the fin bit is set this is a fin segment request to terminate the connection
The research is a sure-fire solution to apply on realistic condition due to its feasibility and low cost for a development of sustainable agriculture in Vietnam as the top aims of Sony Green competition
... float: Table: Some of aquatic plants popular Type Aquatic plant live sink Scientific name Hydrilla verticillata Myriophyllum spicatum Blyxa aubertii Eichhornia crassipes Aquatic plant Wolfia arrhiga ... arrhiga live drift Pistia stratiotes Salvinia spp Typha spp Aquatic plant Scirpus spp live float Phragmites communis Jussiaea repens L 2.2 Some of aquatic plants in Mekong delta - Aquatic plant ... Since then we can compare with different concentration, analyse data of study and conclude about the waste treatment of Ludwigia - Experiment is disposed such as: Each brass basin has 10l (waste...
- 16
- 518
- 0
Nano product preview march 2009 the applause “ this is a fantastic effort”
... Acetoacetic Ester Acetoacetic Ester O H3C O C C H C OCH2CH3 H Acetoacetic ester is another name for ethyl acetoacetate The "acetoacetic ester synthesis" uses acetoacetic ester as a reactant ... Alkylation of Ethyl Acetoacetate Alkylation of Ethyl Acetoacetate O H3C C O •• –C C OCH2CH3 H R Dr Wolf's CHM 201 & 202 X The anion of ethyl acetoacetate can be alkylated using an alkyl halide ... CO2 Saponification and acidification convert the alkylated derivative to the corresponding β-keto acid The β-keto acid then undergoes decarboxylation to form a ketone 21-8 Example Example O O CH3CCH2COCH2CH3...
- 52
- 1,104
- 0
This pdF is a sample of the trend database & Monthly Snapshot potx
... 2 TREND DATABASE This is a small sample aimed at illustrating the key features of our Trend Database (just one part of our 2013 Premium Service) Featuring all our trends (theory, stats, opportunities ... campaign On top of that, up to 200 new examples are added each month, and all content can be easily downloaded in various formats, then tailored and presented to your team w w w.t r en d w a ... DATABASE » BOOKMARKS M SA E PL Customized example folders, available to export into a single pdf for presentations or to share with colleagues w w w.t r en d w a t chin g c om | TREND DATABA...
- 27
- 325
- 0
Báo cáo hóa học: " Our vision for this new SpringerOpen Access journal, Psychology of Well-Being: Research, Theory and Practice, is to promote a distinctly eclectic approach to investigating well-being. When the prospect of " pdf
... individuals across the lifespan and across the globe This is an inter-disciplinary task The scientific research community is considerably more accepting of well-being studies today than it was several ... dedicated to well-being research, many of whom we are fortunate to have on our editorial board Several of the major achievements occurring over the past decade were facilitated by the formation of ... journal but we feel the research climate and resources are now supportive of these types of challenges Well-being research has increased substantially over the past decade and the demand to disseminate...
- 3
- 432
- 0
n order to better illustrate the necessary functions and features of this application, a rainwater retention basin is assumed as example
... PLC sem Watchdog [006] - Programas demo PLC S7-1200 da SIEMENS (Simatic) This configuration example CE-X25 helps to solve the tasks displayed The focus is on the library blocks which enable SMS-Sending ... 25545680 Latest modification Startup-Code and library with the actual version counter V1.2 and the append ant documentations is now adapted to STEP V11 Additional search terms wireless, m2m, without ... Library for STEP Basic V11 Containing also the outdated library based on STEP V10.5 CE-X25_S7-1200_SM S_library.zip Configuration Example X25 (Documentation based on the Startup-Code) ConfigurationExampl...
- 3
- 300
- 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 ... PTI1-4 (At2g47060) was cloned in the pBD-GAL4 cam (Stratagene, La Jolla, CA, USA) and were each used as bait to screen an Arabidopsis pACT2 cDNA library [36] The yeast strain PJ69- 4A [37] containing ... control The top panel shows the kinase assay visualized by autoradiography and the bottom panel shows the Coomassie Brillian Blue-stained SDS ⁄ PAGE The in vitro kinase assays were repeated three...
