Tài liệu Báo cáo khoa học: His374 of wheat endoxylanase inhibitor TAXI-I stabilizes complex formation with glycoside hydrolase family 11 endoxylanases pptx

His374 of wheat endoxylanase inhibitor TAXI-I stabilizes complex formation with glycoside hydrolase family 11 endoxylanases Katleen Fierens 1 , Ann Gils 2 , Stefaan Sansen 3 , Kristof Brijs 1 , Christophe M. Courtin 1 , Paul J. Declerck 2 , Camiel J. De Ranter 3 , Kurt Gebruers 1 , Anja Rabijns 3 , Johan Robben 1 , Steven Van Campenhout 4 , Guido Volckaert 4 and Jan A. Delcour 1 1 Katholieke Universiteit Leuven, Laboratory of Food Chemistry, Leuven, Belgium 2 Katholieke Universiteit Leuven, Laboratory of Pharmaceutical Biology and Phytopharmacology, Leuven, Belgium 3 Katholieke Universiteit Leuven, Laboratory of Analytical Chemistry and Medicinal Physicochemistry, Leuven, Belgium 4 Katholieke Universiteit Leuven, Laboratory of Gene Technology, Leuven, Belgium Endoxylanases (EC 3.2.1.8) are key plant or microbial enzymes in the degradation of arabinoxylan (AX) [1,2], an important structural and quality determining nonstarch polysaccharide in cereals. In sequence-based classifications, endoxylanases are mainly grouped into glycoside hydrolase families (GH) 10 and 11 (CAZy database http://afmb.cnrs-mrs.fr/CAZY/) [3]. The cata- lytic domain of GH11 endoxylanases has a b-jelly roll fold which resembles the shape of a partially closed right hand with ‘finger’, ‘palm’ and ‘thumb’ regions Keywords endoxylanase; inhibitor; protein–protein interaction; surface plasmon resonance; TAXI Correspondence K. Fierens, Katholieke Universiteit Leuven, Laboratory of Food Chemistry, Kasteelpark Arenberg 20, B-3001 Leuven, Belgium Fax: +32 16 321997 Tel: +32 16 321634 E-mail: katleen.fierens@biw.kuleuven.be (Received 24 June 2005, revised 2 September 2005, accepted 22 September 2005) doi:10.1111/j.1742-4658.2005.04987.x Wheat endoxylanase inhibitor TAXI-I inhibits microbial glycoside hydro- lase family 11 endoxylanases. Crystallographic data of an Aspergillus niger endoxylanase-TAXI-I complex showed His374 of TAXI-I to be a key resi- due in endoxylanase inhibition [Sansen S, De Ranter CJ, Gebruers K, Brijs K, Courtin CM, Delcour JA & Rabijns A (2004) J Biol Chem 279, 36022– 36028]. Its role in enzyme–inhibitor interaction was further investigated by site-directed mutagenesis of His374 into alanine, glutamine or lysine. Bind- ing kinetics and affinities of the molecular interactions between A. niger, Bacillus subtilis, Trichoderma longibrachiatum endoxylanases and wild-type TAXI-I and TAXI-I His374 mutants were determined by surface plasmon resonance analysis. Enzyme–inhibitor binding was in accordance with a simple 1 : 1 binding model. Association and dissociation rate constants of wild-type TAXI-I towards the endoxylanases were in the range between 1.96 and 36.1 · 10 4 m )1 Æs )1 and 0.72–3.60 · 10 )4 Æs )1 , respectively, resulting in equilibrium dissociation constants in the low nanomolar range. Muta- tion of TAXI-I His374 to a variable degree reduced the inhibition capacity of the inhibitor mainly due to higher complex dissociation rate constants (three- to 80-fold increase). The association rate constants were affected to a smaller extent (up to eightfold decrease). Substitution of TAXI-I His374 therefore strongly affects the affinity of the inhibitor for the enzymes. In addition, the results show that His374 plays a critical role in the stabiliza- tion of the endoxylanase–TAXI-I complex rather than in the docking of inhibitor onto enzyme. Abbreviations AU, absorbance units; GH, glycoside hydrolase family; IU, inhibition units; RU, resonance units; SPR, surface plasmon resonance; TAXI, Triticum aestivum xylanase inhibitor. 5872 FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS [4]. Its active site is located into the extended open cleft formed by the ‘palm’ region. GH10 endoxylanases, comprising all endogenous plant endoxylanases known to date [5], have the typical (b ⁄ a) 8 barrel fold [6]. The active site of both endoxylanase families con- tains two conserved Glu residues that are involved in substrate hydrolysis via a double displacement mech- anism [7,8]. Microbial endoxylanases belonging to both GH10 and GH11 are often used to impact AX functionality in cereal-based biotechnological applications to opti- mize process parameters, yields and product quality [9–11]. The presence of cereal endoxylanase inhibitors, however, impacts the activity of the added endoxylan- ases. Two structurally different types of proteinaceous endoxylanase inhibitors have been identified in wheat, i.e. the TAXI- (Triticum aestivum xylanase inhibitor) [12,13] and XIP- (Xylanase inhibiting protein) [13,14] type inhibitors. Two TAXI-type endoxylanase inhibi- tors have been described, TAXI-I and TAXI-II, both with molecular mass of 40 kDa but differing from one another in pI (8.8 and 9.3, respectively) and endoxyla- nase specificity [15]. Despite very low sequence homol- ogy levels ( 15% identity), TAXI-I is structurally homologous with the pepsin-like family of aspartic proteases [16]. It folds as a two b-barrel domain pro- tein with a few helical segments, and the separate domains are divided by an extended cleft. XIP-I, on the other hand, is a glycosylated, monomeric inhibitor with a molecular mass of 29 kDa and a basic pI (8.7– 8.9) [14,17]. The inhibitor possesses a (b ⁄ a) 8 barrel fold and displays structural features typical for GH18 chitinases, but lacks chitinase activity [18]. Sequence data and 3D structures of TAXI-I and XIP-I show no structural homology between both types of inhibitors [16,18–20]. Moreover, these inhibitors have different endoxylanase specificities. XIP-I inhibits microbial endoxylanases from GH10 as well