Tài liệu Báo cáo khoa học: Phosphorylation of cyclin dependent kinase 4 on tyrosine 17 is mediated by Src family kinases pptx

Phosphorylation of cyclin dependent kinase on tyrosine 17 is mediated by Src family kinases Nicholas G Martin, Peter C McAndrew, Paul D Eve and Michelle D Garrett Cancer Research UK Centre for Cancer Therapeutics at The Institute of Cancer Research, Haddow Laboratories, Sutton, UK Keywords CDK4; C-YES; Src; tyrosine phosphorylation; WEE1 Correspondence M D Garrett, Cancer Research UK Centre for Cancer Therapeutics at The Institute of Cancer Research, Haddow Laboratories, 15 Cotswold Road, Sutton, Surrey SM2 5NG, UK Fax: +44 020 87224126 Tel: +44 020 87224352 E-mail: michelle.garrett@icr.ac.uk (Received 19 December 2007, revised 19 March 2008, accepted 11 April 2008) doi:10.1111/j.1742-4658.2008.06463.x Cyclin dependent kinase is a key regulator of the cell cycle and its activity is frequently deregulated in cancer The activity of cyclin dependent kinase is controlled by multiple mechanisms, including phosphorylation of tyrosine 17 This site is equivalent to tyrosine 15 of cyclin dependent kinase 1, which undergoes inhibitory phosphorylation by WEE1 and MYT1; however, the kinases that phosphorylate cyclin dependent kinase on tyrosine 17 are still unknown In the present study, we generated a phosphospecific antibody to the tyrosine 17-phosphorylated form of cyclin dependent kinase 4, and showed that this site is phosphorylated to a low level in asynchronously proliferating HCT116 cells We purified tyrosine 17 kinases from HeLa cells and found that the Src family non-receptor tyrosine kinase C-YES contributes a large fraction of the tyrosine 17 kinase activity in HeLa lysates C-YES also phosphorylated cyclin dependent kinase when transfected into HCT116 cells, and treatment of cells with Src family kinase inhibitors blocked the tyrosine 17 phosphorylation of cyclin dependent kinase Taken together, the results obtained in the present study provide the first evidence that Src family kinases, but not WEE1 or MYT1, phosphorylate cyclin dependent kinase on tyrosine 17, and help to resolve how the phosphorylation of this site is regulated Cyclin dependent kinase (CDK) ⁄ cyclin D kinase is an important regulator of cell cycle entry and G1 progression, where it initiates inhibitory phosphorylation of the retinoblastoma tumour suppressor protein RB [1–3], a critical step for progression into the S-phase [4–6] Unsurprisingly, considering its pivotal role in cell cycle control, CDK4 ⁄ cyclin D kinase activity is commonly deregulated in cancer The majority of cancers contain at least one genetic alteration that affects the RB pathway [7], and a better understanding of how CDK4 ⁄ cyclin D kinase is controlled could provide new therapeutic targets and strategies for the treatment of cancer The activity of the CDK4 ⁄ cyclin D holoenzyme is regulated by multiple mechanisms, the most important of which is the association of CDK4 with the D-type cyclin subunit, a requirement for kinase activity [8,9] One of the most poorly understood mechanisms by which CDK4 ⁄ cyclin D kinase activity is controlled is phosphorylation at tyrosine 17 (Y17) of CDK4 This site corresponds to tyrosine 15 (Y15) of CDK1 (Cdc2), a site of inhibitory phosphorylation on this kinase [10,11] Phosphorylation on Y17 of CDK4 has been shown to occur in mammalian cells that are entering the cell cycle from quiescence, and then undergo G1 arrest induced by UV irradiation [12,13] In these studies, the activation of wild-type CDK4 was inhibited by UV irradiation, whereas a Y17F nonphosphorylatable mutant form of CDK4 was activated normally, demonstrating that phosphorylation of CDK4 on Y17 is inhibitory to kinase activity [12] Expression of the Y17F mutant of CDK4 abrogated the UV-induced G1 Abbreviations CDK, cyclin dependent kinase; TGF, transforming growth factor; Y15, tyrosine 15; Y17, tyrosine 17 FEBS Journal 275 (2008) 3099–3109 ª 2008 The Institute of Cancer Research: Royal Cancer Hospital Journal compilation ª 2008 FEBS 3099 Phosphorylation of CDK4 by Src family kinases cell cycle arrest, leading to an increase in chromosomal aberrations and cell death, indicating that phosphorylation of this site is important for integrity of the G1 checkpoint [13] Phosphorylation of CDK4 on Y17 has also been detected in cells entering quiescence in response to contact inhibition, serum starvation and treatment with transforming growth factor (TGF) b [12,14] Taken together, these studies suggest that Y17 phosphorylation of CDK4 regulates G1 phase cell cycle arrest and quiescence The available evidence suggests that the dual specificity phosphatase CDC25A controls removal of phosphate from Y17 of CDK4 The increase in Y17 phosphorylation brought about by TGFb corresponds to a loss of CDC25A [14], and an increase in Y17 phosphorylation of CDK4 has been detected upon chemical inhibition of CDC25A [15–17] Although CDC25A may dephosphorylate the CDK4 Y17 site, the kinase(s) that phosphorylate this residue remain unknown The obvious candidate kinases for this role are WEE1 and MYT1 because they phosphorylate CDK1 on Y15; however, neither is able to phosphorylate CDK4 on Y17 in vitro [18,19] In the present study, we used column chromatography to purify CDK4 Y17 kinases from HeLa cell extracts, and found that the cellular phosphorylation of CDK4 on Y17 is mediated by Src family kinases Results Detection of CDK4 Y17 phosphorylation and kinase activity The N-termini of CDKs 1, 2, and are highly conserved and there is an equivalent residue to the Y17 site of CDK4 in each of these kinases To allow the study of CDK4 Y17 phosphorylation, a phosphospecific antibody