sterol esterification is unaffected by osh7p overexpression total lipids were extracted from cells grown in media containing 3h oleate and analyzed by thin layer chromatography wt osh7 padns osh7 transformed into a wild type strain y00000
Cloning, expression and characterization of oxysterol binding protein homologue 7 (OSH7) in yeast saccharomyces cerevisiae
... is unaffected in osh7 cells 97 29 Sterol esterification is increased in osh7 mutants 98 30 Sterol esterification is unaffected by Osh7p overexpression 99 31 Total ergosterol level is not affected ... proteins (Osh1p, Osh2p and Osh3p) have a large N-terminal region that includes a PH domain, which might regulate protein targeting to membranes and thereby serve as membrane adaptors by interacting ... screening (unpublished data) Vps4p belongs to the protein family of AAA -type ATPase and is involved in vacuolar protein sorting (Babst et al., 1997) The coiled-coil domain of Osh7p alone showed a...
- 123
- 381
- 0
KRONE - What is Patch by Exception
... Constant axial and torsional restoring forces, created by the unique contact and plastic housing, maintain a durable connection that allows up to 200 re-terminations The HIGHBAND module also far ... changes are handled at the software level In the instances when patching is required, changes can be administered simply and easily, without delay or hassle to the network manager This lateral ... efficient cable management system, and peace of mind Any changes required in between monthly calls can be easily administered by the IT Manager in a matter of seconds by using the patching facility If...
- 3
- 449
- 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... TMPRSS13 mRNA is expressed in a variety of human adult tissues, and predominantly in lung, placenta, pancreas and prostate [12] HAI-1 mRNA is also highly expressed in placenta, pancreas and prostate ... template control A5 49 Protease TMPRSS13 is inhibited by HAI-1 TMPRSS13 HAI-1 HAI-1B HAI-1 GAPDH Fig RT-PCR analysis of TMPRSS13 and HAI-1 mRNA in human carcinoma cell lines Total RNA was isolated ... cultured carcinoma cells [14] Weaker inhibitory activity of HAI-1–NK1LK2 against HGFA and matriptase was also observed, and an idea that the second Kunitz domain may obstruct the protease-binding site...
- 13
- 641
- 0
Tài liệu Báo cáo khoa học: Autolytic activity of human calpain 7 is enhanced by ESCRT-III-related protein IST1 through MIT–MIM interaction pptx
... lysates were analyzed by WB analysis with mAb against GFP or polyclonal antibody (pAb) against calpain (raised against recombinant MIT domains [28]) In the case of WB analysis with mAb against GFP, ... mGFP–calpain 7C290S were subjected to immunoprecipitation with anti-GFP serum or pAb against calpain 7, followed by WB analysis with mAb against GFP and mAb against calpain (raised against calpain ... calpain inhibitor I (ALLNal) were obtained from Nacalai Tesque (Kyoto, Japan) Antipain and E-64 were obtained from the Peptide Institute (Osaka, Japan) Pefabloc and ovocystatin were obtained from...
- 15
- 505
- 0
Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efficient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt
... at )80 °C before use for kinetic and molecular mass analyses The activity at saturating conditions was similar before and after dilution, incubation and storage Native molecular size The apparent ... (Copenhagen, Denmark) Materials for cloning, PCR, DNA sequencing and assays were standard commercially available products Enzyme preparation Native human TK1 (hTK1) was purified from human lymphocytes ... deoxynucleoside kinases by ion-exchange chromatography on a DEAE column, and further purified by affinity chromatography on a 3¢-dTMP Sepharose column dThd from the affinity chromatography step was removed, and...
