381, 1089–1101  ... effects of a combination of key residues Further analysis of these and other mutant SODs is currently underway ACKNOWLEDGEMENTS We are indebted to G Peplow, F Yamakura and T Matsumoto for the analyses... D., Hiraoka, B .Y. , Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and destruction of conserved Trp159 of Fesuperoxide dismutase from Porphyromonas gingivalis by hydrogen... result was the extremely high thermostability of Mn[G77Q] and the very low thermostability of Fe [A1 41Q] (Fig 5) Each of these mutants has two glutamine residues in their active sites; one from the