to the Y17 site was raised using a 13mer phosphopeptide as the immunogen (Fig 1A) The antibody was purified and was found to be highly specific for the phosphopeptide over the nonphosphopeptide by ELISA (data not shown) To test the site and phosphospecificity of the antibody against full length CDK4, Flag-tagged CDK4 or the nonphosphorylatable Y17F mutant of CDK4 were transfected into HCT116 cells Western blotting using a CDK4 antibody confirmed expression of the exogenous Flag-CDK4 and Flag-CDK4Y17F because they migrate more slowly on the SDS ⁄ PAGE gel than the endogenous CDK4 due to the Flag-tag (Fig 1B) Western blotting of Flag-immunoprecipitates from these cell lysates with the CDK4 Y17 phosphospecific antibody (CDK4 pY17) revealed a low basal level of Y17 phosphorylation that was greatly 3100 N G Martin et al A B C Fig Detection of CDK4 Y17 phosphorylation (A) Alignment of the N-terminal amino acids of CDKs 1, 2, and showing the conserved tyrosine residue (vertical box) that corresponds to Y17 of CDK4, and the peptide used to raise the pY17 antibody (horizontal box) (B) HCT116 cells were transfected with Flag-tagged CDK4 or CDK4Y17F and were treated with or without sodium orthovanadate (200 lM) Lysates were immunoprecipitated with the Flag antibody (Flag IP) The immunoprecipitates and lysates were western blotted with the phosphospecific CDK4 pY17, total CDK4 and aTubulin antibodies as indicated Long and short exposures of the CDK4 pY17 blot are shown (C) Lysates from HT29, HCT116, HeLa cells and HeLa nuclei were assayed for Y17 kinase activity using the 96-well plate format assay Each sample contained 2.5 lg of total protein Values are the average of four samples with error bars indicating the SEM induced by treatment of the cells with the protein tyrosine phosphatase inhibitor sodium orthovanadate No signal was detected in the Flag-CDK4Y17F immunoprecipitates, indicating that the antibody is both phosphospecific and site specific The low basal signal of CDK4 Y17 phosphorylation is in keeping with previous reports that did not detect CDK4 Y17 phosphorylation in asynchronously proliferating cells [12,13] FEBS Journal 275 (2008) 3099–3109 ª 2008 The Institute of Cancer Research: Royal Cancer Hospital Journal compilation ª 2008 FEBS N G Martin et al Phosphorylation of CDK4 by Src family kinases Using the CDK4 pY17 antibody, we developed a 96-well plate format kinase assay to detect Y17 kinases The 13mer non-phosphopeptide was used as the substrate for the kinase(s), and phosphorylation of the peptide was detected using the CDK4 pY17 antibody and a Europium labelled secondary antibody Cell lysates from a range of cell lines were tested for CDK4 Y17 kinase activity (Fig 1C), and activity was detected in all cell lysates with no activity in the buffer control Interestingly, a higher level of activity was detected in HeLa nuclear lysate compared to HeLa whole cell lysate Due to the commercial availability of suitable quantities of HeLa nuclear pellets, these were chosen as the starting material for a purification of CDK4 Y17 kinases Purification of C-YES as a CDK4 Y17 kinase A five-step procedure was used to purify Y17 kinases from HeLa nuclei (Table 1) After each purification step, the Y17 kinase activities and the protein concentrations of the resulting fractions were measured, and a final purification of approximately 939-fold was achieved Purification by butyl-sepharose chromatography resolved the majority of the Y17 kinase activity as a large peak between fractions 96 and 106, towards the end of the ammonium sulfate gradient (Fig 2A) By contrast, western blotting of selected fractions with a WEE1 antibody revealed that WEE1 flowed through the column without binding to the butyl-sepharose resin (Fig 2B) No Y17 kinase activity was detected in the corresponding fractions (Fig 2A), consistent with the previous reports showing that WEE1 does not phosphorylate CDK4 on Y17 [19] The Y17 kinase activity eluted from the hydroxyapatite column as a single peak between fractions 40 and 47, at the start of the phosphate gradient (Fig 2C) Fractions 38–49 and a sample of the input were precipitated using deoxycholate and trichloroacetic acid, and the proteins were separated using SDS ⁄ PAGE A major protein band of approximately 60 kDa was detected by staining with coomassie (Fig 2D) This band tracked with CDK4 Y17 kinase activity with a peak in fraction 42 (Fig 2C) A sample of the band was excised and the constituent proteins were analysed by Q-TRAP MS (Applied Biosystems, Foster City, CA, USA) Forty-nine ions were selected from the sample and sequenced by MS ⁄ MS Forty-seven of these were peptides from the chaperonin HSP60 and two were peptides from the nonreceptor tyrosine kinase C-YES Selected fractions from each of the chromatography steps were western blotted with an antibody specific for C-YES, and C-YES protein tracked with CDK4 Y17 activity over all of the chromatography columns (Fig 2B,E) Src family kinases but not WEE1 or MYT1 phosphorylate CDK4 on Y17 in vitro To confirm that C-YES contributes to the Y17 kinase activity found in cell lysates, C-YES was immunodepleted from HeLa nuclear and whole cell extracts, and both the supernatants and the precipitates were assayed for Y17 kinase activity C-YES was successfully immunodepleted from the nuclear and whole cell lysates and C-YES protein appeared in the precipitates (Fig 3A) Mock depletions where the depleting antibody was substituted for buffer were used as negative controls The supernatants were assayed for Y17 kinase activity using both the tube (Fig 3A) and 96-well plate (Fig 3B) format assays, whereas the precipitates were assayed using the tube format