- 10
- 647
- 0
Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx
... 5¢-CAAAACGCTCTACAGGC TCC-3¢, 5¢-GAAGAGCTGGACAGAGGTGG-3¢ (ZO-1), 5¢-TTATGGGCCACCGGATATTA-3¢, 5¢-GGAGAGTCA CTGAAGGCTGG-3¢ (DLG-2), 5¢-AAGCTAAGAGGCA CGGAACA-3¢, 5¢-TCCTTATTGCCAGCGAGACT-3¢ (Patj), ... 5¢-TTGCAGACGGAAGAGGTTCT-3¢, 5¢-GGCCACTT TCAGCATCAAAT-3¢ (Erbin), 5¢-GCGGATCCGCAT GTTGGAAACCATAGAC-3¢ and 5¢-GCGAATTCGA CATTTTTAGTGAGTTCCAC-3¢ (MUPP1) Antibodies Primary antibodies used were: anti-adenylyl ... using Dynabeads (Invitrogen) and DynaMag (Invitrogen) Any interaction was detected using MUPP1 antibodies Immunohistochemistry Mice were raised and maintained according to governmental and institutional...
- 12
- 543
- 0
Tài liệu Báo cáo khoa học: Phosphorylation of cyclin dependent kinase 4 on tyrosine 17 is mediated by Src family kinases pptx
... C-YES was mutated from AAA (Lys) to AGA (Arg) with the forward primer: 3¢-GG AACCACGAAAGTAGCAATCAGAACACTAAAACCA GGTACAATGATGC-5¢ All vector inserts were sequenced prior to use CDK4 pY17 antibody ... deoxycholate and trichloroacetic acid, and the proteins were separated using SDS ⁄ PAGE A major protein band of approximately 60 kDa was detected by staining with coomassie (Fig 2D) This band tracked ... 200 gel filtration column was fractionated by hydroxyapatite chromatography and the fractions were assayed for Y17 kinase activity and protein content Fractions from the gradient and a sample of...
- 11
- 456
- 0
Tài liệu Báo cáo khoa học: Staphylococcal enterotoxin C1-induced pyrogenic cytokine production in human peripheral blood mononuclear cells is mediated by NADPH oxidase and nuclear factor-kappa B doc
... stainless cell of the system The area under the curve was calculated to obtain total chemiluminescence Statistical analysis The animals were maintained at an ambient temperature of 22 °C for at ... enterotoxins causes emesis and diarrhea [4] Staphylococcus aureus is also an important microorganism of bovine, ovine and caprine mastitis [5] Staphylococcal enterotoxins, especially staphylococcal ... NF-jB protein (Fig 3A, lanes and 6) and its DNAbinding activity (Fig 3B, lanes and 7) Similar findings were obtained by using 5-LOX inhibitor, 5,8,11,14-eicosatetraynoic acid (ETYA) or FLAP inhibitor...
- 13
- 465
- 0
Tài liệu Báo cáo khoa học: Aggregative organization enhances the DNA end-joining process that is mediated by DNA-dependent protein kinase pdf
... the protein kinase that is mutated in the human hereditary disease ataxia telangiectasia: induced chromatin alterations relay its intermolecular autophosphorylation and dimer dissociation [10] ... the aggregative nucleoproteins (A) Nucleoproteins in chromatographic fractions and in aggregates with DNA Proteins were analyzed by SDS ⁄ PAGE in a 10% gel and stained with Coomassie brilliant ... suggest that the DNA repair factor DNA-PKcs is an aggregation factor that responds to aberrant DNA structures in a manner similar to that of S ⁄ MAR-binding proteins, including nucleolin and SAF -A None...
- 13
- 458
- 0
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
... probe (lanes 1, 2) and binding was FEBS Journal 272 (2005) 5191–5205 ª 2005 FEBS A Parthasarthy and K P Gopinathan completely abolished when the TATATAA sequence was mutated to GATATCA (lanes 3, ... Regulation of pol III transcription A Parthasarthy and K P Gopinathan and making them unavailable for transcription The ‘TATATAA’ sequence present in the flanking regions Gly of tRNA1 -6,7 was responsible ... tRNA1Gly genes (A) Competition by DNA fragments containing TATATAA sequences Transcription of tRNA1Gly -1 was carried out in the presence of increasing concentrations of a 40 bp fragment containing...