as GH11 [21], while TAXI-I and TAXI-II only inhibit microbial endoxy- lanases belonging to GH11 [15]. Experimentally deter- mined K i values ranging from 5 to 30 nm for TAXI [12,22,23] and from 3 to 610 nm for XIP [21] suggest tight binding inhibition for both inhibitor types. The 3D structure of TAXI-I complexed with a GH11 Aspergillus niger endoxylanase revealed both a direct interaction of the inhibitor with the active site region of the enzyme as well as substrate-mimicking contacts filling the whole substrate-docking region [16]. Five TAXI-I loop regions completely cover the deep substrate-binding and active site cleft of the endoxyla- nase through ionic and hydrophobic interactions and hydrogen bonding (including water-bridged contacts) [16] (Fig. 1A), resulting in the burial of 992 A ˚ 2 of accessible surface area. The imidazole ring of TAXI-I His374 that fits into the active site of the enzyme and, more precisely, in between the two catalytic Glu AB Fig. 1. (A) Ribbon diagram of the overall structure of TAXI-I (orange) in complex with A. niger endoxylanase (blue) [16]. The interaction site is boxed and interface residues His374 and Leu292 of TAXI-I and Asp37, Glu79 and Glu170 of A. niger endoxylanase are shown in sticks. (B) Detailed view on the key interactions. The imidazole ring of TAXI-I His374 fits in between the two catalytic residues (Glu79 and Glu170) of A. niger endoxylanase and is highly stabilized through ionic, salt bridge and hydrogen bonding interactions with both residues and Asp37 of the endoxylanase. K. Fierens et al. Role of TAXI-I His374 in endoxylanase inhibition FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS 5873 residues involved in substrate hydrolysis is the key resi- due for endoxylanase inhibition (Fig. 1B). In the )2 glycon subsite of the endoxylanase, Leu292 of TAXI-I perfectly superimposes with xylose. In spite of the above, profound analysis of the speci- fic contributions of the amino acid residues at the interface of the enzyme–inhibitor interaction is lacking. Mutagenesis studies of a GH11 Bacillus subtilis endo- xylanase revealed that both the ‘thumb’ and ‘finger’ regions of the enzyme are important for interaction with TAXI-type inhibitors [12]. Tahir and coworkers [24] showed that mutation of the pH-optimum related Asp37 in the active site cleft of a GH11 A. niger endo- xylanase into Ala completely abolishes interaction with TAXI-I. Mutational analysis of TAXI-I rather than of its target enzymes is another approach to study the struc- tural requirements for formation of the enzyme–inhib- itor complex and for identifying the nature of forces involved in its stabilization. In the present case, His374 of TAXI-I is a critical residue for endoxyla- nase inhibition because of its many interactions with several endoxylanase residues [16]. Hence, we investi- gated its role in the endoxylanase–inhibitor interaction by site-directed mutagenesis. Residual endoxylanase inhibition activities of the TAXI His374 mutants were determined. The specific contribution of TAXI-I His374 in endoxylanase interaction was examined using surface plasmon resonance (SPR) analysis. The need for interface charges and the pH stability of the enzyme–inhibitor interaction were studied by IEF titration curves. Results and Discussion Recombinant expression, purification and characterization of TAXI [H374A/K/Q] mutants The role of TAXI-I His374 in endoxylanase inhibition was studied by site-directed mutagenesis of this residue into Ala (A), Gln (Q) or Lys (K). Ala is mostly used for amino acid substitutions because of its small size and aliphatic properties. Crystallographic analysis of the A. niger endoxylanase–TAXI-I complex showed involvement of the two nitrogen atoms of the His374 imidazole ring of TAXI-I in endoxylanase interaction [16]. Moreover, molecular identification of TAXI-II proteins showed the presence of either His or Gln at this position [25]. For that reason, positively charged and basic His374 was replaced by Gln and Lys both containing one nitrogen atom in their side chain. The Gln nitrogen superimposes with the distal imidazole nitrogen while Lys cannot superimpose similarly but, like His, has a positive charge. Mutant TAXI-I pro- teins were overexpressed in Pichia pastoris and purified to homogeneity as described previously [26]. From a 100 mL culture of each of the yeast transformants, about 3–5 mg of purified protein was obtained, similar to the yield obtained for wild-type TAXI-I [26]. Each of the purified mutants exhibited a single band with molecular mass ( 42 kDa) similar to that of the wild- type protein on SDS ⁄ PAGE. The isoelectric point of all mutants was at least 9.3. CD spectra (Fig. 2) for mutants TAXI [H374A] and TAXI [H374K] were similar to that of wild-type TAXI-I indicating that there were no major structural perturbations caused by the muta- tions. No CD spectrum was recorded for TAXI [H374Q] . However, as the protein still showed endoxylanase inhibition activity (cfr. infra), the overall protein structure was expected to be similar like those of wild- type TAXI-I and the mutants TAXI [H374A] and TAXI [H374K] . Endoxylanase inhibition activity of the TAXI-I mutants Specific endoxylanase inhibition activities of the TAXI-I His374 mutants were determined for a defined set of GH11 endoxylanases (Table 1). Endoxylanase selection was based on high sensitivity for wild-type TAXI-I inhibition [12,15,22]. Endoxylanases from A. niger, Penicillium funiculosum, Trichoderma longi- brachiatum and B. subtilis were all strongly inhibited by wild-type TAXI-I with specific inhibition activities ranging from 2900 to 4400 IUÆmg )1 protein. The TAXI-I His374 mutants, however, exerted large differ- ences in endoxylanase