assay only Depletion of C-YES from both the nuclear and whole cell lysates resulted in a concomitant reduction in kinase activity as measured by both plate and tube assays The accumulation of C-YES in the precipitates correlated with the appearance of kinase activity in those samples The level of depletion of kinase activity mirrored the level of depletion of C-YES, indicating that C-YES contributes a large fraction of the Y17 kinase activity in these lysates Immunodepletion from lysates was repeated for the CDK1 Y15 kinases WEE1 (Fig 3C,E) and MYT1 (Fig 3D,E) In both cases, the proteins were Table CDK4 Y17 kinase activity purification from HeLa nuclei Purification step Activity total (counts) Nuclear lysate (NH4)2SO4 precipitation Butyl-sepharose Q-sepharose Superdex 200 Hydroxyapatite 1.4 2.9 8.5 9.6 1.0 7.3 · · · · · · 1011 1011 1010 109 1010 109 Protein (mg) Specific activity (countsỈmg)1) 1670 596 16.2 1.24 0.51 0.09 8.4 4.8 5.3 7.4 2.0 7.9 · · · · · · 107 108 109 109 1010 1010 Recovery (%) Purification (fold) 100 205 61 6.8 7.2 5.2 5.7 62.7 88.8 237 939 FEBS Journal 275 (2008) 3099–3109 ª 2008 The Institute of Cancer Research: Royal Cancer Hospital Journal compilation ª 2008 FEBS 3101 Phosphorylation of CDK4 by Src family kinases successfully depleted from HeLa whole cell lysates; however, this did not result in a loss of Y17 kinase activity In addition, the WEE1 and MYT1 immunoprecipitates did not possess Y17 kinase activity These data indicate that WEE1 and MYT1 not contribute to the CDK4 Y17 kinase activity in these lysates and are unlikely to be CDK4 kinases in cells As further confirmation that the Y17 kinase in HeLa whole cell lysates is a Src family kinase, we assayed its sensitivity to the Src family kinase inhibitor PP2 [20] In comparison, we also assayed the inhibition of purified recombinant kinases C-SRC, C-YES and p49WEE1 by PP2 using the 96-well plate format kinase assay p49WEE1 is a truncated form of human WEE1 that is known to have altered substrate specificity with respect to full length WEE1 [18,21] and has CDK4 Y17 kinase activity in vitro (Fig 4A) PP2 had similar potency against C-SRC, C-YES and the HeLa lysate, but did not inhibit p49WEE1 activity at any concentration This confirms that the Y17 kinase found in HeLa lysate is PP2 sensitive and likely to be a Src family kinase To test whether CDK4 can be a substrate for Src family kinases other than C-YES, recombinant, purified C-SRC, C-YES and LYN were assayed for Y17 kinase activity using full length CDK4 in a tube format kinase assay (Fig 4B) All three kinases phosphorylated the Y17 site, demonstrating that CDK4 kinase activity is not restricted to C-YES in vitro A B C D Src family kinases phosphorylate CDK4 on Y17 in cells E Fig Identification of C-YES as a Y17 kinase (A) The ammonium sulfate precipitated HeLa nuclear lysate was fractionated by butyl-sepharose chromatography and the even numbered fractions were assayed for Y17 kinase activity and protein content (B) Selected fractions from the flow-through (16), wash (48) and gradient (80–116), along with a sample of the column input and the HeLa nuclear lysate, were separated on a 4–12% NuPAGE gel and western blotted with WEE1 and C-YES antibodies (C) The elute from the superdex 200 gel filtration column was fractionated by hydroxyapatite chromatography and the fractions were assayed for Y17 kinase activity and protein content Fractions from the gradient and a sample of the column input were separated on 4–12% NuPAGE gels and proteins were stained with coomassie (D) and western blotted with the C-YES antibody (E) 3102 N G Martin et al To determine whether C-YES can phosphorylate cellular CDK4, empty vector, C-YES, hyperactive C-YESY537F or kinase dead C-YESK305R were cotransfected with empty vector, Flag-CDK4 or FlagCDK4Y17F into HCT116 cells (Fig 5A,B) The Y537 residue of C-YES is equivalent to Y527 of C-SRC and is the site of inhibitory phosphorylation by the protein-tyrosine kinase CSK [22] The exogenous C-YES, C-YESY537F and C-YESK305R were detected in the cell lysates by western blotting with a C-YES antibody, and appeared as a double band that migrated more slowly than endogenous C-YES due to the C-terminal Myc-His-tag The exogenous CDK4 proteins were immunoprecipitated with the Flag antibody and Y17 phosphorylation was detected with the CDK4 pY17 antibody Co-transfection of CDK4 with C-YES enhanced the level of Y17 phosphorylation compared to vector alone, and the level was even greater when the hyperactive C-YESY537F was expressed This confirms that C-YES can regulate the phosphorylation of FEBS Journal 275 (2008) 3099–3109 ª 2008 The Institute of Cancer Research: Royal Cancer Hospital Journal compilation ª 2008 FEBS N G Martin et al Phosphorylation of CDK4 by Src family kinases A B C E D Fig C-YES, but not WEE1 or MYT1, contributes Y17 kinase activity to HeLa lysates (A) C-YES was immunodepleted from HeLa whole cell and nuclear lysates with the C-YES polyclonal antibody and protein G sepharose, and the depleted supernatants and precipitates were western blotted with the C-YES antibody The supernatants and precipitates were assayed for Y17 kinase activity using the tube format kinase assay and western blotting of samples with the phosphospecific CDK4 pY17 antibody and the total CDK4 antibody As negative controls, the samples were mock depleted by substitution of the antibody for buffer The negative controls for the kinase assay were either no lysate (far left hand lane) or antibody and protein G but no lysate (far right hand lane) *Background caused by cross-reactivity with the depleting antibody (B) The C-YES depleted and mock depleted supernatants were assayed for Y17 