- 15
- 484
- 0
Tài liệu Báo cáo khoa học: Gene transcription of fgl2 in endothelial cells is controlled by Ets-1 and Oct-1 and requires the presence of both Sp1 and Sp3 pdf
... GGGGCGGGGCGAGC-3¢; Ets/Pea3, 5¢-GATCTCGAG CAGGAAGTTCGA-3¢; Ets (PU.1), 5¢-GGGCTGCTTG AGGAAGTATAAGAAT-3¢; Stat3, 5¢-GATCCTTCTG GGAATTCCTAGATC-3¢; and C/EBP, 5¢-TGCAGATT GGGCAATCTGCA-3¢ are from Santa Cruz Biotechnology ... TAC CGC ATC ACA GTC TC GCA AAT GCG CCA GGT ACC TTC TGG GAA CTC GAG TTC CCA GAA GGT ACC TGG CGC ATT TGC CCG CCC TTT TGA GGT ACC AGA GAA CGC CTG CAG GCG TTC TCT GGT ACC TCA AAA GGG CGG CTG GGA ACT ... TGT GAT GC GCA TCA CAG TCT GTG GTA CCT TAC AGG AGG AG GTG GCG TCT GAG GTA CCA ATG CAA ATG CGC GCG CAT TTG CAT TGG TAC CTC AGA CGC CAC GAG ACT GTG ATG CGG TAC CTC CCG CCC TTT C GAA AAG GGC GGG AGG...
- 13
- 525
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... out using the CARA and ENCAD algorithms included in the GENEMINE program Bacterial strains and vectors The mutagenesis and expression phagemid, pGHX(–) was produced in our laboratory and is described ... DsodA, DsodB cells under paraquat-induced oxidative stress E coli OX32 6A (DsodA, DsodB) cells harbouring the appropriate plasmid were grown to exponential phase and used to inoculate media containing...
- 12
- 740
- 0
Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt
... Materials Protein kinase inhibitors: A3 and K-252b were purchased from Calbiochem Apyrase, the catalytic subunit of protein kinase A, and protein kinase inhibitor (PKI) were obtained from Sigma Chemicals ... reaction, and is caused by a kinase(s) in the cytosol Then, authentic protein kinase A (PKA) and calmodulin-dependent protein kinase II (CaMKII) were applied instead of the cytosol fraction, as ... chromatinbinding assay involving soluble proteins GST–NK, GST– NM, GST–RS, GST–SK and GST in a soluble state were incubated with chromatin The chromatin bound and unbound fractions were analyzed by...
- 11
- 563
- 0
Tài liệu Báo cáo Y học: Progressive apoptosis in chorion laeve trophoblast cells of human fetal membrane tissues during in vitro incubation is suppressed by antioxidative reagents pptx
... U937 cell apoptosis by maintaining mitochondrial integrity and function [43], and ricin-induced apoptosis of U937 cells by maintaining an intracellular reducing condition by acting as a thiol supplier ... of oxidative stress may play a role in the mechanism of apoptosis [25], and that oxidative stress and chronic in ammation are related, perhaps being an inseparable phenomenon [26] It is also well ... induced by Fe21, amyloid beta peptide and nitric oxidegenerating agents [34] ROS plays a critical role in activation of NF-kB, AP-1, c-Jun kinase and apoptosis induced by TNFa in MCF-7 cells, and...
- 8
- 477
- 0
Tài liệu Báo cáo Y học: Toxicity of substrate-bound amyloid peptides on vascular smooth muscle cells is enhanced by homocysteine docx
... dissected from Wistar-Kyoto or SpragueDawley rats and VSMC isolated by incubation in collagenase and elastase according to the method of Hadrava et al [39] VSMC were plated at a density of · 103 cells ... both in vivo [22] and in vitro [23,24] Several studies have shown that Ab disrupts calcium homeostasis and that increases in intracellular calcium cause cellular damage [25–27] Increases in oxidative ... Caspase-3 cleaves APP at caspase consensus sites and has been shown to increase Ab production [57] In addition, intracellular accumulation of APP can lead to neuronal caspase-3 activation that...