inhibition activities. A. niger -250 -200 -150 -100 -50 0 50 180 190 200 210 2 20 230 240 250 260 Wavelength (nm) [ θ θ θ θ ] (10 -4 deg.cm 2 .decimole -1 ) Fig. 2. CD spectra of wild-type TAXI-I (dotted line) and TAXI-I mutants TAXI [H374A] (bold line) and TAXI [H374K] (broken line). The spectra were normalized to the protein concentration and expressed as molar ellipticity [h]. Role of TAXI-I His374 in endoxylanase inhibition K. Fierens et al. 5874 FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS endoxylanase inhibition activity was not detected for any of the three mutants even when, in the inhibition assay, 10 times more inhibitor was used than for wild- type TAXI-I. All mutants still strongly inhibited P. funiculosum endoxylanase with specific inhibition units ranging from 2500 to 2900 per mg protein. T. longibrachiatum M3 endoxylanase was strongly inhibited by TAXI [H374A] and TAXI [H374Q] , but only weakly by TAXI [H374K] . The latter TAXI-I mutant exerted low endoxylanase inhibition activities for all GH11 endoxylanases tested with exception of the one from P. funiculosum. The lysine side chain probably does not optimally fit into the active site of the endoxylanases. Both mutants TAXI [H374A] and TAXI [H374Q] showed reduced inhibition activities against B. subtilis and T. longibrachiatum M2 endoxy- lanases. Real-time interactions of wild-type TAXI-I and TAXI-I His374 mutants with GH11 endoxylanases studied by SPR analysis SPR measurements were performed to further investi- gate the specific contribution of TAXI-I His374 to complexation with three industrially important GH11 endoxylanases. Real-time interactions between A. niger, T. longibrachiatum M2, B. subtilis GH11 endoxylanases and wild-type TAXI-I and mutants TAXI [H374A] , TAXI [H374K] , TAXI [H374Q] were determined. Figure 3 shows representative real-time binding sensorgrams. Equilibrium dissociation constants (K D ) were calculated from the ratio of dissociation rate constants over association rate constants (k off ⁄ k on ) and were in the low nanomolar range (Table 2). K D values of the complexes between wild-type TAXI-I and A. niger or B. subtilis endoxylanase (K D[A. niger] 6 3.77 nm, K D[B. subtilis] ¼ 1.07 nm) were, respectively, five- and 17-fold lower than the inhibition constants (K i[A. niger] ¼ 20.1 nm, K i[B. subtilis] ¼ 16.7 nm) previously measured by endoxylanase inhibition assays using water-soluble wheat AX as substrate [12]. Differ- ences may be due to different experimental conditions, including absence ⁄ presence of substrate, reaction tem- peratures (difference of 8 °C) and use of different measurement techniques. A closer look at the SPR results revealed differences in endoxylanase affinity. The wild-type inhibitor has a threefold higher affinity for B. subtilis than for A. niger endoxylanase (K D val- ues of 1.07 nm vs. 3.77 nm, respectively). Mutation of TAXI-I His374 clearly affected the interaction between enzyme and inhibitor. In contrast to what could be predicted from the obtained specific endoxylanase inhibition activity results, mutants TAXI [H374A] and TAXI [H374Q] still showed affinity (albeit reduced) for A. niger endoxylanase. However, no A. niger endoxylanase interaction was observed for TAXI [H374K] . The k on rate constant for TAXI [H374A] Table 1. Specific inhibition units (SD ¼ 10%, n ¼ 3) of TAXI-I and TAXI-I His374 mutants for GH11 endoxylanases (endoxylanase selection was based on high sensitivity for wild-type TAXI-I inhibi- tion [12,15,22]. Endoxylanase inhibition activities were determined with a routinely used variant of the colorimetric Xylazyme-AX method using Xylazyme-AX tablets as substrate. One enzyme unit (EU) corresponded to an increase in absorbance of 1.0 at 590 nm under the conditions of the assay. One inhibition unit (IU) was defined as the amount of inhibitor that, under the conditions of the assay, reduces the A 590 of one EU by 50% (to 0.5). Inhibition activ- ities were determined with 0–10 nm wild-type and 0–60 nm mutant TAXI-I. GH11 endoxylanase Specific inhibition units (IUÆmg protein )1 ) TAXI-I TAXI [H374A] TAXI [H374Q] TAXI [H374K] A. niger 3600 < 20 a <20 a <20 a P. funiculosum 3700 2500 2900 2800 T. longibrachiatum M2 4400 500 1300 100 T. longibrachiatum M3 3200 3700 2900 60 B. subtilis 2900 200 300 20 a No endoxylanase inhibition activity detected. A 1200 nM 600 nM 300 nM 150-50 Time (s) 350 550 750 950 1150 300 260 Response (RU) 220 180 140 100 60 20 -20 -60 B 200 nM 307 nM 100 nM 150-50 Time (s) 350 550 750 950 1150 Response (RU) 350 300 250 200 150 100 50 0 -50 C 500 400 100 0 600 Response (RU) 307 nM 200 nM 100 nM 150-50 Time (s) 350 550 750 950 1150 200 300 Fig. 3. Representative real-time binding sensorgrams measured by SPR and showing the interaction between (A) A. niger endoxylanase and TAXI-I, (B) B. subtilis endoxylanase and TAXI-I, and (C) B. subtilis endoxylanase and TAXI [H374Q] . Varying endoxylanase concentrations were injected over immobilized TAXI-I (A and B) and TAXI [H374Q] (C) as indicated on the sensorgrams. The measurements were performed at 22 °C in 100 m M sodium acetate pH 5.0. K. Fierens et al. Role of TAXI-I His374 in endoxylanase inhibition FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS 5875 was about three times lower than that of wild-type TAXI-I, while the association rate constant of TAXI [H374Q] was only slightly affected. Large differ- ences were found in the dissociation rate constants with k off values for TAXI [H374A] and TAXI [H374Q] that showed about a 50- and 80-fold increase, respectively, over the constant of wild-type TAXI-I. Consequently, the K D values for both mutants were at least 95-fold higher, indicating weaker affinity of the TAXI-I mutants than