Tài liệu Báo cáo khoa học: Autolytic activity of human calpain 7 is enhanced by ESCRT-III-related protein IST1 through MIT–MIM interaction pptx

Autolytic activity of human calpain is enhanced by ESCRT-III-related protein IST1 through MIT–MIM interaction Yohei Osako, Yuki Maemoto, Ryohei Tanaka, Hironori Suzuki, Hideki Shibata and Masatoshi Maki Department of Applied Molecular Biosciences, Graduate School of Bioagricultural Sciences, Nagoya University, Japan Keywords calpain 7; ESCRT-III; IST1; microtubuleinteracting and transport (MIT); proteolysis Correspondence M Maki, Department of Applied Molecular Biosciences, Graduate School of Bioagricultural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan Fax: +81 52 789 5542 Tel: +81 52 789 4088 E-mail: mmaki@agr.nagoya-u.ac.jp (Received 10 May 2010, revised 21 July 2010, accepted 20 August 2010) doi:10.1111/j.1742-4658.2010.07822.x Calpain 7, a mammalian ortholog of yeast Cpl1 ⁄ Rim13 and fungal PalB, is an atypical calpain that lacks a penta-EF-hand domain Previously, we reported that a region containing a tandem repeat of microtubule-interacting and transport (MIT) domains in calpain interacts with a subset of endosomal sorting complex required for transport (ESCRT)-III-related proteins, suggesting involvement of calpain in the ESCRT system Although yeast and fungal calpains are thought to be involved in alkaline adaptation via limited proteolysis of specific transcription factors, proteolytic activity of calpain has not been demonstrated yet In this study, we investigated the interaction between calpain and a newly reported ESCRT-III family member, increased sodium tolerance-1 (IST1), which possesses two different types of MIT-interacting motifs (MIM1 and MIM2) We found that glutathione-S-transferase (GST)-fused tandem MIT domains of calpain (calpain 7MIT) pulled down FLAG-tagged IST1 expressed in HEK293T cells Coimmunoprecipitation assays with various deletion or point mutants of epitope-tagged calpain and IST1 revealed that both repetitive MIT domains and MIMs are required for efficient interaction Direct MIT–MIM binding was confirmed by a pulldown experiment with GST-fused IST1 MIM and purified recombinant calpain 7MIT Furthermore, we found that the GST–MIM protein enhances the autolysis of purified Strep-tagged monomeric green fluorescent protein (mGFP)fused calpain (mGFP–calpain 7–Strep) The autolysis was almost completely abolished by 10 mm N-ethylmaleimide but only partially inhibited by mm leupeptin or E-64 The putative catalytic Cys290-substituted mutant (mGFP–calpain 7C290S–Strep) showed no autolytic activity These results demonstrate for the first time that human calpain is proteolytically active, and imply that calpain is activated in the ESCRT system Structured digital abstract l MINT-7990193, MINT-7990213, MINT-7990233: calpain (uniprotkb:Q9Y6W3) physically interacts (MI:0915) with IST1 (uniprotkb:P53990) by anti tag coimmunoprecipitation (MI:0007) l MINT-7990176: calpain (uniprotkb:Q9Y6W3) physically interacts (MI:0915) with IST1 (uniprotkb:P53990) by pull down (MI:0096) l MINT-7990252: IST1 (uniprotkb:P53990) binds (MI:0407) to calpain (uniprotkb:Q9Y6W3) by pull down (MI:0096) Abbreviations ALLNal, N-acetyl-L-leucyl-L-leucyl-L-norleucinal; CBB, Coomassie Brilliant Blue R-250; CHMP, charged multivesicular body protein; CSD1, calpastatin domain 1; ESCRT, endosomal sorting complex required for transport; GFP, green fluorescent protein; GST, glutathione-S-transferase; IST1, increased sodium tolerance-1; mGFP, monomeric green fluorescent protein; MIM, microtubule-interacting and transport-interacting motif; MIT, microtubule-interacting and transport; pAb, polyclonal antibody; VPS, vacuolar protein sorting; WB, western blot 4412 FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS Y Osako et al Enhancement of calpain autolysis by IST1 Introduction Calpains are a family of intracellular Ca2+-dependent cysteine proteases [1–3] Well-studied typical mammalian calpains (l-calpain and m-calpain) are composed of a catalytic large subunit and a regulatory small subunit Both subunits have C-terminal penta-EF-hand domains [4], which contribute to activation of the protease by Ca2+ binding, to heterodimerization of each subunit, and to binding of the endogenous calpain inhibitor calpastatin [5,6] Although the detailed molecular mechanisms