- 11
- 700
- 0
Tài liệu ECTS Users’ Guide: Europe Direct is a service to help you find answers to your questions about the European Union doc
... learner is the same as the number of credits allocated to the component The full number of credits is always awarded if the student achieves a passing grade; it is never adjusted according to the ... implement the Standards and Guidelines for Quality Assurance in the European Higher Education Area.22 their programmes and awards.23 The quality assurance of programmes and awards is expected to include: ... use a European grading scale as a translation device into other grading systems Such European scale was based on the statistical distribution of passing grades in each pro- As a second step in the...
- 64
- 423
- 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... that an antibody raised to a sequence outside this domain might have little effect on the RAP assay signal This was tested with an antibody to nucleolin raised against amino acids 271–520 No effect ... nucleolin, mean that calculations of binding affinity are unrealistic at this stage Nucleolin localization in muscle is analogous to PTPr ligand localization To determine whether the nucleolin ... bound to charged plates and incubated with various concentrations of FN3d–AP supernatant Binding of FN3d– AP was determined by alkaline phosphatase (AP) activity measured at 405 nm The reaction rate...
- 14
- 669
- 0
Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt
... 4¢ 4¢ 5¢ A 105 75 50 35 + - + + Weak Weak > 54 aa aa T C C T G Weak Weak Adequate Weak Adequate aa 58 aa 13 aa 33 aa 31 aa Adequate Adequate aa 24 aa ATG ATG ATG ATG ATG C B αHu-K4 + PIS Peptide ... the plasma membrane or with the membranes of intracellular organelles although they lack a transmembrane domain They are attached to the cytoplasmic face of the membranes via palmitoyl anchors ... Adequate Weak Weak Weak ATG ATG ATG ATG A T A A In contrast to the 5¢-UTR, the 3¢-UTR of the HuK4 mRNA seems to be the same in all EST clones The poly (A) tail starts about 300 nucleotides behind the...
- 9
- 518
- 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
... reagents, advice and assistance during the two-hybrid screen We are grateful to Nicola Minshall and Nancy Standart for the tethering assay constructs, and to Marvin Wickens and Labib Rouhana ... mechanism underlying XRbm9-dependent translational activation is unclear and awaits further investigations The subcellular localization of mammalian Rbm9 is unclear and is dependent on the isoform ... regulated mRNAs Although cytoplasmic polyadenylation is regulated by a protein complex at the 3¢-end of the mRNA, PAP is the only known enzyme capable of elongating the poly (A) tail This activity...
- 14
- 502
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... oligomerization domain (i.e b sheets and 8, the AAA domain helix and the C-terminal helix) However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA domain helix ... study This study This study This study This study This study This study [32] This study This study [32] [32] [32] [32] [32] This study This study This study This study This study This study This study...
- 23
- 490
- 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx
... four-cysteine-containing cerato-platanin domain, and a blastp search always yielded the members of the cerato-platanin family as the best hits It is possible that they represent an ancestral cerato-platanin ... have been reported to act as phytotoxins [e.g cerato-platanin of Ceratocystis fimbriata f sp platani, Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and ... Comparini C, Calamassi R, Pazzagli L, Cappugi G & Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f sp Platani FEMS...
- 14
- 494
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351-SUT2 was constructed to contain SUT2 as the ... yeast/info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively ... The cassette was amplified from the plasmid pUG27 [13] using the primers disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA...
- 8
- 485
- 0
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
... than that of FprA under the same conditions A peculiar feature of the NADP+ oxidation kinetics is the progressive decrease in the reaction rate When FprA was the catalyst, this behavior was particularly ... as catalyzed by FprA and AdR Figure 4A shows the time courses of NADP+ oxidation to NADPO catalyzed by FprA or AdR in the presence of air oxygen Clearly, both enzymes are able to catalyze this ... proposal, made on the basis of structural data [4], that the mechanism of NADPO formation can be split in two half-reactions: the first leads to NADPO formation coupled to FAD reduction; and the...
- 10
- 406
- 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... indicates clearly that the two compounds are incorporated into tubulin at the same site Another biochemical characteristic of tubulin is its ability to act as substrate of the detyrosinating ... increased to approximately 60% of a control without protein synthesis inhibitors (not shown) This indicates that although tubulin turnover seems to contribute significantly to the disappearance ... in the incubation system led to reduced incorporation of radioactivity In this case, as calculated from the specific radioactivity and tubulin content in the supernatant fraction, approximately...
- 9
- 518
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25