Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt

The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p Ruth Nebauer1, Irmgard Schuiki1, Birgit Kulterer2, Zlatko Trajanoski2 and Gunther Daum1 ă Institute of Biochemistry, Graz University of Technology, Austria Institute for Genomics and Bioinformatics and Christian-Doppler Laboratory for Genomics and Bioinformatics, Graz University of Technology, Austria Keywords mitochondria; Oxa1p; phosphatidylethanolamine; phosphatidylserine decarboxylase; yeast Correspondence G Daum, Institute of Biochemistry, Graz University of Technology, Petersgasse 12 ⁄ 2, A-8010 Graz, Austria Fax: +43 316 873 6952 Tel: +43 316 873 6462 E-mail: guenther.daum@tugraz.at (Received 27 August 2007, revised 10 October 2007, accepted 11 October 2007) doi:10.1111/j.1742-4658.2007.06138.x The majority of phosphatidylethanolamine, an essential component of yeast mitochondria, is synthesized by phosphatidylserine decarboxylase (Psd1p), a component of the inner mitochondrial membrane Here, we report that deletion of OXA1 encoding an inner mitochondrial membrane protein translocase markedly affects the mitochondrial phosphatidylethanolamine level In an oxa1D mutant, cellular and mitochondrial levels of phosphatidylethanolamine were lowered similar to a mutant with PSD1 deleted, and the rate of phosphatidylethanolamine synthesis by decarboxylation of phosphatidylserine in vivo and in vitro was decreased This was due to a lower PSD1 transcription rate in the oxa1D mutant compared with wild-type and compromised assembly of Psd1p into the inner mitochondrial membrane Lack of Mba1p, another component involved in the assembly of mitochondrial proteins into the inner mitochondrial membrane, did not affect the amount of phosphatidylethanolamine or the assembly of Psd1p Deletion of the inner membrane protease Yme1p enhanced Psd1p stability suggesting that Yme1p contributed substantially to the proteolytic turnover of Psd1p in wild-type In summary, our results demonstrate a link between the mitochondrial protein import machinery, assembly and stability of Psd1p, and phosphatidylethanolamine homeostasis in yeast mitochondria Phosphatidylserine decarboxylases (PSDs) catalyze the formation of phosphatidylethanolamine (PtdEtn) from phosphatidylserine (PtdSer) These enzymes play a key role in phospholipid metabolism from bacteria to humans In the yeast Saccharomyces cerevisiae there are two different PSDs, Psd1p, which is associated with the inner mitochondrial membrane (IMM) [1], and Psd2p, which is a component of the Golgi [2] Unlike bacteria, yeast and other eukaryotes can also synthesize PtdEtn via a pathway that is independent of PSDs and uses cytidine diphosphate-ethanolamine and diacylglycerol as substrates [3,4] PtdEtn is an essential component of yeast mitochondrial membranes Depletion of PtdEtn in mitochondria leads to dysfunctions in respiration, defects in the assembly of mitochondrial protein complexes and loss of mitochondrial DNA [5–7] Deletion of the major PtdEtn-synthesizing enzyme, Psd1p, causes a substantial decrease in PtdEtn in cellular and mitochondrial membranes, thereby conferring a petite phenotype characterized by a loss of respiratory capacity [5] The link between cell respiration and PtdEtn homeostasis in mitochondria tempted us to speculate that: (a) other defects resulting in the depletion of mitochondrial Abbreviations IMM, inner mitochondrial membrane; PSD, phosphatidylserine decarboxylase; PtdCho, phosphatidylcholine; PtdEtn, phosphatidylethanolamine; PtdIns, phosphatidylinositol; PtdSer, phosphatidylserine 6180 FEBS Journal 274 (2007) 6180–6190 ª 2007 The Authors Journal compilation ª 2007 FEBS R Nebauer et al PtdEtn may also cause the petite phenotype, and ⁄ or (b) petite mutations may generally affect the formation of mitochondrial PtdEtn Based on this hypothesis, we screened a yeast petite mutant collection [8] for strains with abnormal phospholipid patterns Among the candidate strains identified (R Nebauer, unpublished results), a mutant with OXA1 deleted exhibited marked PtdEtn depletion Oxa1p is a polypeptide involved in the insertion of mitochondrially encoded proteins into the IMM, but it also mediates the assembly of nuclear-encoded proteins into this submitochondrial fraction [9] The import of proteins synthesized on cytoplasmic ribosomes into mitochondria starts with translocation across the outer mitochondrial membrane, mediated by a general import machinery, the translocase of the outer membrane complex Assembly of polypeptides into the IMM requires an energized IMM and another translocation machinery, the translocase of the inner membrane complex [9–12] IMM proteins are targeted to mitochondria by N-terminal targeting signals, imported into the mitochondrial matrix and sorted to the IMM via a specific export pathway [9,13–15] Proteins with their N-termini protruding into the intermembrane space attain their membrane orientation by physical interaction with Oxa1p [16], although the function of this protein is not limited to proteins that undergo N-terminal tail export Recently, Mba1p was identified as a protein that interacts with the Oxa1p insertion machinery of the IMM [17] Mba1p binds to the large subunit of mitochondrial ribosomes and thereby cooperates with the C-terminal ribosome-binding domain of Oxa1p to ensure proper insertion of proteins into the IMM Like the majority of mitochondrial proteins, the mitochondrial PtdSer decarboxylase Psd1p is encoded by a nuclear gene, synthesized as a larger precursor on cytoplasmic ribosomes and imported post-translationally into mitochondria [18] As indicated in the UniProt knowledge base (http://www.uniprot.org ⁄ ), the yeast Psd1p proenzyme has one potential mitochondrial targeting sequence and an a-chain and b-chain linked by a defined