are still unknown, ubiquitously expressed calpains, represented by l-calpain and m-calpain, have been suggested to be involved in fundamental biological phenomena such as regulation of the cell cycle and signal transduction [1,3,7–9] On the other hand, tissue-specific calpains, such as p94 ⁄ calpain and nCL-2 ⁄ calpain 8, have been suggested to have specific roles [10–12] As the mRNA of calpain is expressed ubiquitously in human tissues, calpain is expected to have fundamental and essential roles in mammalian cells [13] Studies on calpain have been preceded by those on yeast and fungal orthologs (Cpl1 ⁄ Rim13 and PalB, respectively), and accumulating data indicate that Cpl1 and PalB play critical roles in alkaline adaptation via processing of transcription factors Rim101 ⁄ PacC [14– 18] However, the functions of mammalian calpain are still unknown It has not even yet been demonstrated whether calpain has protease activity, and neither in vivo nor in vitro substrates have been identified Although calpain contains a C2-like domain, it lacks a penta-EF-hand domain and is classified as an atypical calpain As one of the significant structural features, mammalian calpain possesses a tandem repeat of microtubule-interacting and transport (MIT) domains [19,20] at the N-terminus (Fig 1A) Several MIT domain-containing proteins have been shown to bind endosomal sorting complex required for transport (ESCRT)-III proteins and their related proteins [21–23] Fig Schematic representations of calpain and IST1 (A) Calpain possesses two MIT domains (MITa and MITb) at its N-terminus, a calpain-like cysteine protease domain (Cys290, a putative catalytic Cys) in the middle, and a C2-like domain at its C-terminus Catalytic triad residues are indicated by closed triangles (B) IST1 has a CHMPlike domain in its N-terminal half, a Pro-rich linker in the middle, and two different types of MIMs (from the N-terminal side, MIM2 and MIM1, respectively) at the C-terminus Amino acids that are important for binding to the VPS4 MIT domain are indicated by open triangles Wild-type (WT) as well as deletion and amino acid substituted mutants of calpain and IST1 used in this study are schematically represented The numbers below the bars indicate positions in amino acid residues FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS 4413 Enhancement of calpain autolysis by IST1 Y Osako et al The ESCRT system was originally identified as machinery contributing to multivesicular endosome (multivesicular body) formation in the endocytic pathway [24,25] ESCRT machinery has been proposed to have additional roles in other membrane deformation ⁄ fission events, such as retrovirus budding and membrane fission of daughter cells in cytokinesis [26] The core ESCRT system is composed of four complexes, termed ESCRT-0, ESCRT-I, ESCRT-II and ESCRT-III, and associated proteins, including AAAtype ATPase vacuolar protein sorting (VPS)4 VPS4 interacts with components of ESCRT-III via its MIT domain, and catalyzes the dissociation of ESCRTs from membranes [27] We previously reported that calpain associates with a subset of ESCRT-III and its related proteins: charged multivesicular body protein (CHMP)1A CHMP1B, CHMP2A, CHMP4b, CHMP4c and CHMP7 [28] We also showed that calpain interacts with CHMP1B via its tandem MIT domains, and that it partially colocalizes with endocytosed epidermal growth factor, suggesting involvement of calpain in the ESCRT system [28] On the basis of the resolved 3D structure, the MIT domain of VPS4 forms three-helix bundles ESCRT-III proteins commonly contain conserved amino acid sequences for MIT binding, termed MIT-interacting motif (MIMs), in their C-termini Two types of MIM have been identified: MIM1 and MIM2 The former forms an amphipathic helix that binds to the groove between VPS4 MIT domain helices and [29,30], and the latter forms a Pro-rich strand that binds between helices and [31] Human increased sodium tolerance-1 (IST1), an ortholog of yeast Ist1, possesses both MIM1 and MIM2 at its C-terminus [32,33] IST1 and Ist1 can bind to several ESCRT-related proteins, including VPS4 ⁄ Vps4 and CHMP1B ⁄ Did2 [32–35] Interestingly, the 3D structure of the IST1 N-terminal domain is very similar to that of the core domain of CHMP3, an ESCRT-III component [35,36] Although small interfering RNA-mediated knockdown effects on the