wild-type TAXI-I for A. niger endoxyla- nase. Lower affinity may explain the absence of A. niger endoxylanase inhibition by the TAXI-I His374 mutants in the inhibition assay because the amount of mutated inhibitor used was too low. Indeed, in another experiment, 100-fold excess of mutated inhibitor (TAXI [H374A] or TAXI [H374Q] ) slightly reduced the A. niger endoxylanase activity (results not shown). Reduced affinity was also observed for the interac- tion of the TAXI-I His374 mutants with T. longibra- chiatum M2 and B. subtilis endoxylanases. However, mutation of TAXI-I His374 did more markedly affect the k on rate constants of the interaction with B. subtilis endoxylanase than the k on rate constants of the inter- actions with A. niger or T. longibrachiatum M2 endoxylanases. At the same time, the increase in k off values was less pronounced for B. subtilis endoxylanase than for either the A. niger or T. longibrachiatum M2 endoxylanase. However, the range of k off increases was still larger than the decrease in their respective k on rate constants. Hence, mutation of TAXI-I His374 weakened the affinity of the enzyme–inhibitor interaction. This was clearly reflected in the drastic increase in k off and K D constants. The smaller effect on the k on rate constants indicated that TAXI-I His374 is less critical for dock- ing of the inhibitor onto the enzyme. Crystallographic analysis of the TAXI-I–A. niger endoxylanase complex [16] showed that the two nitrogen atoms of the TAXI- I His374 imidazole ring strongly interact with several endoxylanase residues (Fig. 1B). They are highly sta- bilized through salt bridge and hydrogen bond interac- tions with Asp37, a residue known to determine the acidic enzymic pH optimum [8], and ionic interactions with the nucleophilic catalyst Glu79 of the endoxyla- nase (Fig. 1B). In addition, strong hydrogen bond interactions were observed for TAXI-I His374 and acid ⁄ base catalyst Glu170 of the endoxylanase. As mutation of TAXI-I His374 most affected the k off rate constants, it seems that both nitrogen atoms of the TAXI-I His374 imidazole ring provide additional stabilization once the enzyme–inhibitor complex is formed. This is especially true for A. niger endoxyla- nase as the K D values of its interaction with all TAXI- I His374 mutants largely increased. Our assumption was convincingly demonstrated by the binding behav- ior of TAXI-I mutants TAXI [H374A] and TAXI [H374Q] (Table 2). The side chain of Gln (containing one nitro- gen atom) probably accounts for additional hydrogen bonding interactions compared to the aliphatic side chain of Ala, resulting in stronger complex formation and lower equilibrium dissociation constants for TAXI [H374Q] than for TAXI [H374A] . The higher K D val- ues for TAXI [H374K] may be due to difficult fitting and stabilization problems of the flexible and long Lys side chain into the endoxylanase active site cleft despite the presence of one positively charged nitrogen atom in its terminal amino group. Table 2. Kinetic parameters of the binding of TAXI-I and its mutants to GH11 endoxylanases. Association rate constants (k on ), dissociation rate constants (k off ) and equilibrium dissociation rate constants (K D ¼ k off ⁄ k on ) were derived from SPR data using Biacore software. The data were fitted to the 1 : 1 Langmuir binding model. The rate constants represent the average of measurements with three different endoxyla- nase concentrations performed at least in duplicate (± SD). Measurements were performed at 22 °C in 100 mM sodium acetate pH 5.0. TAXI-I TAXI [H374A] TAXI [H374Q] TAXI [H374K] A. niger endoxylanase k on (10 4 M )1 Æs )1 ) 1.96 ± 0.48 0.72 ± 0.15 1.59 ± 0.35 No binding detected k off (10 )4 s )1 ) 6 0.72 ± 0.42 39.1 ± 17.6 56.1 ± 13.2 K D (10 )9 M) 6 3.77 ± 2.00 545 ± 208 360 ± 82.5 T. longibrachiatum M2 endoxylanase k on (10 4 M )1 Æs )1 ) 5.35 ± 2.32 3.37 ± 1.82 3.72 ± 1.73 2.80 ± 1.62 k off (10 )4 s )1 ) 6 0.82 ± 0.35 14.7 ± 3.43 3.25 ± 0.21 60.0 ± 19.8 K D (10 )9 M) 6 1.84 ± 1.05 55.3 ± 30.2 10.8 ± 5.42 551 ± 916 B. subtilis endoxylanase k on (10 4 M )1 Æs )1 ) 36.1 ± 10.6 11.7 ± 6.84 25.6 ± 13.3 4.57 ± 1.52 k off (10 )4 s )1 ) 3.60 ± 0.43 15.9 ± 1.90 11.8 ± 1.00 34.4 ± 6.70 K D (10 )9 M) 1.07 ± 0.32 17.0 ± 7.45 6.58 ± 4.68 81.6 ± 29.9 Role of TAXI-I His374 in endoxylanase inhibition K. Fierens et al. 5876 FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS Interface charges and pH stability of the enzyme–inhibitor interaction studied by IEF titration curves The above results indicated that, especially for A. niger endoxylanase, electrostatic interactions are important for stabilization of the enzyme–inhibitor complex. The need for interface charges and the pH-stability of the enzyme–inhibitor interaction were therefore studied in the pH range pH 3.0–9.0 by IEF titration curves of enzyme, inhibitor and their complex. Pre-incubation of wild-type TAXI-I and A. niger endoxylanase at pH 5.0 resulted in the formation of an enzyme–inhibitor com- plex stable in a pH range from pH 3.0–7.0 (Fig. 4). Above pH 7.0, the complex dissociated. The complexes of TAXI-I with endoxylanases from B. subtilis or T. longibrachiatum M2 were stable in the entire pH range tested from pH 3.0–9.0, respectively (Fig. 4). These results show that the weaker A. niger endoxyla- nase–TAXI-I complex also is more susceptible to pH– B. subtilis endoxylanase complex TAXI-I mobility 3 9 p H 3 9 p H 3 9 p H mobility mobility 3 9 pH TAXI-I complex E T. longibrachiatum M2 endoxylanase complex 3 9 pH D GHF BCA A. niger endoxylanase complex A. niger endoxylanase TAXI - I TAXI - I 3 9 pH 3 9 pH 3 9 pH Fig. 4. IEF titration curves of TAXI-I, alone or in the presence of endoxylanases from A. niger, T. longibrachiatum M2 or B. subtilis.