cleavage site [19] According to von Heijne [20] or applications available at ExPASy (http://www.expasy.org/) [21], Psd1p localized to the IMM [1] has at least one transmembrane domain The N-terminus of Psd1p contains motifs for protein targeting to mitochondria and specifically to the IMM ⁄ intermembrane space [18,22] In this study, we analyzed the roles of Oxa1p, Mba1p and the IMM protease Yme1p in the formation of PtdEtn by Psd1p We demonstrate that in an oxa1D mutant inefficient assembly of Psd1p into the Phosphatidylethanolamine of yeast mitochondria IMM leads to decreased PtdEtn levels in yeast mitochondria No such effect could be observed in an mba1D strain Moreover, we show that lack of the IMM protease Yme1p prevents degradation of Psd1p resulting in partial protection of its enzymatic activity Thus, specific components of the mitochondrial biosynthetic machinery indirectly affect phospholipid homeostasis in this organelle Results The oxa1D mutant has an abnormal phospholipid composition Screening of a set of petite (respiratory-deficient) yeast strains [8,23] for defects in the PtdEtn and phosphatidylcholine (PtdCho) biosynthetic pathways revealed a number of candidate genes whose deletion caused changes in the amounts of at least one of the major phospholipids PtdCho, PtdEtn, and ⁄ or phosphatidylinositol (PtdIns) in the cell homogenate and ⁄ or mitochondria (R Nebauer, unpublished data) One of these strains exhibiting decreased cellular PtdEtn levels compared with wild-type was the oxa1D mutant (Table 1), which is known to bear a defect in protein translocation from the mitochondrial matrix to the IMM (see above) Fluorescence microscopic inspection employing DAPI staining revealed mitochondrial DNA in wildtype and oxa1D The amount of mitochondrial DNA appeared to be lower in oxa1D than in wild-type Thus, the petite phenotype of the mutant was not caused by a rho°-mutation The decrease in cellular PtdEtn in oxa1D was compensated by increased amounts of PtdIns, and also of lysophospholipids, phosphatidic acid and, to a lesser extent, PtdCho (Table 1) The decrease and compensation in oxa1D were similar to psd1D, which lacks the major enzyme of cellular PtdEtn formation, mitochondrial Psd1p In oxa1D mitochondria, the effect of PtdEtn depletion was even more pronounced than in total cell extracts Depletion of mitochondrial PtdEtn in oxa1D was mainly compensated by an increase in PtdIns and, to a lesser extent, PtdCho Although the decrease in PtdEtn in oxa1D mitochondria was comparable with that in psd1D, there was a difference in the amount of mitochondrial PtdSer in these two strains In psd1D, PtdSer imported into mitochondria from the endoplasmic reticulum [3] was not further converted to PtdEtn and accumulated in this organelle to some extent, whereas no such accumulation was observed with oxa1D Lack of such an accumulation appears to be due to residual Psd1p activity in oxa1D mitochondria, as shown below FEBS Journal 274 (2007) 6180–6190 ª 2007 The Authors Journal compilation ª 2007 FEBS 6181 6182 ± ± ± ± ± ± ± ± ± ± ± ± 0.07 0.26 0.05 0.14 0.09 2.64 0.25 0.04 0.16 0.14 0.20 0.15 0.67 3.15 0.15 0.79 1.15 2.83 1.42 3.52 1.86 3.89 1.13 5.24 1.03 5.17 1.53 3.68 3.92 4.21 1.73 3.59 1.65 2.04 2.34 2.21 During our studies of oxa1D-dependent PtdEtn depletion in yeast mitochondria we also investigated the effect on PtdEtn homeostasis of other yeast gene products that are related or linked to the Oxa1pdependent protein translocation machinery These strains were mutants of MBA1, which encodes a component involved in the Oxa1p-dependent export of mitochondrially encoded proteins into the IMM [17], and YME1, which encodes an intermembrane spacelocated ATP-dependent AAA protease (ATPase associated with various cellular activities) [24] The mba1D deletion strain exhibited only a slight decrease in total cellular PtdEtn and essentially the same mitochondrial phospholipid pattern as wild-type (Table 1) The yme1D and yme1D oxa1D mutants contained cellular and mitochondrial amounts of PtdEtn (Table 1) that exceeded wild-type levels 4.25 4.64 3.59 3.07 2.96 3.89 5.04 4.73 2.75 1.93 2.97 2.76 0.98 1.67 2.62 2.91 1.14 3.48 1.92 1.72 0.42 2.17 0.26 2.36 ± ± ± ± ± ± ± ± ± ± ± ± 5.87 3.83 8.62 7.77 6.13 3.82 7.64 4.62 6.59 4.96 6.78 4.12 ± ± ± ± ± ± ± ± ± ± ± ± 14.96 11.09 17.55 16.85 17.91 16.71 17.35 10.56 12.07 12.82 12.99 12.79 ± ± ± ± ± ± ± ± ± ± ± ± 28.04 30.37 16.68 18.67 20.93 20.27 24.83 30.12 35.58 40.78 34.01 39.14 ± ± ± ± ± ± ± ± ± ± ± ± yme1 oxa1 yme1 mba1 oxa1 psd1 HOM MIT HOM MIT HOM MIT HOM MIT HOM MIT HOM MIT BY4742 44.13 39.82 49.21 46.12 45.77 42.15 39.82 41.10 38.92 31.27 39.32 31.23 CF PtdCho 0.96 1.13 1.08 1.09 0.81 0.53 0.95 0.88 0.75 0.33 0.90 0.60 PtdEtn 0.48 0.61 0.23 0.28 0.31 0.30 0.61 0.79 0.54 0.55 0.82 0.49 PtdIns 0.27 0.16 0.42 0.28 0.25 0.29 0.28 0.29 0.28 0.34 0.35 0.18 PtdSer 0.06 0.04 0.06 0.03 0.08 0.04 0.08 0.08 0.17 0.08 0.16 0.06 LPL ± ± ± ± ± ± ± ± ± ± ± ± 0.01 0.04 0.04 0.07 0.01 0.08 0.03 0.03 0.01 0.04 0.01 0.02 ± ± ± ± ± ± ± ± ± ± ± ± 0.10 0.11 0.08 0.01 0.04 0.06 0.07 0.08 0.04 0.03 0.04 0.06 PA DMPE ± ± ± ± ± ± ± ± ± ± ± ± 0.02 0.08 0.03 0.06 0.06 0.11 0.05 0.09 0.02 0.03 0.03 0.03 CL ± ± ± ± ± ± ± ± ± ± ± ± 0.01 0.07 0.00 0.01 0.03 0.02 0.02 0.05 0.03 0.04 0.02 0.08 others 0.00 0.01 0.00 0.00 0.00 0.03 0.01 0.00 0.00 0.00 0.00 0.00 R Nebauer et al Strain % of total phospholipids Table Phospholipid composition of homogenate and mitochondria from cells grown on YPD CF, cellular fraction; HOM, homogenate; MIT, mitochondria; LPL, lysophospholipids; DMPE, dimethylphosphatidylethanolamine; PA, phosphatidic acid; CL, cardiolipin Mean values of at least three independent measurements and standard deviations (SD) are shown Phosphatidylethanolamine of yeast mitochondria Deletion of OXA1 affects the rate of PtdEtn