kinase activity using the 96-well plate format assay Each sample contained 2.5 lg of total protein Values are the average of four samples with error bars indicating the SEM HeLa whole cell lysates were depleted with WEE1 and MYT1 antibodies as described for C-YES and the deleted supernatants were assayed for Y17 kinase activity using the tube format kinase assay (C, D) and the 96-plate format assay (E) CDK4 on Y17 in cells The kinase dead version of C-YES did not increase the level of Y17 phosphorylation (Fig 5B), confirming that the phosphorylation of CDK4 is dependent on the kinase activity of C-YES To determine whether the Src family kinases are responsible for the CDK4 Y17 phosphorylation detected in cells, Flag-CDK4 and Flag-CDK4Y17F were transfected into HCT116 cells, which were then treated with either the vehicle (dimethylsulfoxide) or the Src inhibitors PP2 and SU6656 [23] (Fig 5C) Western blotting of Flag immunoprecipitates from these cells with the CDK4 pY17 antibody revealed that both of the Src inhibitors blocked phosphorylation of CDK4 on Y17 Interestingly, blotting of the lysates with a CDK1 pY15 phosphospecific antibody revealed that the inhibitors did not block the phosphorylation of CDK1 on this site Discussion The aim of the present study was to identify the kinase or kinases that phosphorylate CDK4 on Y17, the equivalent site to Y15 on CDK1 We purified CDK4 Y17 kinase activity from HeLa cells and identified C-YES as a kinase that contributes a large fraction of the Y17 kinase activity found in HeLa lysates C-YES is a 62 kDa nonreceptor tyrosine kinase of the Src family that is expressed in a wide range of tissues [24] The N-terminus of C-YES is dually myristoylated and palmitoylated [25], and these modifications target C-YES to intracellular membranes and exclude it from the nucleus [26] Considering that C-YES is not usually localized to the nucleus, it is interesting that we found a higher concentration of C-YES protein and Y17 kinase activity in our nuclear lysates compared to FEBS Journal 275 (2008) 3099–3109 ª 2008 The Institute of Cancer Research: Royal Cancer Hospital Journal compilation ª 2008 FEBS 3103 Phosphorylation of CDK4 by Src family kinases A N G Martin et al A B B Fig Src family kinases phosphorylate CDK4 on Y17 in vitro (A) HeLa lysates (2.5 lg protein per well), and recombinant purified p49WEE1, C-YES and C-SRC were assayed for Y17 kinase activity using the plate format assay at various concentrations of the Src family kinase inhibitor PP2 Values are the average of four samples normalized to the start activity, with error bars indicating the SEM converted to a percentage as described in the Experimental procedures (B) Recombinant purified Src family kinases C-YES, C-SRC and LYN were assayed for Y17 kinase activity using the tube format assay and western blotting of the samples with the phosphospecific CDK4 pY17 antibody and the total CDK4 antibody As negative controls, the kinases was heat inactivated at 95 °C for prior to the assay, as indicated whole cell lysates (Fig 3A,B) Previous immunofluorescence studies have shown C-YES to be located mainly at the plasma membrane and perinuclear region [26] It is possible that the C-YES found in our nuclear pellets was not genuinely nuclear and was from perinuclear material or other C-YES containing membranes that were not removed during the nuclear fractionation; however, the potential existence of nuclear C-YES warrants further investigation The study then demonstrated that C-YES phosphorylates CDK4 on Y17 when expressed along with CDK4 in HCT116 cells, indicating that C-YES is a CDK4 Y17 kinase in cells Moreover, the level of Y17 phosphorylation was dependent on the activity of C-YES because the activated C-YESY537F mutant phosphorylated CDK4 to a higher degree than wildtype C-YES, and the kinase dead C-YESK305R did not phosphorylate CDK4 We also showed that two structurally unrelated Src family kinase inhibitors block the phosphorylation of CDK4 on Y17 As these inhibitors have similar activity against all Src family kinases [20,23], and we have shown that C-YES, C-SRC and 3104 C Fig Src family kinases phosphorylate CDK4 on Y17 in cells HCT116 cells were transfected with Flag-tagged CDK4 or CDK4Y17F along with C-YES, activated C-YESY537F (A) or kinase dead C-YESK305R (B) and then treated with or without sodium orthovanadate as indicated Lysates were immunoprecipitated with the Flag antibody (Flag IP) The immunoprecipitates and lysates were western blotted with the phosphospecific CDK4 pY17, total CDK4 and C-YES antibodies as indicated (C) HCT116 cells were transfected with Flag-tagged CDK4 or CDK4Y17F and treated with either vehicle (dimethylsulfoxide), PP2 (10 lM), SU6656 (10 lM) or sodium orthovanadate (200 lM) Lysates were immunoprecipitated with the Flag antibody (Flag IP) The immunoprecipitates and lysates were western blotted with the phosphospecific CDK4 pY17 and CDK1 pY15 antibodies, total CDK4, CDK1 and C-YES antibodies as indicated Long and short exposures of the CDK4 pY17 blot are shown LYN can all phosphorylate CDK4 on Y17 in vitro, it is possible that Src kinases other than C-YES are also involved in the cellular phosphorylation of CDK4 The FEBS Journal 275 (2008) 3099–3109 ª 2008 The Institute of Cancer Research: Royal Cancer Hospital Journal compilation ª 2008 FEBS N G Martin et al specific depletion of C-YES from cells using siRNA did not reduce the level of Y17 phosphorylation (data not shown); however, this result could be due to inadequate knockdown of C-YES or compensation by other Src family members It is known that Src family kinases share many substrates and show considerable functional redundancy [27], and it is likely the Src kinases other than C-YES contribute to Y17 phosphorylation of CDK4 in cells Src family kinases have recently been reported to phosphorylate p27KIP1 on two tyrosine residues [28,29] and there is the possibility that tyrosine phosphorylation of p27KIP1 could indirectly affect the Y17 phosphorylation of CDK4 However, it is clear that the CDK4 pY17 antibody does not detect tyrosine phosphorylation of p27KIP1 because a p27KIP1 band would run at a lower molecular weight than CDK4 on a western blot, and no signal was detected with the CDK4Y17F mutant Furthermore, the purified recombinant cyclin D1-CDK4 complex used as a substrate for kinase assays was dimeric and did not contain p27KIP1 (data not shown) Therefore, the data presented in Figs 1–4 strongly suggest that Src kinases directly phosphorylate CDK4 on Y17 and that this phosphorylation is independent of p27KIP1 The finding that Y17 phosphorylation is mediated by Src family kinases is completely novel and it is interesting to note how this fits in with the previously published data CDK4 phosphorylation on Y17 is considered to restrain cell cycle progression in UV irradiated cells undergoing G0–G1 transit [12,13], and may play a role in TGFb mediated G1 arrest [14] In this context, Y17 phosphorylation is thought to be modulated by loss of the phosphatase CDC25A Our data suggest that Src kinases are candidates to provide the phosphorylation of CDK4 If this is the case, it may be that Src family kinase activity is important for G1 arrest in these cellular situations or other Y17 dependent processes that are yet to be defined It is interesting to note that this is not the first report of Src family kinases phosphorylating CDKs The Src kinase LYN is already known to phosphorylate CDK1 [30,31] and CDK2 [32] on Y15 in response to DNA damage, and it is plausible that LYN may also phosphorylate CDK4 on Y17 in this context It is clear, however, that the regulation of CDK4 Y17 phosphorylation differs markedly from the regulation of CDK1 Y15 phosphorylation First, the basal level of CDK4 Y17 phosphorylation appears to be very low and was greatly increased by incubation with the protein tyrosine phosphatase inhibitor vanadate (Figs 1B and 5C) By contrast, the phosphorylation of CDK1 on Y15 was increased to a much lesser degree by vana- Phosphorylation of CDK4 by Src family kinases date treatment (Fig 5C) This is in keeping with previous studies that have either reported very low or undetectable levels of Y17 phosphorylation in untreated asynchronously proliferating cells [12–14, 33–35], and suggests that Y17 phosphorylation of CDK4 plays little role in an unperturbed cell cycle Second, the kinases WEE1 and MYT, which phosphorylate CDK1 on Y15, not appear to phosphorylate CDK4 on Y17 Immunodepletion of WEE1 or MYT1 from cell lysates did not deplete Y17 kinase activity, suggesting that CDK4 is not a substrate for WEE1 or MYT1, in agreement with previous reports demonstrating that neither of these kinases phosphorylate CDK4 in vitro [18,19] Furthermore, we found that, although CDK4 phosphorylation on Y17 was blocked by Src family kinase inhibitors, CDK1 phosphorylation on Y15 was not affected (Fig 5C) This suggests that Src kinases not phosphorylate CDK1 during an unperturbed cell cycle To conclude, we show that Src family kinases phosphorylate CDK4 on Y17 in the cell Considering the tight regulation of CDK4 activity during the cell cycle and the critical role that CDK4 plays in human cancer, it will be interesting to investigate how this novel form of regulation affects CDK4 activity during these processes Experimental procedures Cell lines and cell culture Frozen whole HeLa cells and HeLa nuclei were purchased from Cil Biotech (Mons, Belgium) HCT116 and HT29 cells (ATCC, LGC Promochem, Teddington, UK) were maintained in DMEM medium supplemented with 10% (v ⁄ v) fetal calf serum in an incubator at 37 °C with a humidified atmosphere of 5% CO2 HCT116 cells were transfected using Effectene reagent in accordance with the manufacturer’s instructions (Qiagen, Crawley, UK) and were lysed or frozen 48 h later Purified kinases and inhibitors Purified recombinant LYN and C-YES were puchased from Calbiochem (Merck Chemicals Limited, Nottingham, UK), C-SRC was obtained from Upstate (Lake Placid, NY, USA) and p49WEE1 was obtained as previously described [18] The kinase inhibitors PP2 and SU6656 were purchased from Calbiochem (Merck Chemicals Limited) and were dissolved at 10 mm in dimethylsulfoxide The phosphatase inhibitor sodium orthovanadate (Sigma-Aldrich, Dorset, UK) was dissolved at 0.1 m in water Cells were treated with these inhibitors for 16 h FEBS Journal 275 (2008) 3099–3109 ª 2008 The Institute of Cancer Research: Royal Cancer Hospital Journal compilation ª 2008 FEBS 3105 Phosphorylation of CDK4 by Src family kinases Plasmid vectors The human CDK4 coding sequence was cloned into the EcoRI-XbaI site of pcDNA3.1 (Invitrogen, Paisley, UK) modified with a FLAG-tag BamHI-EcoRI Codon 17 of CDK4 was mutated from TAT (Tyr) to TTT (Phe) using the QuickChangeÒ kit (Stratagene, La Jolla, CA, USA) and the forward primer: 3¢-GAAATTGGTGTCGGCGCC TTTGGGACAGTGTAC-5¢ The human C-YES coding sequence minus the termination codon was PCR amplified from IMAGE clone 5260751 and cloned into the XbaI-NotI site of pcDNA3.1 ⁄ myc-His A (Invitrogen) Codon 537 of C-YES was mutated from TAC (Tyr) to TTC (Phe) with the forward primer: 3¢-GTCACAGAGCCACAGTTCCAG CCAGGA-5¢ Codon 305 of C-YES was mutated from AAA (Lys) to AGA (Arg) with the forward primer: 3¢-GG AACCACGAAAGTAGCAATCAGAACACTAAAACCA GGTACAATGATGC-5¢ All vector inserts were sequenced prior to use CDK4 pY17 antibody generation