endocytic pathway are not evident, IST1 is required for efficient cytokinesis in HeLa cells [32,33] IST1 and Ist1 associate with CHMP1 ⁄ Did2 to regulate the localization and ATPase activity of VPS4 ⁄ Vps4 [32,33,37] Because of the structural and functional resemblance to CHMP proteins, IST1 is now regarded as a new ESCRT-III family member The findings described above led us to investigate whether calpain interacts with IST1 through MIT– MIM interactions In this study, we examined calpain 7–IST1 interactions by in vitro and in vivo binding experiments, using purified recombinant proteins and 4414 cultured mammalian cells expressing epitope-tagged proteins We also investigated the effect of this interaction on the autolysis of calpain Results Glutathione-S-transferase (GST) pulldown assay of FLAG–IST1 To investigate whether MIT domains of calpain (calpain 7MIT) interact with IST1, we first performed a GST pulldown assay (Fig 2) GST-fused calpain7MIT (1–165 amino acids) followed by the protease cleavage site and His6-tag (GST–MIT–pHis) was purified with His-tag affinity resin, immobilized on glutathione– Sepharose beads, and incubated with cleared lysates of HEK293T cells expressing FLAG-tagged CHMP1B, CHMP4b, CHMP6 or IST1 After incubation, the beads were pelleted by low-speed centrifugation and washed Cleared lysates and proteins bound to the Fig GST–MIT–pHis pulldown assay of FLAG–IST1 HEK293T cells were transfected with pFLAG–CHMP1B pFLAG–CHMP4b, pFLAG–CHMP6 or pFLAG–IST1 At 24 h after transfection, cells were lysed, and the cleared lysates were incubated with recombinant GST-fused tandem MIT domains of calpain (GST–MIT–pHis) or GST–pHis (negative control) immobilized on glutathione–Sepharose beads The beads were then pelleted by low-speed centrifugation and washed with the lysis buffer The cleared lysates (Input) and proteins in the pellets (pulldown product, Pulldown) were subjected to SDS ⁄ PAGE (10% gel) and WB, with mAb against FLAG Immunoreactive bands were detected by the chemiluminescence method Membranes were also stained with CBB Bands of GST– MIT–pHis and GST–pHis in the pulldown products are indicated by arrows FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS Y Osako et al beads (pulldown products) were separated by SDS ⁄ PAGE and subjected to western blot (WB) analysis with mAb against FLAG or visualized by staining with Coomassie Brilliant Blue R-250 (CBB) The intensities of the immunoreactive bands for FLAG–IST1 in the pulldown products of GST–MIT–pHis were much stronger than those of FLAG–CHMP1B and FLAG– CHMP4b For FLAG–CHMP6 (negative control), no specific immunoreactive band was detected under the conditions used No signals were detected in the control pulldown products of GST–pHis Coimmunoprecipitation of FLAG–IST1 with monomeric green fluorescent protein (mGFP)– calpain mutants Next, we investigated the interaction between calpain and IST1 in mammalian cells by the coimmunoprecipitation method Cleared lysates (Fig 3, Input) of HEK293T cells coexpressing mGFP fused with calpain and various mutants (Fig 1A) and FLAG–IST1 were incubated with anti-green fluorescent protein (GFP) serum for immunoprecipitation Clear immunoreactive bands of FLAG–IST1 were detected for mGFP–calpain 7, mGFP–calpain 7C290S (a mutant with replacement of the putative catalytic Cys, Cys290, by Ser), and mGFP–calpain 7MIT by WB analysis with mAb against FLAG (Fig 3, IP, lower panel) The signal was weak but significant for mGFP–calpain 7MITb Signals were reduced to the background Fig Coimmunoprecipitation of FLAG–IST1 with mGFP–calpain mutants HEK293T cells were cotransfected with pFLAG–IST1 and plasmids expressing calpain mutants fused with mGFP At 24 h after transfection, cleared lysates (Input, 10%, upper panel; 1%, lower panel) were subjected to immunoprecipitation (IP) with antiGFP serum followed by WB analysis with mAb against GFP (upper panel) and mAb against FLAG (lower panel), respectively Proteolysed fragments of mGFP–calpain in wild-type (WT) and DMIT constructs are indicated by closed ( 45 kDa) and open ( 30 kDa) triangles Enhancement of calpain autolysis by IST1 or control level for mGFP–calpain 7MITa and mGFP– calpain 7DMIT The results indicated that tandem MIT domains are required for efficient calpain 7–IST1 interaction Intriguingly, the degradation bands seen in mGFP–calpain (Fig 3, closed and open triangles) were not detected in the case of mGFP–calpain 7C290S, suggesting that the degradation was caused by proteolytic activity of mGFP–calpain itself We refer to this issue later Effects of mutations of IST1 MIMs on binding to mGFP–calpain 7MIT To investigate whether the MIM1 and ⁄ or MIM2 regions present in IST1 are responsible for interaction with calpain MIT domains, we performed a similar coimmunoprecipitation assay with mGFP–calpain 7MIT and various FLAG–IST1MIM deletion and point mutants (L326D, MIM2 Leu326 replaced by Asp; L353A, MIM1 Leu353 replaced by Ala; Fig 1B), which were previously shown to lose the ability to bind to the VPS4 MIT domain [32] As shown in Fig (bottom panel), the immunoreactive band for wild-type FLAG-IST1 (WT) was clearly detected, but for FLAG–IST1DMIM1, FLAG–IST1DMIM2, and all MIM Fig Effects of mutations of IST1 MIMs on binding to mGFP–calpain 7MIT mGFP–calpain 7MIT and various FLAG–IST1 mutants (see Fig 1B) were independently expressed in HEK293T cells Cleared lysate from cells expressing mGFP–calpain 7MIT was mixed with that expressing each FLAG–IST1 mutant, and each mixture was subjected to coimmunoprecipitation with anti-GFP serum The cleared lysates (Input) and immunoprecipitated proteins (IP) were subjected to WB analysis with mAb against GFP and mAb against FLAG, respectively FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS 4415 Enhancement of calpain autolysis by IST1 Y Osako et al Fig Direct interaction between recombinant calpain 7MIT and GST–IST1 Purified recombinant calpain MIT domain (1–165 amino acids), calpain 7MIT, was incubated with GST (negative control), GST–IST1, GST–IST1MIM or GST–IST1MIML326D,L353A that had been immobilized on glutathione–Sepharose beads and subjected to GST-pulldown assay Purified proteins, initial protein mixtures (Input) and pulldown products (Pulldown) were resolved on a 15% gel by SDS ⁄ PAGE, and subjected to CBB staining Open triangles and closed triangles indicate bands of recombinant calpain 7MIT and GST, GST–IST1, GST–IST1MIM, and GST–IST1MIML326D,L353A, respectively point mutants, signals were significantly weakened The signal for FLAG–IST1DMIM1,2 decreased to almost the background or negative control (FLAG–CHMP6) level calpain was thought to be proteolysed by its own proteolytic activity, which led us to investigate this phenomenon further Estimation of cleavage sites in mGFP–calpain Direct interaction between recombinant calpain 7MIT and GST–IST1 proteins The use of cleared lysates of HEK293T cells for all of the experiments described above left the possibility that unknown factors might mediate MIT–MIM interactions To exclude this possibility, we performed in vitro GST-pulldown assays with purified recombinant calpain 7MIT, which was obtained by removal of GST and His6-tag by digestion with PreScission protease followed by ion exchange chromatography Purified calpain 7MIT was incubated with GST–IST1 mutants or GST immobilized on glutathione–Sepharose beads Pulldown products were visualized by staining with CBB Calpain 7MIT was pulled down by GST–IST1 and GST–MIM (Fig 5, Pulldown, open triangle) but not by GST–MIML326D,L353A or GST Enhancement of autolytic activity of mGFP– calpain by calpain 7–IST1 interaction As shown in Fig 3, expression of mGFP–calpain in HEK293T cells generated  45 and 30 kDa fragments (designated as 45 K and 30 K, respectively, in this article), and those bands were not detected in the case of mGFP–calpain 7C290S A similar result was obtained when we used HeLa cells (data not shown) mGFP– 4416 mGFP–calpain 7, mGFP–calpain 7C290S and mGFP– calpain 7C290A (a mutant with the putative catalytic Cys, Cys290, replaced by Ala) were transiently expressed in HEK293T cells, and total cell lysates were analyzed by WB analysis with mAb against GFP or polyclonal antibody (pAb) against calpain (raised against recombinant MIT domains [28]) In the case of WB analysis with mAb against GFP, 45 K and 30 K were reproducibly detected for mGFP–calpain but not for mGFP–calpain 7C290S and mGFP–calpain 7C290A (Fig 6B, upper panel, closed and open triangles) With pAb against calpain 7, an  45 kDa fragment was also detected specifically for mGFP–calpain (Fig 6B, lower panel, gray triangle) These data indicate that a putative catalytic Cys, Cys290, of calpain has a critical role in