synthesis by Psd1p in vivo Because mitochondrial Psd1p is the major producer of cellular PtdEtn, we hypothesized that the decrease in total cellular and mitochondrial PtdEtn levels in the oxa1D mutant were due to reduced activity of this enzyme To test this hypothesis, we performed in vivo experiments labeling PtdSer with [3H]serine and followed its conversion to PtdEtn and PtdCho in a timedependent manner (see Experimental procedures) All strains tested showed a linear increase in the formation of the three aminoglycerophospholipids within the selected timeframe, which enabled us to determine the rate of formation, i.e the incorporation of radiolabel per period, for each phospholipid The formation rates for PtdSer, PtdEtn and PtdCho in wild-type cells were set at 100%, and the corresponding rates for mutant strains were calculated accordingly As can be seen from Fig 1, deletion of OXA1 decreased the rate of formation of all aminoglycerophospholipids The rate of PtdSer synthesis decreased to 80%, the rate of PtdEtn formation to 70% and that of PtdCho synthesis to 60% of wild-type Because Oxa1p was assumed to compromise only the mitochondrial PtdEtn-synthesizing Psd1p, leaving the Golgi-located Psd2p unaffected, the decrease in the rate of PtdEtn synthesis in oxa1D confirmed a defect in Psd1p-dependent PtdEtn formation Under these circumstances, the decreased rate of PtdCho formation seemed to be due to the lowered rate of PtdEtn formation, whereas reduced PtdSer formation might reflect a response to a feedback regulatory mechanism It should be noted that the steady-state levels of individual phospholipids not necessarily reflect the rates of synthesis of the components FEBS Journal 274 (2007) 6180–6190 ª 2007 The Authors Journal compilation ª 2007 FEBS R Nebauer et al Phosphatidylethanolamine of yeast mitochondria Fig Deletion of OXA1 causes a decreased rate of PtdEtn synthesis in vivo Wild-type and mutant strains were labeled for 0, 15, 30, 45 and 60 with [3H]serine Incorporation of label into PtdSer, PtdEtn and PtdCho was determined by liquid-scintillation counting after separation of phospholipids by TLC (see Experimental procedures) The formation rate of PtdSer, PtdEtn and PtdCho of wild-type (black bars) was set at 100% Values are means from three independent experiments with mean deviations as indicated by the error bars In contrast to psd1D, however, the oxa1D mutation led to a smaller reduction of PtdEtn synthesis That the psd1D strain and the oxa1D psd1D double mutant had comparable rates of PtdEtn formation suggests that Oxa1p acted upstream of Psd1p Not unexpectedly, rates of PtdEtn formation in the oxa1D psd2D mutant were lower than in the psd2D mutant indicating an additive effect of these two mutations acting on two different pathways Taken together, deletion of OXA1 affected synthesis of PtdEtn by Psd1p, but did not completely abolish the activity of this enzyme Activity of Psd1p in vitro is impaired in oxa1D PtdEtn depletion in mitochondria and the decreased rate of Psd1p-dependent PtdEtn formation in oxa1D suggested a functional impairment of mitochondrial Psd1p To address the question of Psd1p enzyme activity we subjected subcellular fractions of an oxa1D mutant to enzymatic analyses As can be seen from Fig 2, the in vitro activity of Psd1p with oxa1D mitochondria was only 60% that of wild-type In mitochondria from the psd1D mutant there was no measurable Psd1p activity (data not shown) Psd1p activity in mitochondria from mba1D was not decreased, in line with the unchanged mitochondrial level of PtdEtn in this strain (Table 1) Studies on the stability of subunits of the mitochondrial membrane complexes Cox and ATPase revealed that these proteins are degraded in the absence of Oxa1p [25] When functional Oxa1p is missing the membrane subunits of these complexes cannot be assembled and are cleaved by the intermembrane space (i)-AAA protease Yme1p and ⁄ or by the matrix (m)AAA protease Afg3p ⁄ Yta12p To test whether Psd1p Fig The oxa1D mutation affects Psd1p activity in vitro Enzymatic assays were performed with isolated mitochondrial fractions from wild-type BY4742, mba1D, oxa1D, yme1D and yme1D oxa1D Values are expressed relative to wild-type which was set at 100% and are means from three independent experiments with mean deviations as indicated by the error bars stability was also affected by the presence or absence of these mitochondrial hydrolases, we analyzed Psd1p activity in the respective single mutants or in double mutants in combination with oxa1D Deletion of YME1 encoding the i-AAA protease led to a considerable increase in Psd1p activity (Fig 2), which is in line with the increased PtdEtn level in a deletion mutant compared with wild-type (Table 1) This observation was surprising because overexpression of the PtdEtn biosynthetic pathway enzymes phosphatidylserine synthase (Pss1p) and ⁄ or Psd1p did not change the PtdEtn level (R Birner-Gruenberger, unpublished results) The yme1D oxa1D double mutant showed an intermediate value for the Psd1p activities from the single mutants Yme1p appears to contribute markedly FEBS Journal 274 (2007) 6180–6190 ª 2007 The Authors Journal compilation ª 2007 FEBS 6183 Phosphatidylethanolamine of yeast mitochondria R Nebauer et al to the proteolytic turnover of Psd1p Deletions of either subunit of the m-AAA protease yta12D and afg3D, respectively, seemed to have no effects on Psd1p turnover (data not shown) and were not investigated further A A decreased transcription rate for PSD1 and a defect in Psd1p maturation are the molecular basis of the decreased rate of PtdSer decarboxylation in oxa1D mitochondria One obvious explanation for the decreased amount of Psd1p in oxa1D mitochondria was a possible reduction in the PSD1 transcription rate in the mutant To address this question