(A) A. niger endoxylanase, (B) a mixture of TAXI-I and A. niger endoxylanase with excess of TAXI-I, (C) TAXI-I, (D) a mixture of TAXI-I and T. longibrachiatum M2 endoxylanase with excess of enzyme, (E) a mixture of TAXI-I and T. longibrachiatum M2 endoxylanase with excess of inhibitor, (F) B. subtilis endoxylanase, (G) a mixture of B. subtilis endoxylanase and TAXI-I and (H) TAXI-I. K. Fierens et al. Role of TAXI-I His374 in endoxylanase inhibition FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS 5877 induced changes in interface charges. The pH-depend- ent stability of this enzyme-inhibitor complex cannot easily be rationalized since stability is reflected in the titration of several residues in the active site of the endoxylanase and TAXI-I itself. However, it can be partially explained by the weakened affinity of the TAXI-I His374 mutants for GH11 endoxylanases indi- cating that the presence of normally charged TAXI-I His374 is of utmost importance for hydrogen bonding and salt bridge interactions with Glu79, Glu170 and Asp37 of A. niger endoxylanase. These results are in perfect agreement with structural data of the A. niger endoxylanase–TAXI-I complex [16] and with results of Tahir and coworkers [24] who found that mutation of the negatively charged and pH-optimum related Asp37 of A. niger endoxylanase into neutral Ala completely abolishes interaction with TAXI-I. Recent data by Raedschelders et al. [25] showed the functional import- ance of His374 in the interaction between TAXI-type proteins and A. niger endoxylanase. Moreover, the TAXI combination His374 ⁄ Leu292 is required for A. niger endoxylanase inhibition by TAXI-type pro- teins. In a pH range 3.0–9.0, changes in interface charges are less critical for stabilization of the enzyme– inhibitor complexes of wild-type TAXI-I and endo- xylanases from B. subtilis or T. longibrachiatum M2 as such complexes were stable between pH 3.0–9.0. Indeed, SPR data showed that the increase in k off rate constants was smaller for B. subtilis and T. longibrachi- atum M2 endoxylanases than for interaction with A. niger endoxylanase. Hence, the IEF titration curves were in perfect agreement with the SPR analyses of the endoxylanase–TAXI-I interaction. Our results suggest that TAXI-I His374 is important for stabilization of the formed enzyme–inhibitor com- plex. Mutation of this amino acid residue to a variable degree affects the affinity of the enzyme–inhibitor interaction. Inhibition activity remains upon mutation of TAXI-I His374 for endoxylanases from P. funiculo- sum and T. longibrachiatum M3. This is strong evi- dence for additional inhibition determinants in the TAXI-I protein. Based on structural data [16], possible candidates are the neighboring amino acid residues of TAXI-I His374 such as Phe375 and Thr376 and the residues situated on another endoxylanase interaction TAXI-I loop, e.g. amino acid Leu292 as shown recently for A. niger endoxylanase [25]. Determination of the crystal structures of TAXI-I complexed with dif- ferent GH11 endoxylanases and mutational analysis of enzyme and inhibitor would provide insight in the cur- rently observed differences in enzyme-inhibitor affinity. In this way, the exact mechanism of endoxylanase inhi- bition by TAXI-I and the specific contributions of the amino acid residues at the interface of the enzyme– inhibitor complex would be unravelled. Conclusions Endoxylanase inhibition by TAXI-I is due to a speci- fic, reversible, high-affinity (in the nanomolar range) 1 : 1 stoichiometric interaction between GH11 endo- xylanases and TAXI-I. In addition to structural data of an A. niger endoxylanase–TAXI-I complex [16], site-directed mutagenesis studies showed that TAXI-I His374 plays an important role in the stabilization of the enzyme–inhibitor complex rather than in the dock- ing of the inhibitor onto the enzyme. It is also conclu- ded that TAXI-I His374 is not the sole critical amino acid residue for endoxylanase inhibition. The work proved that substitution of a single specific amino acid residue strongly affects the affinity of the inhibitor for the enzyme. This fact opens new perspectives for devel- opment of novel TAXI mutants with adapted endo- xylanase specificity. Experimental procedures Materials Primers were from Proligo Primers and Probes (Paris, France) and restriction enzymes were from Roche Diagnos- tics (Basel, Switzerland). Escherichia coli TOP10 (Invitro- gen, Carlsbad, CA, USA) cells were used for cloning while Pichia pastoris strain X33 (Invitrogen) was used for protein expression experiments. GH11 endoxylanases were from Aspergillus niger (M4 from Megazyme (Bray, Ireland), Swissprot P55329), Bacillus subtilis (Grindamyl H640 from Danisco (Brabrand, Denmark), Swissprot P18429), Tricho- derma longibrachiatum (formerly T. reesei) (M2 and M3 from Megazyme, Swissprot P36218 and P36217, respect- ively), Penicillium funiculosum (xynC, GenBank acc. num- ber CAC15487; kind gift from C. Furniss, I.F.R., Norwich, UK) and Trichoderma viride (M1 from Megazyme, Swiss- prot AJ012718). Site-directed mutagenesis of TAXI-I His374: plasmid construction and P. pastoris transformation The contribution of amino acid His374 of TAXI-I to endo- xylanase inhibition was studied by mutation of this amino acid residue into alanine, lysine or glutamine. Site-directed mutagenesis was performed using a ‘two-round’ PCR method for mutants H374A and H374K. As His374 is situ- ated near the end of the TAXI-I coding sequence [19], a first round PCR reaction was performed incorporating the Role of TAXI-I His374 in endoxylanase inhibition K. Fierens et al. 5878 FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS H374A mutation with a reverse primer and amplifying