the wild-type-specific proteolysis To examine whether the 45 kDa fragment detected by WB analysis with pAb against calpain is identical to 45 K, cleared lysates from cells expressing mGFP–calpain or mGFP–calpain 7C290S were subjected to immunoprecipitation with anti-GFP serum or pAb against calpain 7, followed by WB analysis with mAb against GFP and mAb against calpain (raised against calpain MITb [28]), respectively As shown in Fig 6C, 45 kDa fragments were wild-type-specifically detected in both immunoprecipitation products (upper FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS Y Osako et al Enhancement of calpain autolysis by IST1 Fig Estimation of cleavage sites in mGFP–calpain (A) Schematic representations of mGFP–calpain (fragmentary view) and unfused mGFP constructs with stop codons at different positions at their C-termini Two estimated cleavage sites generating 45 and 30 kDa fragments (designated 45 and 30 K, respectively) are indicated by solid arrows (B) The putative catalytic residue Cys290 was replaced by either Ser or Ala, mGFP–calpain (WT), mGFP–calpain 7C290S (C290S) and mGFP–calpain 7C290A (C290A) were transiently expressed in HEK293T cells, and total cell lysates were then analyzed by WB with mAb against GFP and pAb against calpain 7, respectively Arrows and closed and open triangles indicate fulllength mGFP–calpain and 45 K and 30 K, respectively, and the gray triangle indicates the 45 kDa fragment (45 K) detected by WB analysis with pAb against calpain [also shown in (C) and (D)] (C) Cleared lysates from cells expressing mGFP–calpain or mGFP–calpain 7C290S were subjected to immunoprecipitation (IP) with anti-GFP serum or pAb against calpain 7, followed by WB analysis with mAb against GFP and mAb against calpain 7, respectively (D) mGFP–calpain 7, mGFP–calpain 7C290S and three types of unfused mGFP constructs (mGFP265, mGFP259 or mGFP239) were transiently expressed in HEK293T cells, and total cell lysates from those cells and untransfected cells were analyzed by WB with mAb against GFP to compare the electrophoretic mobility of 30 K with that of each mGFP Asterisks indicate 33 kDa bands that were detected in both the wild type (WT) and Cys290-substituted mutants (C290S and C290A) panel, closed triangle; lower panel, gray triangle), suggesting that 45 K contains both mGFP and MIT domains of calpain On the other hand, the antiGFP-reacting 30 kDa band was not detected in the immunoprecipitates of antibody against calpain 7, indicating a lack of MIT domains in 30 K Thus, mGFP–calpain contains at least two cleavage sites: one lies at the N-terminal boundary of the protease domain, generating 45 K, and the other lies between mGFP and MITa, generating 30 K (Fig 6A) To roughly estimate the latter cleavage site in mGFP–calpain 7, we used three types of unfused mGFP FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS 4417 Enhancement of calpain autolysis by IST1 Y Osako et al constructs that have stop codons at different positions at their C-termini: mGFP265, mGFP259 and mGFP239 (see Fig 6A and Experimental procedures) These mGFP proteins were transiently expressed in HEK293T cells, and total cell lysates were analyzed by WB with mAb against GFP to compare the electrophoretic mobility of 30 K with that of each mGFP construct As shown in Fig 6D, the electrophoretic mobility of 30 K was closer to that of mGFP239 This result suggested that mGFP–calpain was cleaved at the point immediately after or in the vicinity of residue 239 of mGFP In order to determine an autolytic cleavage site in mGFP–calpain 7–Strep, we also attempted to purify a C-terminal fragment by using Strep-Tactin Sepharose beads Although extraneous bands other than intact expression products were detected, they were common to both the wild type and the C290S mutant (Fig 7A) Moreover, no wild-type-specific bands were detected by probing with antibody against Strep or Strep-Tactin-conjugated horseradish peroxidase (data not shown) Thus, it is likely that autolytic cleavage also occurs near the C-terminus of calpain before or immediately after N-terminal cleavage The faint,  33 kDa, bands detected with mAb against GFP [indicated by asterisks in Fig 6: (B), top, lanes 3–5; (C), top, lanes 1, 2, and 5; (D), last two lanes] were found not only for the wild type but also for the Cys mutants (C290S and C290A) Thus, they