we performed RT-PCR analyses of PSD1 mRNA with wild-type and oxa1D (see Experimental procedures) These analyses revealed a reduction in PSD1 mRNA in the mutant The transcription rate for PSD1 was repressed in oxa1D to  50% that of wild-type Thus, downregulation of PSD1 expression at the transcriptional level appears to be one reason for the decreased Psd1p activity in oxa1D Because Oxa1p had been shown to facilitate membrane assembly in several mitochondrial proteins (see above), it was tempting to speculate that it was also necessary for correct insertion of Psd1p into the IMM To test this hypothesis, we performed import experiments of radioactively labeled Psd1p into isolated mitochondria These in vitro assays (see Experimental procedures) allowed analysis of protein assembly into mitochondrial membranes independent of the transcriptional level of a respective gene The full-length precursor form of Psd1p was synthesized by a coupled transcription ⁄ translation reaction and incubated with wild-type and oxa1D mitochondria Complete processing of Psd1p occurred in three proteolytic steps (Fig 3A) The primary translation product of 57 kDa was cleaved to a first intermediate of 52 kDa, most likely during or immediately after the import process This cleavage step is in agreement with the finding that a positively charged amino acid stretch at the N-terminus of Psd1p serves as a mitochondrial targeting sequence Processing of Psd1p was continued by cleavage of a kDa fragment representing the intermembrane space sorting signal, yielding the second intermediate of 50 kDa Assembly of Psd1p into the IMM was completed by (autocatalytic) cleavage of the 50 kDa intermediate to one a-chain and one b-chain (4 and 46 kDa mature forms) The kDa a-subunit was not detected in electrophoretic analysis In oxa1D (Fig 3B), import and processing of Psd1p occurred more slowly than in wild-type resulting in a lower ratio of mature form to precursors Thus, 6184 B Fig Proteolytic processing of Psd1p Maturation of Psd1p was measured in wild-type BY4742 (A) and oxa1D (B) The primary translation product of 57 kDa (not shown in the diagram) was cleaved to a 52 kDa intermediate (d), which was further processed to yield a 50 kDa polypeptide (h) The final processing step leads to the formation of the mature 46 kDa b-subunit of Psd1p (*) For each time point, the amount of every single processing intermediate was expressed as percent of the sum of all intermediates Values are means from three independent experiments with mean deviations as indicated by the error bars deletion of OXA1 decreased both the transcription rate of PSD1 and the Psd1p assembly rate into the IMM Both effects appear to result in a reduced amount of enzymatically active Psd1p in the IMM and thus in a decreased capacity to form PtdEtn Discussion The biosynthetic scheme shown in Fig summarizes the possible ways in which the mitochondrial level of PtdEtn can be affected First, is the supply of PtdSer to the mitochondria as a precursor for PtdEtn formation by Psd1p This process includes synthesis of PtdSer in the endoplasmic reticulum by the PtdSer synthase Pss1p and translocation of PtdSer to the site of Psd1p-catalyzed decarboxylation in the IMM Second, mitochondrial factors may, directly or indirectly, FEBS Journal 274 (2007) 6180–6190 ª 2007 The Authors Journal compilation ª 2007 FEBS R Nebauer et al Phosphatidylethanolamine of yeast mitochondria Fig Factors affecting the PtdEtn level in mitochondria Pss1p (phosphatidylserine synthase 1), Psd1p (phosphatidylserine decarboxylase 1), Psd2p (phosphatidylserine decarboxylase 2), Dpl1p (dihydrosphingosine 1-phosphate lyase 1), import of PtdSer into mitochondria (x), export of PtdEtn from mitochondria (y), import of PtdEtn into mitochondria (z) and factors (F) affecting level and activity of Psd1p in mitochondria may contribute to the mitochondrial PtdEtn affect the activity of Psd1p, thereby decreasing or increasing the efficiency of mitochondrial PtdEtn formation Third, import and export of PtdEtn may contribute to a balance in the level of this phospholipid in mitochondria Finally, although not addressed specifically in this scheme, transcriptional ⁄ translational regulation of PSD1 expression has to be taken into account Similar to plants [26], increased levels of yeast mitochondrial Psd1p are not necessarily accompanied by an increase in the amount of mitochondrial PtdEtn In strains overexpressing Pss1p and ⁄ or Psd1p neither the PtdSer nor the PtdEtn level was markedly changed compared with wild-type (R Birner-Gruenberger, unpublished data) These findings imply that the amount of mitochondrial PtdEtn is tightly controlled by one of the above-mentioned regulatory mechanisms Alternatively, the wild-type level of Psd1p may already represent an excess of activity which cannot be enhanced further by increasing the amount of protein A search for components affecting mitochondrial PtdEtn levels led to the identification of mitochondrial components interacting directly with mitochondrial Psd1p One example of such a component is the mitochondrial prohibitin, Phb1p ⁄ Phb2p Recent studies in our laboratory demonstrated the synthetic lethality of a psd1D phb1 ⁄ 2D double mutant [7] It was speculated that the decreased PtdEtn level in mitochondria caused by psd1D might be harmful in the phb1 ⁄ 2D background, which by itself causes an increase in mitochondrial PtdEtn In view of the results of this study, this hypothesis appears to be wrong, because depletion of the mitochondrial PtdEtn level by oxa1D to an amount comparable with that in psd1D did not lead to synthetic lethality with phb1 ⁄ 2D (R Nebauer, unpublished results) Thus, it is the direct interaction of Psd1p and Phb1 ⁄ 2p or even a more complex effect through combination of the two gene products that