Murex lop-eared rabbits were injected with a phosphopeptide corresponding to amino acids 11–23 of human CDK4 phosphorylated on Y17 with an additional cysteine at the C-terminus (EIGVApYGTVYKAC) conjugated to Keyhole Limpet Haemocyanin (Pierce, Rockford, IL, USA) The resulting antisera was affinity-purified by binding to the phosphopeptide antigen conjugated to sulfolink media (Pierce) The antibodies were eluted with 100 mm glycine (pH 2.8) and dialysed into NaCl ⁄ Pi The eluate was passed over a second column of the equivalent nonphosphopeptide (EIGVAYGTVYKAC), the flow-through was collected and dialysed into NaCl ⁄ Pi containing 50% (v ⁄ v) glycerol 96-well plate format CDK4 Y17 kinase assays Half of the wells of Immulon 2HB 96-well plates (Dynex Technologies Limited, Worthing, UK) were coated with lg per well of the CDK4 nonphosphopeptide (EIGVAYGTVYKAC) at °C overnight Protein samples were added to paired peptide-coated and noncoated wells, and kinase buffer (50 mm Hepes, pH 7.4, 10 mm MgCl2, mm EGTA, mm dithiothreitol, 0.4 mm NaF, 0.4 mm Na3VO4, mm ATP) was added to a total volume of 100 lL per well The plate was incubated at 37 °C for 45 and the reaction was stopped by washing the plate three times in 0.1% (v ⁄ v) Tween-20 The plate was blocked by incubation with 5% (w ⁄ v) skimmed milk powder in TNT [50 mm Tris-Cl, pH 8.0, 150 mm NaCl, 0.1% (v ⁄ v) Tween-20] for h The CDK4 pY17 antibody diluted : 1000 in 5% (w ⁄ v) skimmed milk powder in TNT was added and incubated overnight at °C The plate was washed three times in 0.1% (v ⁄ v) Tween-20 before antibody detection using the DELFIAÒ Europium labelled anti- 3106 N G Martin et al rabbit secondary sera and a Wallac Victor plate reader (PerkinElmer, Waltham, MA, USA) as described by the manufacturer The counts from the nonpeptide-coated wells were subtracted from the corresponding peptide-coated wells, and the raw counts were used as the unit of kinase activity For the HeLa lysate PP2 inhibitor assay (Fig 4B), the ATP concentration was reduced to 50 lm and the dimethylsulfoxide concentration was kept constant in all the wells For this assay, the SEM was converted to percent of control and was calculated as: (1 ⁄ y)Ö[rx2 + (x ⁄ y)2ry2], where y is the sample set to 100%, x is the sample calculated relative to y, ry is the SEM of y and rx is the SEM of x Tube format CDK4 Y17 kinase assay Protein samples were mixed with kinase buffer (as above) containing lg of purified cyclin D1 ⁄ CDK4 complex [36] and were incubated at 37 °C for 30 The CDK4 Y17 phosphorylation was detected by western blotting with the CDK4 pY17 antibody Y17 kinase purification procedure All protein purification steps were carried out at °C and all chromatography steps were performed using an AKTA FPLC (Amersham Biosciences, GE Healthcare, Amersham, UK) All chromatography columns and media were purchased from Amersham Biosciences unless otherwise stated After each step, the Y17 kinase activity of each fraction was measured using the 96-well plate format assay and the protein concentration was assayed using Bradford reagent (Bio-Rad, Hemel Hempstead, UK) Fractions from the Superdex 200 and Hydroxyapatite columns were analysed using the ATTO-TAG CBQCA protein assay (Invitrogen) · 1010 frozen HeLa Nuclei (Cil Biotech) with a mass of approximately 80 g were lysed for 30 in 400 mL of KCl protein extraction buffer [50 mm Hepes, pH 7.4, 250 mm KCl, mm EDTA, 0.1% (v ⁄ v) NP-40, mm dithiothreitol] containing protease inhibitors (CompleteÔ EDTA-free Protease Inhibitor Cocktail tablets; Roche Diagnostics Ltd, Burgess Hill, UK) and phosphatase inhibitors (10 mm b-glycerophosphate, mm NaF, 0.1 mm Na3VO4) The lysate was clarified by centrifugation at 15 000 g for 30 followed by centrifugation at 100 000 g for h Saturated ammonium sulfate solution (200 mL) was added (33% final concentration) and incubated for 30 The precipitated proteins were collected by centrifugation at 2885 g for 30 The protein pellets were dissolved in 400 mL of buffer A [25 mm Hepes, pH 7.4, 0.6 m ammonium sulfate, 10% (v ⁄ v) glycerol, mm benzamidine hydrochloride, mm EDTA, mm dithiothreitol] and clarified by centrifugation at 100 000 g for h, prior to loading onto an XK 50 ⁄ 30 column packed with Butyl Sepharose Fast Flow (GE FEBS Journal 275 (2008) 3099–3109 ª 2008 The Institute of Cancer Research: Royal Cancer Hospital Journal compilation ª 2008 FEBS N G Martin et al Healthcare), equilibrated in buffer A Proteins were eluted with a L linear gradient of 0.6–0 m ammonium sulfate and 40 mL fractions were collected Fractions 99–105 were pooled for further purification The pooled elutes were dialysed into buffer B [25 mm bis-tris, pH 7.0, 50 mm KCl, 10% (v ⁄ v) glycerol, mm benzamidine hydrochloride, mm EDTA, mm dithiothreitol], and loaded onto an XK 16 ⁄ 20 column packed with Q Sepharose Fast Flow (GE Healthcare), equilibrated in buffer B Proteins were eluted with a 240 mL linear gradient of 50–400 mm KCl and mL fractions were collected Chaps was added to the pooled elute to a final concentration of 10 mm and the sample was concentrated from 24 mL to mL using two Vivaspin 15R centrifugal concentrators (VWR International Ltd, Lutterworth, UK) The concentrated sample was applied to a HiLoad 26 ⁄ 60 Superdex 200 pg gel filtration column (GE Healthcare) equilibrated with buffer C [10 mm phosphate buffer, pH 7.0, 100 mm KCl, 10% (v ⁄ v) glycerol, mm dithiothreitol, 10 mm Chaps], and proteins were eluted in the same buffer and collected in mL fractions The active Superdex 200 fractions were loaded onto a Tricorn ⁄ 50 column packed with 20 lm particle size Type I CHT ceramic hydroxyapatite (Bio-Rad) equilibrated with buffer C The proteins