were probably derived by limited digestion with other cellular proteases, and not by autolysis of mGFP–calpain Enhancement of autolysis of mGFP– calpain 7–Strep by GST–MIM in vitro As we observed direct MIT–MIM interaction in vitro (Fig 5), we speculated that IST1 serves as an activator for mGFP–calpain via MIT–MIM interaction To investigate this possibility, we performed an in vitro ‘autolysis assay’ mGFP–calpain 7–Strep was expressed in HEK293T cells, and purified by affinity purification with Strep-Tactin Sepharose beads (Fig 7A) Purified mGFP–calpain 7–Strep ( 0.7 lg) was incubated with lg of recombinant GST–IST1, GST–MIM or GST (negative control) at 30 °C for 20 h After incubation, samples were analyzed by WB with mAb against GFP to detect proteolysed fragments of mGFP–calpain 7–Strep As expected, addition of GST–IST1 and GST–MIM enhanced the generation of 30 K, but addition of GST did not (Fig S1) As the purified recombinant GST–IST1 contained multiple degraded fragments, we used GST–MIM for further analyses Next, we performed a similar assay with GST– MIM, GST–MIML326D,L353A or GST-fused CHMP6 4418 Fig Enhancement of autolysis of mGFP–calpain 7–Strep by GST–MIM in vitro (A) Purification of mGFP–calpain 7–Strep and mGFP–calpain 7C290S–Strep from HEK293T cells Cleared lysate of untransfected HEK293T cells (mock) and those of cells expressing C-terminally Strep-tagged mGFP–calpain (WT) or mGFP–calpain 7C290S (C290S) were incubated with Strep-Tactin Sepharose beads After incubation, unbound proteins were removed (Unbound), and the beads were washed Proteins bound to the beads were eluted with a buffer containing mM D-desthiobiotin (Purified proteins) Samples were separated by SDS ⁄ PAGE followed by CBB staining The arrow and asterisk indicate bands of mGFP–calpain 7–Strep and Strep-Tactin detached from beads, respectively (B) Purified mGFP–calpain 7–Strep (WT and C290S) proteins ( 0.7 lg) were incubated at 30 °C for 20 h with either GST–MIM, GST–MIML326D,L353A or GST–CHMP6NT (1 lg) or without additional proteins ()) Samples without incubation (time 0) were also analyzed After incubation, samples were subjected to SDS ⁄ PAGE (15% gel) and analyzed by WB with mAb against GFP to detect proteolysed fragments of mGFP–calpain 7–Strep Bands of full-length WT and C290S are indicated by the arrow, and those of 30 K are indicated by the open triangle N-terminal half (GST–CHMP6NT) as a negative control As shown in Fig 7B, addition of GST–MIM enhanced the generation of 30 K, but only a marginal enhancing effect was observed with the addition of GST–MIML326D,L353A or GST–CHMP6NT In the case of mGFP–calpain 7C290S–Strep, with or without any recombinant proteins, no degraded bands were FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS Y Osako et al Enhancement of calpain autolysis by IST1 detected This result strongly suggests that 30 K is generated by proteolytic activity of mGFP–calpain 7–Strep itself, not by potentially contaminating proteases in the preparations, and that MIT–MIM interaction enhances the autolytic activity of mGFP– calpain 7–Strep in vitro Autolytic properties of mGFP–calpain 7–Strep We further characterized the autolytic activity of mGFP–calpain 7–Strep Purified mGFP–calpain 7–Strep was incubated with GST–MIM in a buffer containing mm CaCl2 or EGTA As compared with the control (a sample without addition of CaCl2 or EGTA), neither enhancing nor inhibitory effects on the generation of 30 K were observed with the addition of mm CaCl2 or EGTA (data not shown) On the other hand, when purified mGFP–calpain 7–Strep was incubated with GST–MIM in the presence of various protease inhibitors or N-ethylmaleimide, a sulfhydryl modification reagent, the generation of 30 K was almost completely abolished by 10 mm N-ethylmaleimide (Fig 8A) and partially inhibited by mm leupeptin (inhibitor of trypsin-type serine proteases and cysteine proteases) or mm E-64 (cysteine protease inhibitor) (Fig 8B) Obvious effects of other protease inhibitors were not observed with the use of lm recombinant human calpastatin domain (CSD1, calpain inhibitor protein), 0.5 lm ovocystatin (cysteine protease inhibitor protein), 20 lm MG-132 (proteasome inhibitor), 20 lm antipain (cysteine protease inhibitor), 20 lm N-acetyl-l-leucyl-l-leucyl-l-norleucinal (ALLNal) (calpain inhibitor) or mm pefabloc (serine protease