may be important for mitochondrial function In this study, we demonstrate another mode of action that affects Psd1p activity in yeast mitochondria, namely disturbance of the import and assembly of this polypeptide into mitochondrial membranes We show that Oxa1p facilitates the import of Psd1p to its proper destination in the IMM Oxa1p has been characterized previously as a helper protein for the assembly of a number of other IMM proteins [9] In wild-type yeast cells, import into mitochondria, processing and assembly into mitochondrial membranes of Psd1p is accomplished by a three-step mechanism similar to Chinese hamster ovary cells [27] According to Boeckmann et al [28], Psd1p contains all the features of a typical IMM ⁄ intermembrane space protein, namely a positively charged N-terminal sequence followed by a hydrophobic stretch The three cleavage steps are accomplished by the mitochondrial-processing peptidase (MPP), the intermembrane space protease Imp1p and autocatalysis In oxa1D, the Psd1p processing rate was decreased (Fig 3) This resulted in slower utilization of the precursor polypeptide in the mutant than in wild-type, delayed formation of intermediates and finally a decreased appearance of the mature form Although only one intermediate step in the process, namely translocation of the 50 kDa intermediate to the IMM, appears to be directly affected by Oxa1p, the whole process of Psd1p assembly into the IMM occurs more slowly in the mutant than in the wild-type The residual Psd1p activity in oxa1D appears to be due to alternative import pathways In addition to the reduced rate of Psd1p import into mitochondria, the decreased transcription rate of PSD1 in oxa1D seems to play a role in imbalanced PtdEtn formation of the mutant We can only specu- FEBS Journal 274 (2007) 6180–6190 ª 2007 The Authors Journal compilation ª 2007 FEBS 6185 Phosphatidylethanolamine of yeast mitochondria R Nebauer et al late at present that a negative feedback control caused by unassembled Psd1p precursor or intermediate proteins might trigger this transcriptional regulation However, the additive effects of reduced PSD1 transcription and Psd1p assembly are sufficient to cause a limitation of active Psd1p being present in mitochondria of oxa1D Another component that affects the mitochondrial level of Psd1p activity is the intermembrane space protease Yme1p In a yme1D strain, Psd1p activity exceeded the wild-type level, and in the oxa1D background, yme1D restored Psd1p activity to a higher level than wild-type Under the latter conditions, Oxa1p-independent insertion of Psd1p seems to be sufficient to ensure assembly of a functional enzyme exhibiting activity higher than wild-type We assume from these results that Yme1p contributes to Psd1p degradation and turnover In a yme1D strain, an excess of Psd1p appears to accumulate in the IMM leading to the observed effects of enhanced enzyme activity and increased PtdEtn levels In summary, our results demonstrate a link between the mitochondrial machinery of protein assembly and PtdEtn homeostasis in mitochondria and the whole cell We have to keep in mind, however, that depletion of mitochondrial PtdEtn by the various possible effects described appears to negatively affect proteins involved in mitochondrial function or membrane properties and may thus contribute to a petite phenotype (respiratory defect) By contrast, it should be noted that not all respiratory defects of mitochondria need to be linked to lipid defects in mitochondrial membranes as documented by a recent screening of petite strains in our laboratory (R Nebauer, unpublished results) Rather it appears that Psd1p-dependent PtdEtn formation is affected by a distinct set of mitochondrial proteins, e.g Oxa1p, which are involved in the correct assembly of Psd1p into the IMM Experimental procedures Strains and culture conditions The yeast strains used in this study are listed in Table Yeast mutants exhibiting a petite phenotype as described by Dimmer et al [8] were obtained from the Euroscarf strain collection (Frankfurt, Germany) S cerevisiae strains were grown under aerobic conditions at 30 °C on YPD medium containing 1% yeast extract, 2% peptone, and 2% glucose as the carbon source For large scale cultivation, inoculations to a D600 of 0.1 in fresh medium were made by diluting precultures grown to the stationary phase For auxotrophy tests, yeast strains were cultivated on solid synthetic medium [29] Plasmid and strain constructions Primers used in this study are listed in Table The yeast deletion mutants oxa1D::His3MX6 and psd1D::His3MX6 were constructed as described by Longtine et al [30] Primers OXA1-F1 and OXA1-R1 or PSD1-F1 and PSD2-F2, respectively, were used to amplify the His3MX6 disruption cassette The cassette was introduced into the respective strain by lithium acetate transformation [31] Correct insertion of the cassette was tested by growing strains on selective media without the respective amino acid and by colony PCR with the appropriate primers Double-deletion mutants were constructed by mating the corresponding single-deletion mutants, sporulation of zygotes, and tetrad dissection using standard methods Identity of strains was confirmed by marker-dependent growth and colony PCR Fluorescence microscopy Visualization of mitochondrial DNA in living cells was performed using the fluorescent dye DAPI In brief, cells were grown in YPD medium over night at 30 °C An inoculation to a D600 of 0.3 in fresh medium was made by diluting of Table Yeast strains used in this study Strain Genotype Source ⁄ Reference Y00000 Y00148 Y02043 Y04800 Y06224 Y07144 Y10000 Y13325 Y16151 YRN2 YRN3 YRN12 BY4741 Mata his3D1 leu2D0 met15D0 ura3D0 BY4741 Mata his3D1 leu2D0 met15D0 ura3D0 afg3D::KanMX4 BY4741 Mata his3D1 leu2D0 met15D0 ura3D0 psd1D::KanMX4 BY4741 Mata