were eluted with a linear gradient of 10–500 mm phosphate buffer and 500 lL fractions were collected 2.5 lL of sodium deoxycholate (2%, w ⁄ v) was added to 250 lL samples of selected fractions and the samples were incubated for 15 62.5 lL trichloroacetic acid (50%, w ⁄ v) was added, the samples were incubated for a further h, and the proteins collected by centrifugation at 13000 g for 10 The precipitates were washed with icecold ethanol, and the proteins were separated by SDS ⁄ PAGE on a NuPAGE 4–12% Bis-Tris gradient gel in Mops running buffer (Invitrogen) The proteins were stained with Coomassie brilliant blue G (Sigma-Aldrich) and a sample from the 60 kDa band was excised The sample was analysed using Q-TRAP MS by the Protein Analysis Laboratory at the Cancer Research UK London Research Institute (London, UK) Phosphorylation of CDK4 by Src family kinases with RIPA buffer and the precipitated proteins were resolved by SDS ⁄ PAGE and western blotting Immunodepletion Samples of HeLa whole cell and nuclear lysates prepared in KCl protein extraction buffer containing 500 lg of protein were depleted with 20 lg of anti-C-YES (Upstate), lg of anti-WEE1 H-300 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or lg of anti-MYT1 N-17 (Santa Cruz Biotechnology) polyclonal sera and 15 lL (bed volume) of protein G-sepharose For mock depletions, the antibody was replaced with KCl protein extraction buffer After incubation with the beads and antibodies at °C for h, the depleted supernatants were assayed for Y17 kinase activity using both the 96-well plate format and tube format assays The beads were washed four times with KCl protein extraction buffer and twice with kinase buffer without ATP The beads were then assayed for Y17 kinase activity using the tube format assay Western blotting Protein lysates and immunoprecipitates were resolved on standard 10% SDS ⁄ PAGE gels, and chromatography fractions were resolved on NuPAGE 4–12% Bis-Tris gradient gels in Mops running buffer (Invitrogen) The proteins were transferred onto Immobilon-P membranes [Millipore (UK) Ltd, Watford, UK], which were blocked in 5% skimmed milk powder in TNT Membranes were incubated with primary antibodies overnight and secondary antibodies (peroxidase-conjugated goat anti-rabbit ⁄ mouse antibody; Bio-Rad) for h Blots were developed using ECL Western Blotting Detection Reagents and Hyperfilm (Amersham Biosciences, GE Healthcare) Primary antibodies were CDK4 C-22, WEE1 B-11, MYT1 N-17 (Santa Sruz Biotechnology), CDK1 Ab-4 (NeoMarkers, Thermo Fisher Scientific, Runcorn, UK), CDK1 phospho-Y15 (Cell Signaling Technology, New England Biolabs, Hitchin, UK), aTubulin DM1A (Sigma-Aldrich) and C-YES (BD Biosciences, Oxford, UK) Immunoprecipitation Cells were lysed in RIPA buffer [50 mm Hepes, pH 7.4, 150 mm NaCl, mm EDTA, 1% (v ⁄ v) NP-40, 0.5% (w ⁄ v) sodium deoxycholate, 0.1% (w ⁄ v) SDS, mm dithiothreitol] containing protease inhibitors (CompleteÔ EDTA-free Protease Inhibitor Cocktail) and phosphatase inhibitors (10 mm b-glycerophosphate, mm NaF, 0.1 mm Na3VO4) Insoluble debris was removed from the lysate by centrifugation at 13 000 g for 10 and the protein concentration was measured using Bradford reagent (Bio-Rad) Typically lysates containing mg of protein were incubated with 20 lL (bed volume) of Anti-FLAG M2 affinity gel (SigmaAldrich) for h at °C, the beads were washed four times Acknowledgements We thank Jacky Metcalfe for the peptide synthesis, Clive Lebozer for production of the rabbit antiserum, and the Protein Analysis Laboratory at the Cancer Research UK London Research Institute for performing the MS We also thank the members of the Garrett laboratory for useful discussion of the manuscript This work was supported by The Institute of Cancer Research, Cancer Research UK (CUK) grant numbers C309 ⁄ 2187 and C309 ⁄ A8274 and by AICR grant 02-112 FEBS Journal 275 (2008) 3099–3109 ª 2008 The Institute of Cancer Research: Royal Cancer Hospital Journal compilation ª 2008 FEBS 3107 Phosphorylation of CDK4 by Src family kinases References Dowdy SF, Hinds PW, Louie K, Reed SI, Arnold A & Weinberg RA (1993) Physical interaction of the retinoblastoma protein with human D cyclins Cell 73, 499– 511 Ewen ME, Sluss HK, Sherr CJ, Matsushime H, Kato J & Livingston DM (1993) Functional interactions of the retinoblastoma protein with mammalian D-type cyclins Cell 73, 487–497 Kato J, Matsushime H, Hiebert SW, Ewen ME & Sherr CJ (1993) Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin D-dependent kinase CDK4 Genes Dev 7, 331–342 Harbour JW & Dean DC (2000) The Rb ⁄ E2F pathway: expanding roles and emerging paradigms Genes Dev 14, 2393–2409 Knudsen ES, Buckmaster C, Chen TT, Feramisco JR & Wang JY (1998) Inhibition of DNA synthesis by RB: effects on G1 ⁄ S transition and S-phase progression Genes Dev 12, 2278–2292 Lukas J, Parry D, Aagaard L, Mann DJ, Bartkova J, Strauss M, Peters G & Bartek J (1995) Retinoblastomaprotein-dependent cell-cycle inhibition by the tumour suppressor p16 Nature 375, 503–506 Malumbres M & Barbacid M (2001) To cycle or not to cycle: a critical decision in cancer Nat Rev Cancer 1, 222–231 Bockstaele L, Coulonval K, Kooken H, Paternot S & Roger PP (2006) Regulation of CDK4 Cell Div 1, 25 Morgan DO (1995) Principles of CDK regulation Nature 374, 131–134 10 McGowan CH & Russell P (1993) Human Wee1 kinase inhibits cell division by phosphorylating p34cdc2 exclusively on Tyr15 EMBO J 12, 75–85 11 Parker LL & Piwnica-Worms H (1992) Inactivation of the p34cdc2-cyclin B complex by the human WEE1 tyrosine kinase Science 257, 1955–1957 12 Jinno S, Hung SC & Okayama H (1999) Cell cycle start from quiescence controlled by tyrosine phosphorylation