- 9
- 376
- 0
Báo cáo khoa học: Visfatin is induced by peroxisome proliferator-activated receptor gamma in human macrophages pdf
... experiments, increasing amounts (5, 10, 50, 100 and 200-fold excess) of unlabeled visfatin–PPREwt (5¢-CAAT ACAGGGCAAAGATCATGGAAG-3¢) or visfatin–PPREmut (5¢-CAATACAGGAAAAAGAAAATGGAAG-3¢) oligonucleotides ... TCC AGT TC-3¢), mouse visfatin (forward, 5¢-TCCGGCCCGAGATGAAT-3¢; and reverse, 5¢-GTGGGTATTGTTTATAGTGAGTAACCTTGT-3¢), human CD36 (forward, 5¢-TCAGCAAATGCAAAGAAG GGAGAC-3¢; and reverse, 5¢-GGTTGACCTGCAGCCGT ... of visfatin from adipocytes or macrophages cannot be evaluated and cell-specific PPARc regulation of visfatin may have a local effect Visfatin induction by PPARc in human macrophages Adipose tissue...
- 13
- 565
- 0
Báo cáo khoa học: Autocatalytic processing of procathepsin B is triggered by proenzyme activity doc
... It is possible that, at least initially, intermediate forms and intact zymogens are also cleaved by activated intact and partially processed zymogens This is in agreement with the findings of a ... substantial catalytic activity Glycosaminoglycans, which can facilitate autocatalytic activation of cysteine cathepsins, were shown to induce a conformational change in procathepsin B upon binding, ... FTED57AAAA mutant: R54N, F5 7A, T5 8A, E5 9A, D6 0A) ; 5¢-CCAGAACGTTATGGC TACCGAGGACCTGAAGC-3¢ (for the F5 7A mutant: R54N, F5 7A) ; 5¢-CCAGAACGTT(GC)CGTTTACCGA GG-3¢ (a degenerate primer for M5 6A and M56P...
- 9
- 425
- 0
Báo cáo khoa học: The autophagic response to nutrient deprivation in the hl-1 cardiac myocyte is modulated by Bcl-2 and sarco⁄endoplasmic reticulum calcium stores ppt
... Brady et al degradation of the autophagosomes and cargo by lysosomal proteases [2,3] The autophagic pathway is crucial for maintaining cell homeostasis and disruption to the pathway can be a ... autophagy may protect against apoptosis activated by ischemic injury [7], and its chronic perturbation is causative in a genetic form of heart disease [8] Conversely, autophagy can also act as ... Beclin contains a Bcl-2-binding domain which may serve as a point of cross-talk between the autophagic and apoptotic pathways Recently, a BH3 domain in the Bcl-2-binding domain of Beclin was shown...
- 14
- 444
- 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
... melanogaster a- F1-ATPase gene and flanking regions, we screened a genomic library using this a- F1-ATPase cDNA as a probe Two overlapping clones containing the entire gene as well as 5¢ upstream and ... structure and activate transcription both in vitro and in vivo [38] To analyse the involvement of the potential GAF and Adf-1 binding sites in activating the a- F1-ATPase promoter, we eliminated the target ... downstream of transcriptional initiation sites in Drosophila promoters include ACGT, ACAA, ACAG, and AACA [32], and these were detected at )17, )18, )36 and )103 positions of the a- F1-ATPase gene...
- 11
- 532
- 0
Báo cáo khoa học: Androgen receptor function is modulated by the tissue-specific AR45 variant ppt
... in its own right, depending on the promoter context and availability of cofactors AR45 may act as a dominant-negative inhibitor of AR function As intact ligand- and DNA-binding regions are mandatory ... following DHT and also adrenal androgen binding This might have implications in the progression of prostate carcinoma, a disease in which androgens and the AR play the main role [49–51] Enhanced ... (Stratagene) The following primers were used for AR45: 5¢-ACA GGGAACCAGGGAAACGAATGCAGAGTGCTCCTGA CATTGCCTGT-3¢ and 5¢-TCACTGGGTGTGGAAATA GATGGGCTTGA-3¢ Reaction conditions were: five cycles of s at...
- 11
- 514
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25