his3D1 leu2D0 met15D0 ura3D0 psd2D::KanMX4 BY4741 Mata his3D1 leu2D0 met15D0 ura3D0 yta12D::KanMX4 BY4741 Mata his3D1 leu2D0 met15D0 ura3D0 yme1D::KanMX4 BY4742 Mata his3D1 leu2D0 lys2D0 ura3D0 BY4742 Mata his3D1 leu2D0 lys2D0 ura3D0 mba1D::KanMX4 BY4742 Mata his3D1 leu2D0 lys2D0 ura3D0 oxa1D::KanMX4 BY4742 Mata his3D1 leu2D0 lys2D0 ura3D0 oxa1D::KanMX4 psd1D::His3MX6 BY474X Mata his3D1 leu2D0 met15D0 ura3D0 oxa1D::KanMX4 psd2D::KanMX4 BY4741 Mata his3D1 leu2D0 met15D0 ura3D0 oxa1D::His3MX6 yme1D::KanMX4 Euroscarf Euroscarf Euroscarf Euroscarf Euroscarf Euroscarf Euroscarf Euroscarf Euroscarf This study This study This study 6186 FEBS Journal 274 (2007) 6180–6190 ª 2007 The Authors Journal compilation ª 2007 FEBS R Nebauer et al Phosphatidylethanolamine of yeast mitochondria Table Primers used to construct strains for in vitro transcription ⁄ translation of PSD1 and RT-PCR described in this study The underlined sequences are homologous to the His3MX6 disruption cassette (OXA1-F1, OXA1-R1, PSD1-F1, PSD1-R1) or to the PSD1 ORF (PSD1-T1) Primer PSD1-U1 is complementary to the region spanning the stop codon of the PSD1 ORF Primer Primer sequence (5¢- to 3¢) OXA1-F1 OXA1-R1 PSD1-F1 PSD1-R1 PSD1-T1 PSD1-U1 PSD1-RT FW PSD1-RT REV GTTCACGTACAAGCGGAGCCACAGAATAACCTCCCCGACGCGGATCCCCGGGTTAATTAA GTTTTATATTTTTATATTTACAGAGAGATATAGAGCCTTTATGAATTCGAGCTCGTTTAAAC GCCAGTTAAGAACGCCTTGGCGCAAGGGAGGACGCTCCTCCGGATCCCCGGGTTAATTAA CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC TCTAATACGACTCACTATAGGGAGAATGTCAATTATGCCAGTTAAG CTTTACATATGATTGCTTTCATTTTAAATCATTCTTTCC AGAACTGCGGTGCTATGGAATAGA TTTGGCACGATCCACAATCTC an overnight culture and cells were harvested in the mid-log phase DNA was stained with 2.5 lgỈmL)1 of DAPI dissolved in NaCl ⁄ Pi at 30 °C for 30 After staining, cells were rinsed once with NaCl ⁄ Pi and then resuspended in NaCl ⁄ Pi Suspensions were placed on a glass slide and covered with a cover slip Cells were then visualized using a fluorescence microscope (Axiovert 35, Carl Zeiss, Jena, Germany) with the appropriate filter set for the blue-emitting fluorochrome DAPI and a 100-fold oil immersion objective Mitochondrial DNA was visualized as smaller spots distinct from larger nuclear DNA At least 100 cells from all strains to be tested were inspected Labeling of aminoglycerophospholipids in vivo Labeling of aminoglycerophospholipids in vivo was determined by following the incorporation of [3H]serine into PtdSer, PtdEtn and PtdCho as described by Birner et al [7] For each time point, an equivalent of 10 D600 from an overnight culture ( mL, corresponding to 1.45 · 108 cells) was harvested, washed once, suspended in 500 lL YPD and incubated for 30 at 30 °C Cells were labeled with 10 lCi [3H]serine (27 CiỈmmol)1, Perkin– Elmer, Boston, MA) per time point Samples were taken at 0, 15, 30 and 60 min, put on ice and harvested by centrifugation Chloroform ⁄ methanol (2 : 1, v ⁄ v) and glass beads, mL each, were added to the cell pellets For disintegration of cells samples were shock frozen in liquid nitrogen and shaken vigorously on an IKAÒ Vibrax VXR for 15 at °C Then, lipids were extracted for 30 by the method of Folch et al [32] Individual phospholipids were separated by TLC on Silica gel 60 plates (Merck, Darmstadt, Germany) with chloroform ⁄ methanol ⁄ 25% ammonia (50 : 25 : 6, v ⁄ v ⁄ v) as a developing solvent Spots on TLC plates were stained with iodine vapor, scraped off and suspended in mL scintillation cocktail (Packard BioScience, Groningen, the Netherlands) containing 5% water Radioactivity was determined by liquid scintillation counting using a Packard TriCarbÒ Liquid Scintillation Analyzer Preparation of subcellular fractions, protein analysis, and enzymatic analysis Mitochondria were prepared from spheroplasts by published procedures [1,33] Relative enrichment of markers and cross-contamination of subcellular fractions were assessed as described by Zinser and Daum [34] Protein was quantified by the method of Lowry et al [35] by using BSA as a standard SDS–PAGE was carried out as published by Laemmli [36] Western blot analysis of proteins from subcellular fractions prepared as described above was performed as described by Haid and Suissa [37] Immunoreactive bands were visualized by enzyme-linked immunosorbent assay using a peroxidase-linked secondary antibody (Sigma-Aldrich, St Louis, MO) following the manufacturer’s instructions PtdSer decarboxylase activity was measured in isolated mitochondria from yeast cells grown in YPD to the logarithmic growth phase as reported by Kuchler et al [38] with minor modifications: 100 nmol [3H]PtdSer (specific activity of 28 900 dpmỈnmol)1) was used as the substrate, and the assay was performed in 0.1 m Tris ⁄ HCl, pH 7.2, containing 10 mm EDTA Import of Psd1p into mitochondria in vitro Import, processing and assembly of Psd1p into mitochondria in vitro were assayed following the protocol of Ryan et al [39] The precursor Psd1p was synthesized in the presence of [35S]methionine (15 mCiỈmL)1; Amersham Biosciences, Chalfont, UK) by coupled transcription ⁄ translation in a reticulocyte lysate (Promega, Madison, WI) following the manufacturer’s instructions The T7 RNA polymerase system with a PCR-generated DNA fragment as a template was employed Primers PSD1-T1 and PSD1U1 (see Table 2) were used to amplify PSD1 from genomic DNA Yeast mitochondria were isolated as described above and aliquoted at 10 mgỈmL)1 in SEM buffer containing 250 mm sucrose, mm EDTA, 10 mm Mops-KOH, pH 7.2, and stored at )70 °C The import assay involved incuba- FEBS Journal 274 (2007) 6180–6190 ª 2007 The Authors Journal compilation ª 2007 FEBS 6187 Phosphatidylethanolamine of yeast mitochondria R Nebauer et al tion of the radiolabeled Psd1p precursor with isolated mitochondria in the presence of NADH (1.8 mm) and ATP (1.8 mm) in a buffer