inhibitor) Effects of ESCRT-related proteins on autolysis of mGFP–calpain in vivo Next, we examined whether IST1 affects the generation of 30 K in vivo mGFP–calpain was coexpressed with either FLAG–IST1 or FLAG–IST1DMIM1,2 in HEK293T cells, and total cell lysates were analyzed by WB with mAb against GFP As shown in Fig 9A, the effect of coexpression with FLAG–IST1 on the generation of 30 K was not so obvious regarding the ratio of precursor (arrow) and 30 K (open triangle) On the other hand, coexpression with FLAG–IST1DMIM1,2 reduced 30 K generation Overexpression of VPS4BE235Q (a VPS4B mutant with replacement of Glu235 by Gln, lacking ATPase activity) is known to cause accumulation of ESCRTs on the endosomal membrane to form aberrant multivesicular bodies MVB [27] As shown in Fig 9B, coexpression with FLAG–VPS4BE235Q signifi- Fig Autolytic properties of mGFP–calpain 7–Strep Effects of protease inhibitors and sulfhydryl modification reagent on autolysis of mGFP–calpain 7–Strep were investigated Purified mGFP–calpain 7–Strep was incubated at 30 °C for 20 h with GST–MIM in a buffer containing protease inhibitors as indicated (A) As a control, the same volume of a vehicle used for dissolving reagents was added to the reaction mixture in place of inhibitors Bands of fulllength mGFP–calpain 7–Strep and those of 30 K are shown in the upper and lower panels, respectively Additionally, leupeptin, E-64 and pefabloc were tested at higher concentrations (B) cantly reduced the generation of 30 K as compared with the control vector Discussion IST1 is a newly reported ESCRT-III (or CHMP) family member, and interacts with the MIT domain of VPS4 [32,33] In this study, we showed for the first time that a tandem repeat unit of MIT domains of human calpain directly interacts with the C-terminal region of IST1 (Fig 5) We previously reported an interaction between calpain and CHMP1B [28], but this interaction seems to be much weaker than that between calpain and IST1 under the conditions employed (Fig 2) As shown by mutational analyses (Fig 4), the observed stronger interaction may be attributable to the presence of two potential binding sites in the IST1 C-terminal region, which contains FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS 4419 Enhancement of calpain autolysis by IST1 Y Osako et al Fig Effects of ESCRT-related proteins on autolysis of mGFP–calpain in vivo (A) mGFP–calpain of either the wild type (WT) or C290S mutant was coexpressed with either FLAG–IST1 or FLAG– IST1DMIM1,2 in HEK293T cells, and total cell lysates were analyzed by WB with mAb against GFP and mAb against FLAG, respectively Bands of 45 kDa (45 K) and 30 kDa (30 K) are indicated by closed and open triangles, respectively Cotransfection with a blank vector instead of IST1 expression plasmids was performed for control experiments (B) The effect of coexpression of FLAG–VPS4BE235Q on mGFP–calpain autolysis was investigated as shown in (A) two types of MIM motif (MIM1 and MIM2) for binding to VPS4 MIT [32,33] MIM1 and MIM2 were originally defined by differences in binding to different grooves formed by a three-helix bundle of the MIT domain of mammalian VPS4 or yeast Vps4 [29–31] MIM1 of CHMP1A or Vps2 binds to the groove between helices and 3, and MIM2 of CHMP6 binds to that between helices and Bajorek et al [32] suggested that MIM1 and MIM2 of IST1 also bind to 4420 the different grooves of VPS4 MIT, on the basis of NMR chemical shift mapping Their mutational analyses revealed that MIM1 and MIM2 have a synergistic effect on binding to MIT, suggesting that the two grooves in the three-helix bundle of VPS4 MIT accept MIM1 and MIM2 simultaneously [32] In analogy to those findings, either one of the MIT domains of calpain seems to be sufficient for binding to MIMs of IST1 However, our data indicated that both MIT domains are required for efficient interaction (Fig 3) One conceivable explanation for this observation is that tandem MIT domains may act as a single integrated module The yeast ESCRT-related protein Vta1 also has tandem MIT domains, and the 3D structures showed that they are closely associated by extensive hydrophobic interactions, which make two MIT domains an apparent single module [38] As the linker region between the MIT domains of calpain is much shorter than that of Vta1 (five residues versus 21 residues), it is not