the complete TAXI-I coding sequence except its C-terminal end. In a second PCR reaction, the complete coding sequence was amplified with a reverse primer that over- lapped with the first PCR product. PCR reactions were per- formed in 30 lL using 2 units cloned Pfu DNA polymerase (Stratagene, La Jolla, CA, USA), commercially supplied buffer, 200 lm of each dNTP, 1 lm of each primer and 5 ng of template DNA. The reaction mixtures were incuba- ted for 2 min at 95 °C, followed by 35 cycles of 1 min at 95 °C (dissociation), 90 s at 47 °C (annealing), 2 min at 72 °C (extension), and a final extension step for 20 min at 72 °C on a Mastercycler gradient (Eppendorf, Hamburg, Germany). For the first round of PCR, plasmid pQE16- SSPelB TAXI-I [19] was used as DNA template together with forward primer XIF1 (Table 3), comprising a BglII restriction site, and reverse mutagenic primer XI019 (Table 3) to incorporate the mutations. The obtained PCR- product was gel-purified using the QIAquick Gel Extraction Kit (Qiagen) and used as DNA template for the final PCR round. The coding sequence of TAXI [H374A] was amplified completely using forward primer XIF1 and reverse primer XIR2 (Table 3), both comprising BglII restriction sites, and the same PCR conditions as above. Again, the PCR prod- uct was gel-purified and 3¢A-overhangs were added with 1 Unit Supertaq DNA polymerase (SphaeroQ, Leiden, the Netherlands) during 10 min at 72 °C. The PCR product was cloned in the pCRÒ4-TOPOÒ TA cloning vector (Invitrogen) according to the manufacturer’s instructions. Vectors with insert were retained and sequenced on a 377 DNA Sequencer using ABI PRISM Big Dye Terminator chemistry (Applied Biosystems, Foster City, CA, USA) and vector-specific primers. A BglII-restricted TAXI-H374A insert was cloned into the BsmBI restriction site of the P. pastoris pPICZaC vector (Invitrogen) for protein secre- tion. Proper insert orientation was verified by restriction digestion and sequencing. Mutant TAXI [H374K] was pre- pared in the same way. Only for the first round of PCR, forward primer XIF1 and reverse mutagenic primer XI022 (Table 3) were used. For the construction of the TAXI [H374Q] mutant, the QuikChangeÒ Site-Directed Mutagenesis Kit (Stratagene) was used. One pair of complementary mutant primers XI036 and XI037 (Table 3) was used for the amplification and introduction of mutation H374Q into the pPICZaC- TAXI-I plasmid [26]. All reactions were performed accord- ing to the manufacturer’s instructions. The obtained vector was sequenced to confirm the desired mutation. The vectors pPICZaC-TAXI-H374A ⁄ K ⁄ Q were linea- rized with Pme I and used for transformation by means of homologous recombination of the P. pastoris X33 genome according to the EasyComp TM Transformation protocol (Invitrogen). Genomic DNA of Zeocin TM -resistant Pichia transformants was isolated [27] and incorporation of the mutant TAXI-I gene was determined by PCR using vector- specific primers and HotStarTaq DNA polymerase (Invitro- gen). Expression and purification of TAXI-I and TAXI-I mutants Recombinant X33 TAXI-I and TAXI-I His374 mutants were produced in P. pastoris and purified using cation exchange and gel filtration chromatography as described by Fierens et al. [26]. Purification of GH11 endoxylanases for IEF titration curve analysis and SPR Endoxylanases from B. subtilis (extract of 1.0 g Grindamyl H640 in 5 mL 25 mm sodium acetate buffer pH 5.0), A. niger (1.0 mL, M4 from Megazyme) and T. longibrachia- tum M2 (1.0 mL, Megazyme) were purified to homogeneity using gel filtration chromatography. Endoxylanase samples were loaded on a Bio-Gel P-30 Gel fine (BioRad, Hercules, CA, USA, 16 mm · 65 cm) column and fractionated at 0.2 mLÆmin )1 using 250 mm sodium acetate buffer pH 5.0. Highly pure endoxylanase fractions were used for IEF titra- tion curve analysis and SPR. Protein concentration determination Protein concentrations of purified proteins were determined by measuring the absorbance at 280 nm. The molar extinc- tion coefficients (m )1 Æcm )1 ) were calculated from the amino acid sequences using the protparam tool [28]. The absor- bances, corresponding to a protein concentration of 1.000 mgÆmL )1 , are 4.013 AU (B. subtilis endoxylanase), 2.526 AU (A. niger endoxylanase), 2.464 AU (T. longibra- chiatum M2 endoxylanase), 0.763 AU (TAXI-I), 0.764 (TAXI [H374A] ), 0.763 AU (TAXI [H374K] ) and 0.763 AU (TAXI [H374Q] ), respectively. Endoxylanase inhibition assay Endoxylanase inhibition activities were determined with a routinely used variant of the colorimetric Xylazyme-AX method as described by Fierens et al. [26]. The endoxylanases Table 3. Primers used for TAXI-I mutational analysis. Mutagenic bases and restriction sites are in bold and underlined, respectively. Name Sequence XIF1 CCA AGATCTCTTCCGGTGCTCGCTCCG XIR2 CCT AGATCTTTACAGGCCGCCGCAACCCGTAAAG XI019 CCGCAACCCGTAAAGGCCGGCAGCCTG XI022 CCGCAACCCGTAAACTTCGGCAGCCTG XI036 GCAGGCTGCCGCAATTTACGGG XI037 CCCGTAAATTGCGGCAGCCTGC K. Fierens et al. Role of TAXI-I His374 in endoxylanase inhibition FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS 5879 were diluted in sodium acetate buffer (25 mm, pH 5.0) with 0.5 mgÆmL )1 bovine serum albumin (BSA). Inhibitor fractions were dissolved in 25 mm sodium acetate buffer (pH 5.0). One enzyme unit (EU) corresponded to an increase in absorbance of 1.0 at 590 nm under the condi- tions of the assay. One inhibition unit (IU) was defined as the amount of inhibitor that, under the conditions of the assay, reduces the A 590 of one EU by 50% (to 0.5). All inhibition activity measurements were performed in tripli- cate. CD spectroscopy CD spectra of TAXI-I, TAXI [H374A] and TAXI [H374K] were recorded with a JASCO Spectropolarimeter (J-810) (JASCO Benelux, B.V., Maarssen, the Netherlands) at room tem- perature using a 0.1 mm quartz cell path length. Three scans in the far-UV (260–180 nm) were recorded for each protein sample and averages are reported. The obtained ellipticities were expressed as molar ellipticities. Pure pro- tein samples of TAXI-I, TAXI [H374A] and TAXI [H374K] were prepared in phosphate buffer (10 mm, pH 6.0) at concen- trations of 17.5 lm, 17.0 lm and 16.8 lm, respectively. Surface plasmon resonance (SPR) analysis SPR allows direct visualization of real–time interactions and, hence, determination of complex association (k on ) and dissociation (k off ) rate constants. The kinetics of binding between TAXI-I wild-type, TAXI [H374A ⁄ K ⁄ Q] mutants and GH11 endoxylanases from A. niger, B. subtilis and T. longi- brachiatum M2 were analyzed in real time by SPR using a BIAcore 3000 (BIAcore, Uppsala, Sweden) system. Ran- dom amine coupling of TAXI-I wild-type and mutants was carried out by injecting the proteins (10 lgÆmL )1 each) in 10 mm sodium acetate, pH 5.0, following preactivation of the carboxymethylated dextran matrix (CM5 sensor chip) using N-hydroxysuccinimide (NHS) ⁄ N-ethyl-N¢-[3-(diethyl- amino)propyl]carbodiimide. After injection of the proteins, the residual NHS esters were deactivated by the injection of 25 lL of ethanolamine (1 m, pH 8.5). BIAcore 3000 sensorgrams [resonance units (RU) versus time] were recorded at a flow rate of 30 lL Æmin )1 at room temperature (22 °C), using different concentrations of analytes (A. niger endoxylanase: 300 nm, 600 nm, 1200 nm, 2205 nm; B. subtilis endoxylanase: 100 nm, 200 n m, 307 n m; T. longibrachiatum M2 endoxylanase: 50 nm, 100 nm, 200 nm) in sodium acetate running buffer (100 mm, pH 5.0). The runs were at least in duplicate for each analyte concen- tration using sensor chips coupled with 1200–1400 RU of protein. One RU corresponds to 1 pg of bound pro- tein ⁄ mm 2 . Association and dissociation data were both col- lected for 8 min. The sensor chips were regenerated at the end of each run by one 10 lL injection of 50 mm sodium hydroxide pH 12.0. Data obtained from parallel flow cells with coupled thrombin activatable fibrinolysis inhibitor [29] served as blank sensorgrams for subtraction of changes in the bulk refractive index. The sensorgrams were analyzed using biaevaluation ver- sion 3.1 software that provides both numerical integration and global fitting algorithms. The data were fitted to a single-site interaction model [1:1 (Langmuir) binding: A+B« AB]. Assuming pseudo-first-order interaction kin- etics, the rate of complex formation during sample injection is given by d[AB] ⁄ dt ¼ k on [A][B] – k off [AB], which may be expressed as dR ⁄ dt ¼ k on CR max –(k on C+k off )R, where dR ⁄ dt is the rate of change of the SPR signal, C is the con- centration of analyte, R max is the maximum analyte binding capacity in RU, and R is the recorded SPR signal in RU at time t. k off values were determined from the data collected during the dissociation phase (dR ⁄ dt ¼ -k off R), while k on values were derived from the above rate equation for complex formation. The equilibrium dissociation (K D ) con- stants were calculated from the kinetic rate constants (K D ¼ k off ⁄ k on ). Details of the rate equations are described in the BIAevaluation version 3 software manuals. IEF titration curve analysis IEF titration curve analysis was performed with the Phast- System TM (Amersham Biosciences, Uppsala, Sweden). Pro- tein samples were applied on a PhastGel IEF 3–9 (Amersham Biosciences). In the first dimension, carrier ampholytes contained in the gel were subjected to an elec- tric field (2000 V, 2.5mA, 3.5 W, 15 °C and 150 Vh) to gen- erate a pH gradient (3–9). The gel was then rotated clockwise 90°, and the protein sample was applied perpen- dicular to the pH gradient. The focusing step was then performed (1000 V, 2.5mA, 0.2 W, 15 °C and 40–50Vh). Protein samples (1–5 ng of inhibitor, endoxylanase or endo- xylanase–inhibitor complex ⁄ well) were solubilized in 25 mm sodium acetate buffer (pH 5.0) and incubated during 30 min at room temperature before applying them onto the gel. Finally, proteins were silver stained as described in Amersham Biosciences’ development technique file 210. Acknowledgements The authors thank Dr Y. Engelborghs and M. Hellings (Laboratory of Biomolecular Dynamics, K.U. Leuven, Leuven, Belgium) for helpful discussions and technical assistance concerning the CD spectra measurements. We gratefully acknowledge Griet Compernolle for technical assistance with the SPR analyses. Financial support was obtained from the ‘Bijzonder Onder- zoeksfonds’ (K.U. Leuven, Belgium). This study was carried out in the framework of research project GOA ⁄ 03⁄ 10 financed by the Research Fund K.U. Leu- ven and with financial support from the ‘Fonds voor Role of TAXI-I His374 in endoxylanase inhibition K. Fierens et al. 5880 FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS Wetenschappelijk onderzoek-Vlaanderen’ (F.W.O. Vla- anderen, Brussels, Belgium). A.G., K.G., A.R and S.V.C. are postdoctoral fellows of the F.W.O. Vlaand- eren. GBOU project funding by the ‘Instituut voor de aanmoediging van Innovatie door Wetenschap en Technologie in Vlaanderen’ (I.W.T., Brussels, Belgium) is gratefully acknowledged. References 1 Kulkarni N, Shendye A & Rao M (1999) Molecular and biotechnological aspects of xylanases. FEMS Microbiol Rev 23, 411–456. 