containing 3% (w ⁄ v) fatty acid-free BSA, 250 mm sucrose, 80 mm KCl, mm MgCl2, mm KH2PO4, mm methionine, 10 mm Mops-KOH, pH 7.2 [39] After 2, 5, 10, and 15 samples were withdrawn and put on ice in the presence of valinomycin (final concentration 0.5 lm) to stop the import reaction Supernatants were removed by centrifugation at 12 000 g and °C for Pellets were washed once in SEM buffer, recovered by centrifugation and suspended in SDS ⁄ PAGE loading buffer [36] prior to heating at 95 °C for Analysis of radioactively labeled translation products, intermediates and mature polypeptides was performed employing standard methods of SDS–PAGE, autoradiography and densitometric scanning Phospholipid quantification For the analysis of total cellular phospholipids yeast cells harvested from a 500 mL culture grown to the late logarithmic phase were disintegrated by shaking with glass beads in a Merckenschlager homogenizer under CO2 cooling in the presence of 10 mm Tris ⁄ HCl, pH 7.2, and mm phenylmethylsulfonyl fluoride (Calbiochem, La Jolla, CA) After removal of the beads by centrifugation the supernatant representing the total cell homogenate was aliquoted and stored at )70 °C Lipids from samples containing mg protein were extracted by the procedure of Folch et al [32] using mL chloroform ⁄ methanol (2 : 1, v ⁄ v) Isolated mitochondria (2 mg protein) were subjected to lipid extraction by the same method Individual phospholipids were separated by 2D TLC using chloroform ⁄ methanol ⁄ 25% ammonia (70 : 35 : 5, v ⁄ v ⁄ v) as first, and chloroform ⁄ acetone ⁄ methanol ⁄ acetic acid ⁄ water (55 : 20 : 10 : 10 : 5, v ⁄ v ⁄ v ⁄ v ⁄ v) as second developing solvent Phospholipids were visualized on TLC plates by staining with iodine vapor, scraped off and quantified by the method of Broekhuyse [40] Acknowledgements The authors wish to thank A Hermetter for providing access to the fluorescence microscope (FWF instrument) This work was financially supported by the FWF (Fonds zur Forderung der wissenschaftlichen ¨ ¨ Forschung in Osterreich) projects 14468 and 17321 to GD References RNA preparation and real-time PCR Total RNA was isolated using phenol ⁄ chloroform extraction as described previously [29] and further purified by RQ1 RNase-free DNase (Promega) treatment according to the manufacturer’s instructions and subsequent ethanol precipitation Integrity of RNA was tested by agarose gel electrophoresis and determination of the 260 to 280 nm ratio of the absorbencies RNA concentration was determined by measurement of the absorbance at 260 nm Total RNA was subjected to reverse transcription using the SuperScriptTM II First Strand Synthesis System (Invitrogen, Carlsbad, CA) for real-time PCR (RT-PCR) Possible traces of contaminating genomic DNA were removed by DNAse I digestion In detail, 2.5 lg of RNA 6188 with a concentration of 500 ngỈlL)1 were incubated with 10· DNAse I buffer, DNAse I amplification grade and U RNaseOutTM ribonuclease for 15 at room temperature (all reagents from Invitrogen) DNA digestion was stopped by adding lL of EDTA (25 mm) and lL of H2O, incubating for at room temperature and further at 70 °C The DNase I treated RNA was mixed with 0.5 lg of oligo-dT2-18, lg of random primers, and U of RNaseOutTM ribonuclease, heated for at 70 °C and left at room temperature for another The RNA sample was mixed with the cDNA synthesis mix, consisting of · RT buffer, dithiothreitol (0.1 m), dNTP (10 mm), U RNaseOutTM and 200 U SuperScriptTM II reverse transcriptase (all reagents from Invitrogen), and heated to 45 °C for h The reaction was stopped by heating to 95 °C for RT-PCR assays were performed using the PlatinumÒ SYBRÒ Green SuperMix-UDG (Invitrogen) following the manufacturer’s recommendations Primers for RT-PCR were designed using the software tool primer expressTM (ABI) For a 25 lL RT-PCR reaction, lL of primer pair (800 nm), 0.5 lL of diluted cDNA (10 ngỈlL)1) and 12.5 lL of PlatinumÒ SYBRÒ Green SuperMix-UDG were applied In addition, no template controls (NTC) and no RT reaction (No RT) controls were performed The cycling conditions on an ABI Prism 7000 were set for at 50 °C, 10 at 95 °C and 40 cycles of 15 s at 95 °C and at 60 °C Data were analyzed using the ABI Prism 7000 sds software Zinser E, Sperka-Gottlieb CDM, Fasch E-V, Kohlwein SD, Paltauf F & Daum G (1991) Phospholipid synthesis and lipid composition of subcellular membranes in the unicellular eukaryote Saccharomyces cerevisiae J Bacteriol 173, 2026–2034 Trotter PJ & Voelker DR (1995) Identification of a non-mitochondrial phosphatidylserine decarboxylase activity in the yeast Saccharomyces cerevisiae J Biol Chem 270, 6062–6070 Nebauer R, Birner-Grunberger R & Daum G (2003) ă Biogenesis and cellular dynamics of glycerophospholipids in the yeast Saccharomyces cerevisiae Topics Curr Genet 6, 125–168 FEBS Journal 274 (2007) 6180–6190 ª 2007 The Authors Journal compilation ª 2007 FEBS R Nebauer et al Birner R & Daum G (2003) Biogenesis and cellular dynamics of aminoglycerophospholipids Int Rev Cytol 225, 273–323 Birner R, Burgermeister M, Schneiter R & Daum G ă (2001) Roles of phosphatidylethanolamine and of its several biosynthetic pathways in Saccharomyces cerevisiae Mol Biol Cell 12, 997–1007 Storey MK, Clay KL, Kutateladze T, Murphy RC, Overduin M & Voelker DR (2001) Phosphatidylethanolamine has an essential role in Saccharomyces cerevisiae that is independent of its ability to form hexagonal phase structures J Biol Chem 276, 48539–48548 Birner R, Nebauer R, Schneiter R & Daum G (2003) Synthetic lethal interaction of the mitochondrial phosphatidylethanolamine biosynthetic machinery with the prohibitin complex of Saccharomyces cerevisiae Mol Biol Cell 14, 370–383 Dimmer KS, Fritz S, Fuchs F, Messerschmitt M, Weinbach N, Neupert W & Westermann B (2002) Genetic basis of mitochondrial