of Cdk4 Oncogene 18, 565–571 13 Terada Y, Tatsuka M, Jinno S & Okayama H (1995) Requirement for tyrosine phosphorylation of Cdk4 in G1 arrest induced by ultraviolet irradiation Nature 376, 358–362 14 Iavarone A & Massague J (1997) Repression of the CDK activator Cdc25A and cell-cycle arrest by cytokine TGF-beta in cells lacking the CDK inhibitor p15 Nature 387, 417–422 15 Wang Z, Southwick EC, Wang M, Kar S, Rosi KS, Wilcox CS, Lazo JS & Carr BI (2001) Involvement of Cdc25A phosphatase in Hep3B hepatoma cell growth inhibition induced by novel K vitamin analogs Cancer Res 61, 7211–7216 3108 N G Martin et al 16 Tamura K, Southwick EC, Kerns J, Rosi K, Carr BI, Wilcox C & Lazo JS (2000) Cdc25 inhibition and cell cycle arrest by a synthetic thioalkyl vitamin K analogue Cancer Res 60, 1317–1325 17 Tamura K, Rice RL, Wipf P & Lazo JS (1999) Dual G1 and G2 ⁄ M phase inhibition by SC-alpha alpha delta 9, a combinatorially derived Cdc25 phosphatase inhibitor Oncogene 18, 6989–6996 18 Booher RN, Holman PS & Fattaey A (1997) Human Myt1 is a cell cycle-regulated kinase that inhibits Cdc2 but not Cdk2 activity J Biol Chem 272, 22300– 22306 19 Watanabe N, Broome M & Hunter T (1995) Regulation of the human WEE1Hu CDK tyrosine 15-kinase during the cell cycle EMBO J 14, 1878–1891 20 Hanke JH, Gardner JP, Dow RL, Changelian PS, Brissette WH, Weringer EJ, Pollok BA & Connelly PA (1996) Discovery of a novel, potent, and Src familyselective tyrosine kinase inhibitor Study of Lck- and FynT-dependent T cell activation J Biol Chem 271, 695–701 21 Parker LL, Sylvestre PJ, Byrnes MJ III, Liu F & Piwnica-Worms H (1995) Identification of a 95-kDa WEE1-like tyrosine kinase in HeLa cells Proc Natl Acad Sci USA 92, 9638–9642 22 Okada M, Nada S, Yamanashi Y, Yamamoto T & Nakagawa H (1991) CSK: a protein-tyrosine kinase involved in regulation of src family kinases J Biol Chem 266, 24249–24252 23 Blake RA, Broome MA, Liu X, Wu J, Gishizky M, Sun L & Courtneidge SA (2000) SU6656, a selective src family kinase inhibitor, used to probe growth factor signaling Mol Cell Biol 20, 9018–9027 24 Sudol M & Hanafusa H (1986) Cellular proteins homologous to the viral yes gene product Mol Cell Biol 6, 2839–2846 25 Koegl M, Zlatkine P, Ley SC, Courtneidge SA & Magee AI (1994) Palmitoylation of multiple Src-family kinases at a homologous N-terminal motif Biochem J 303, 749–753 26 McCabe JB & Berthiaume LG (1999) Functional roles for fatty acylated amino-terminal domains in subcellular localization Mol Biol Cell 10, 3771–3786 27 Thomas SM & Brugge JS (1997) Cellular functions regulated by Src family kinases Annu Rev Cell Dev Biol 13, 513–609 28 Chu I, Sun J, Arnaout A, Kahn H, Hanna W, Narod S, Sun P, Tan CK, Hengst L & Slingerland J (2007) p27 phosphorylation by Src regulates inhibition of cyclin E-Cdk2 Cell 128, 281–294 29 Grimmler M, Wang Y, Mund T, Cilensek Z, Keidel EM, Waddell MB, Jakel H, Kullmann M, Kriwacki RW & Hengst L (2007) Cdk-inhibitory activity and stability of p27Kip1 are directly regulated by oncogenic tyrosine kinases Cell 128, 269–280 FEBS Journal 275 (2008) 3099–3109 ª 2008 The Institute of Cancer Research: Royal Cancer Hospital Journal compilation ª 2008 FEBS N G Martin et al 30 Uckun FM, Tuel-Ahlgren L, Waddick KG, Jun X, Jin J, Myers DE, Rowley RB, Burkhardt AL & Bolen JB (1996) Physical and functional interactions between Lyn and p34cdc2 kinases in irradiated human B-cell precursors J Biol Chem 271, 6389–6397 31 Kharbanda S, Saleem A, Yuan ZM, Kraeft S, Weichselbaum R, Chen LB & Kufe D (1996) Nuclear signaling induced by ionizing radiation involves colocalization of the activated p56 ⁄ p53lyn tyrosine kinase with p34cdc2 Cancer Res 56, 3617–3621 32 Yuan ZM, Huang Y, Kraeft SK, Chen LB, Kharbanda S & Kufe D (1996) Interaction of cyclin-dependent kinase and the Lyn tyrosine kinase in cells treated with 1-beta-D-arabinofuranosylcytosine Oncogene 13, 939–946 33 Bockstaele L, Kooken H, Libert F, Paternot S, Dumont JE, de Launoit Y, Roger PP & Coulonval K (2006) Regulated activating Thr172 phosphorylation of cyclin- Phosphorylation of CDK4 by Src family kinases dependent kinase 4(CDK4): its relationship with cyclins and CDK ‘inhibitors’ Mol Cell Biol 26, 5070–5085 34 Coulonval K, Bockstaele L, Paternot S, Dumont JE & Roger PP (2003) The cyclin D3-CDK4-p27kip1 holoenzyme in thyroid epithelial cells: activation by TSH, inhibition by TGFbeta, and phosphorylations of its subunits demonstrated by two-dimensional gel electrophoresis Exp Cell Res 291, 135–149 35 Sexl V, Diehl JA, Sherr CJ, Ashmun R, Beach D & Roussel MF (1999) A rate limiting function of cdc25A for S phase entry inversely correlates with tyrosine dephosphorylation of Cdk2 Oncogene 18, 573–582 36 Fry DW, Bedford DC, Harvey PH, Fritsch A, Keller PR, Wu Z, Dobrusin E, Leopold WR, Fattaey A & Garrett MD (2001) Cell cycle and biochemical effects of PD 0183812 A potent inhibitor of the cyclin D-dependent kinases CDK4 and CDK6 J Biol Chem 276, 16617–16623 FEBS Journal 275 (2008) 3099–3109 ª 2008 The Institute of Cancer Research: Royal Cancer Hospital Journal compilation ª 2008 FEBS 3109 ... purify CDK4 Y17 kinases from HeLa cell extracts, and found that the cellular phosphorylation of CDK4 on Y17 is mediated by Src family kinases Results Detection of CDK4 Y17 phosphorylation and kinase. .. that Y17 phosphorylation is mediated by Src family kinases is completely novel and it is interesting to note how this fits in with the previously published data CDK4 phosphorylation on Y17 is considered... Roger PP & Coulonval K (2006) Regulated activating Thr172 phosphorylation of cyclin- Phosphorylation of CDK4 by Src family kinases dependent kinase 4( CDK4): its relationship with cyclins and CDK