2 Fincher GB & Stone BA (1986) Cell walls and their components in cereal grain technology. In Advances in Cereal Science and Technology, pp. 207–295. American Association of Cereal Chemists: St Paul, Minnesota, USA. 3 Coutinho PM & Henrissat B (1999) Carbohydrate- active enzymes: an integrated database approach. In Recent Advances in Carbohydrate Bioengineering (Gilbert HJ, Davies G, Henrissat B & Svensson B, eds), pp. 3–12. The Royal Society of Chemistry, Cambridge, UK. 4To ¨ rro ¨ nen A, Harkki A & Rouvinen J (1994) Three- dimensional structure of endo-1,4-b-xylanase II from Trichoderma reesei: two conformational states in the active site. EMBO J 13, 2493–2501. 5 Simpson DJ, Fincher GB, Huang AHC & Cameron- Mills V (2002) Structure and function of cereal and related higher plant (1 fi 4)-b-xylan endohydrolases. J Cereal Sci 37, 111–127. 6 Derewenda U, Swenson L, Green R, Wei Y, Morosoli R, Shareck F, Kluepfel D & Derewenda ZS (1994) Crystal structure, at 2.6 A ˚ resolution, of the Strepto- myces lividans xylanase A, a member of the F family of b-1,4-d-glycanases. J Biol Chem 269, 20811–20814. 7 Sinnot ML (1990) Catalytic mechanisms of enzymic glycosyl transfer. Chem Rev 90, 1171–1202. 8 Krengel U & Dijkstra BW (1996) Three-dimensional structure of endo-1,4-b-xylanase I from Aspergillus niger: molecular basis for its low pH optimum. J Mol Biol 263, 70–78. 9 Christophersen C, Andersen E, Jacobsen TS & Wagner P (1997) Xylanases in wheat separation. Starch ⁄ Sta ¨ rke 1, 5–12. 10 Courtin CM & Delcour JA (2002) Arabinoxylans and endoxylanases in wheat flour bread-making. J Cereal Sci 35, 225–243. 11 Bedford MR & Schulze H (1998) Exogenous enzymes for pigs and poultry. Nutr Res Rev 11, 91–114. 12 Gebruers K, Brijs K, Courtin CM, Fierens K, Goesaert H, Rabijns A, Raedschelders G, Robben J, Sansen S, Sørensen JF et al. (2004) Properties of TAXI-type endo- xylanase inhibitors. Biochim Biophys Acta 1696, 213– 221. 13 Goesaert H, Elliott G, Kroon PA, Gebruers K, Courtin CM, Robben J, Delcour JA & Juge N (2004) Occur- rence of proteinaceous endoxylanase inhibitors in cereals. Biochim Biophys Acta 1696, 193–202. 14 Juge N, Payan F & Williamson G (2004) XIP-I, a xyla- nase inhibitor protein from wheat: a novel protein func- tion. Biochim Biophys Acta 1696, 203–211. 15 Gebruers K, Debyser W, Goesaert H, Proost P, Van Damme J & Delcour JA (2001) Triticum aestivum L. endoxylanase inhibitor (TAXI) consists of two inhibi- tors, TAXI I and TAXI II, with different specificities. Biochem J 353, 239–244. 16 Sansen S, De Ranter CJ, Gebruers K, Brijs K, Courtin CM, Delcour JA & Rabijns A (2004) Structural basis for inhibition of Aspergillus niger xylanase by Triticum aestivum xylanase inhibitor-I. J Biol Chem 279, 36022– 36028. 17 McLauchlan WR, Garcia-Conesa MT, Williamson G, Roza M, Ravestein P & Maat J (1999) A novel class of protein from wheat which inhibits xylanases. Biochem J 338, 441–446. 18 Payan F, Flatman R, Porciero S, Williamson G, Juge N & Roussel A (2003) Structural analysis of xylanase inhi- bitor protein I (XIP-I), a proteinaceous xylanase inhibi- tor from wheat (Triticum aestivum, var. Soisson). Biochem J 372, 399–405. 19 Fierens K, Brijs K, Courtin CM, Gebruers K, Goesaert H, Raedschelders G, Robben J, Van Campenhout S, Volckaert G & Delcour JA (2003) Molecular identifica- tion of wheat endoxylanase inhibitor TAXI-I, member of a new class of plant proteins. FEBS Lett 540, 259– 263. 20 Elliott GO, Hughes RK, Juge N, Kroon PA & William- son G (2002) Functional identification of the cDNA coding for a wheat endo-1,4-b-d-xylanase inhibitor. FEBS Lett 519, 66–70. 21 Flatman R, McLauchlan WR, Juge N, Furniss C, Berrin J-G, Hughes RK, Manzanares P, Ladbury JE, O’Brien R & Williamson G (2002) Interactions defining the specificity between fungal xylanases and the xyla- nase-inhibiting protein XIP-I from wheat. Biochem J 365, 773–781. 22 Furniss CSM, Belshaw NJ, Alcocer MJC, Williamson G, Elliott GO, Gebruers K, Haigh NP, Fish NM & Kroon PA (2002) A family 11 xylanase from Penicillium funiculosum is strongly inhibited by three wheat xylanase inhibitors. Biochim Biophys Acta 1598, 24–29. 23 Brutus A, Villard C, Durand A, Tahir T, Furniss C, Puigserver A, Juge N & Giardina T (2004) The inhibi- tion specificity of recombinant Penicillium funiculosum xylanase B towards wheat proteinaceous inhibitors. Biochim Biophys Acta 1701, 121–128. K. Fierens et al. Role of TAXI-I His374 in endoxylanase inhibition FEBS Journal 272 (2005) 5872–5882 ª 2005 The Authors Journal compilation ª 2005 FEBS 5881 [...]... (2005) Molecular identification of wheat endoxylanase inhibitor TAXI-II and the determinants of its inhibition specificity Biochem Biophys Res Commun 335, 512–522 26 Fierens K, Geudens N, Brijs K, Courtin CM, Gebruers K, Robben J, Van Campenhout S, Volckaert G & Delcour JA (2004) High-level expression, purification and 5882 characterization of recombinant wheat xylanase inhibitor TAXI-I secreted by the yeast...Role of TAXI-I His374 in endoxylanase inhibition K Fierens et al 24 Tahir TA, Durand A, Gebruers K, Roussel A, Williamson G & Juge N (2004) Functional importance of Asp37 from a family 11 xylanase in the binding to two proteinaceous xylanase inhibitors from wheat FEMS Microbiol Lett 239, 9–15 25 Raedschelders G, Fierens K, Sansen... 37, 39–46 27 Fujimura HA & Sakuma Y (1993) Simplified isolation of chromosomal and plasmid DNA from yeasts Biotechniques 14, 538–540 28 Gill SC & von Hippel PH (1989) Calculation of protein extinction coefficients from amino acid sequence data Anal Biochem 182, 319–326 29 Hendriks D, Scharpe S, Van Sande M & Lommaert MP (1989) Characterisation of a carboxypeptidase in human serum distinct from carboxypeptidase . His374 of wheat endoxylanase inhibitor TAXI-I stabilizes complex formation with glycoside hydrolase family 11 endoxylanases Katleen. 22 September 2005) doi:10 .111 1/j.1742-4658.2005.04987.x Wheat endoxylanase inhibitor TAXI-I inhibits microbial glycoside hydro- lase family 11 endoxylanases. Crystallographic