function and morphology in Saccharomyces cerevisiae Mol Biol Cell 13, 847–853 Stuart RA (2002) Insertion of proteins into the inner membrane of mitochondria: the role of the Oxa1 complex Biochim Biophys Acta 1592, 79–87 10 Neupert W (1997) Protein import into mitochondria Annu Rev Biochem 66, 863–917 11 Pfanner N & Geissler A (2001) Versatility of the mitochondrial protein import machinery Nat Rev Mol Cell Biol 2, 339–349 12 Rehling P, Pfanner N & Meisinger C (2003) Insertion of hydrophobic membrane proteins into the inner mitochondrial membrane – a guided tour J Mol Biol 326, 639–657 13 Herrmann JM & Neupert W (2003) Protein insertion into the inner membrane of mitochondria IUBMB Life 55, 219–225 14 Stuart RA & Neupert W (1996) Topogenesis of inner membrane proteins of mitochondria Trends Biochem Sci 21, 261–267 15 Herrmann JM, Neupert W & Stuart RA (1997) Insertion into the mitochondrial inner membrane of a polytopic protein, the nuclear-encoded Oxa1p EMBO J 16, 2217–2226 16 Hell K, Herrmann JM, Pratje E, Neupert W & Stuart RA (1998) Oxa1p, an essential component of the N-tail protein export machinery in mitochondria Proc Natl Acad Sci USA 95, 2250–2255 17 Ott M, Prestele M, Bauerschmitt H, Funes S, Bonnefoy N & Herrmann J (2006) Mba1, a membrane-associated ribosome receptor in mitochondria EMBO J 25, 1603– 1610 18 Voelker DR (1997) Phosphatidylserine decarboxylase Biochimica Biophysica Acta 1348, 236–244 19 The Uniprot Consortium (2007) The Universal Protein Resource (UniProt) Nucleic Acids Res 35, 193–197 Phosphatidylethanolamine of yeast mitochondria 20 von Heijne G (1992) Membrane protein structure prediction Hydrophobicity analysis and the positive-inside rule J Mol Biol 20, 487–494 21 Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD & Bairoch A (2003) ExPASy: the proteomics server for in-depth protein knowledge and analysis Nucleic Acids Res 31, 3784–3788 22 Schatz G (1996) The protein import system of mitochondria J Biol Chem 271, 31763–31766 23 Atkinson KD, Jensen B, Kolat AI, Storm EM, Henry SA & Fogel S (1980) Yeast mutants auxotrophic for choline and ethanolamine J Bacteriol 141, 558–564 24 Leonhard K, Herrmann JM, Stuart RA, Mannhaupt G, Neupert W & Langer T (1996) AAA proteases with catalytic sites on opposite membrane surfaces comprise a proteolytic system for the ATP-dependent degradation of inner membrane proteins in mitochondria EMBO J 15, 4218–4229 25 Lemaire C, Hamel P, Velours J & Dujardin G (2000) Absence of the mitochondrial AAA protease Yme1p restores F0-ATPase subunit accumulation in an oxa1 deletion mutant of Saccharomyces cerevisiae J Biol Chem 275, 23471–23475 26 Rontein D, Wu W-I, Voelker DR & Hanson AD (2003) Mitochondrial phosphatidylserine decarboxylase from higher plants Functional complementation in yeast, localization in plants, and overexpression in Arabidopsis Plant Physiol 132, 1678–1687 27 Kuge O, Saito K, Kojima M, Akamatsu Y & Nishijima M (1996) Post-translational processing of the phosphatidylserine decarboxylase gene product in Chinese hamster ovary cells Biochem J 319, 33–38 28 Boeckmann B, Bairoch A, Apweiler R, Blatter MC, Estreicher A, Gasteiger E, Martin MJ, Michoud K, O’Donovan C, Phan I et al (2003) The SWISS-PROT protein knowledgebase and its supplement TrEMBL in 2003 Nucl Acids Res 31, 365–370 29 Burke D, Dawson D & Stearns T (2000) Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 30 Longtine MS, McKenzie A III, Demarini DJ, Shah NG, Wach A, Brachat A, Philippsen P & Pringle JR (1998) Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae Yeast 14, 953–961 31 Gietz D, St Jean A, Woods RA & Schiestl RH (1992) Improved method for high efficiency transformation of intact yeast cells Nucleic Acids Res 20, 1425 32 Folch J, Lees M & Sloane Stanley GH (1957) A simple method for the isolation and purification of total lipids from animal tissues J Biol Chem 226, 497–509 33 Daum G, Bohni PC & Schatz G (1982) Import of ¨ proteins into mitochondria J Biol Chem 257, 13028– 13033 FEBS Journal 274 (2007) 6180–6190 ª 2007 The Authors Journal compilation ª 2007 FEBS 6189 Phosphatidylethanolamine of yeast mitochondria R Nebauer et al 34 Zinser E & Daum G (1995) Isolation and biochemical characterization of organelles from the yeast Yeast 11, 493–536 35 Lowry OH, Rosebrough NJ, Farr AL & Randall RJ (1951) Protein measurement with the Folin phenol reagent J Biol Chem 193, 265–275 36 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685 37 Haid A & Suissa M (1983) Immunochemical identification of membrane proteins after sodium dodecyl sulfate–polyacrylamide gel electrophoresis Methods Enzymol 96, 192–205 6190 38 Kuchler K, Daum G & Paltauf F (1986) Subcellular and submitochondrial localization of phospholipid-synthesizing enzymes in Saccharomyces cerevisiae J Bacteriol 165, 901–910 39 Ryan MT, Voos W & Pfanner N (2001) Assaying protein import into mitochondria Methods Cell Biol 65, 189–215 40 Broekhuyse RM (1968) Phospholipids in tissues of the eye I Isolation, characterization and quantitative analysis by two-dimensional thin-layer chromatography of diacyl and vinyl-ether phospholipids Biochim Biophys Acta 152, 307–315 FEBS Journal 274 (2007) 6180–6190 ª 2007 The Authors Journal compilation ª 2007 FEBS ... (SD) are shown Phosphatidylethanolamine of yeast mitochondria Deletion of OXA1 affects the rate of PtdEtn synthesis by Psd1p in vivo Because mitochondrial Psd1p is the major producer of cellular... The rate of PtdSer synthesis decreased to 80%, the rate of PtdEtn formation to 70% and that of PtdCho synthesis to 60% of wild-type Because Oxa1p was assumed to compromise only the mitochondrial. .. line with the unchanged mitochondrial level of PtdEtn in this strain (Table 1) Studies on the stability of subunits of the mitochondrial membrane complexes Cox and ATPase revealed that these proteins