certain whether the same theory applies to calpain 7, but the idea that tandem MIT domains of calpain affect each other to maintain an interacting interface seems attractive However, at present, we have no clue as to whether MIM1 and MIM2 bind to only one MIT domain or bind to each of the two MIT domains of calpain 7, and it is not known why interaction between calpain and the MIM2-containing protein CHMP6 was not observed (Fig 2) [28] Structural studies, such as cocrystallization and X-ray analysis of tandem MIT domains of calpain and IST1 MIM elements, should clarify these issues in the future Although the physiological role of human calpain is still unknown, the presence of tandem MIT domains might contribute to its role being different from that in unicellular organisms Whereas Cpl1 (yeast calpain 7) does not possess an apparent MIT domain, PalB (fungal calpain 7) has only a single MIT domain In accordance with this difference, reported binding partners are not identical among calpain 7, Cpl1 and PalB Cpl1 and PalB were shown to interact with the ESCRT-III core proteins Snf7 ⁄ Vps32 (CHMP4) and Vps24 (CHMP3), respectively [39,40], but interaction between Cpl1 ⁄ PalB and CHMP1 orthologs (Did2 ⁄ DidB) has not been reported Thus, the N-terminal regions of calpain might have evolved to acquire different strategies for involvement in the ESCRT system, and the tandem MIT domains may govern interacting features unique to human calpain 7, enabling it to execute its physiological roles differently from lower eukaryotic calpains In yeast and fungi, the transcription factor Rim101 ⁄ PacC is thought to be a substrate of Cpl1 ⁄ PalB, and it FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS Y Osako et al has been proposed that Rim101 ⁄ PacC is also recruited around the ESCRTs on the endosomal membranes by binding to Snf7 ⁄ Vps32-interacting factor Rim20 ⁄ PalA [16,18] On the other hand, a human homolog of Rim101 ⁄ PacC has not been identified Futai et al showed that His-tagged calpain purified from COS cells does not proteolyse typical calpain substrates in vitro [13] In this study, we found that GST-fused MIM of IST1 enhances the autolysis of purified mGFP–calpain7–Strep in vitro (Fig 7B), demonstrating the protease activity of calpain for the first time This finding suggests that calpain also functions as a protease rather than as a structural protein in mammalian cells, and that MIT domains are involved in calpain activation This notion leads us to suggest two possible activation mechanisms of calpain in vitro: (a) by binding of MIM, MIT domains dissociate from the protease domain to expose the catalytic core; and (b) binding of MIM causes a conformational change of calpain to create an active catalytic core We observed that an mGFP-fused calpain mutant lacking tandem MIT domains (mGFP–calpain 7DMIT) is still proteolysed to generate 30 K in cultured cells (Fig 3), apparently supporting the former possibility However, it is also possible that IST1 acts on the substrate rather than on the protease To investigate further whether the autolysis is an intermolecular or intramolecular reaction, we purified N-terminally Strep-tagged calpain as a protease source, and incubated it with either mGFP–calpain 7C290S–Strep or mGFP–calpain 7DMITC290S–Strep in the presence of GST–MIM As a result, proteolysed mGFP–calpain 7C290S–Strep fragment (30 K) was detected (Fig S2), suggesting that autolysis of calpain is intermolecular As the degree of degradation of mGFP–calpain 7DMITC290S–Strep was slightly decreased, it is likely that IST1 acts on MIT of the substrate and influences the accessibility of the substrate to the enzyme However, there remains a possibility that a gross conformational change induced by deletion of MIT from mGFP–calpain 7C290S–Strep itself made the substrate more resistant to the protease Moreover, the efficiency of generation of 30 K in the intermolecular reaction experiment seems less than that observed in the experiment in which mGFP–calpain was incubated, and we cannot exclude the possibility that both an intramolecular reaction and an intermolecular reaction occur in the autolysis Therefore, it is premature to draw conclusions regarding the mechanism of the enhancing effects of IST1 on mGFP–calpain 7–Strep autolysis in vitro Both mGFP–calpain and IST1 have been reported to accumulate on aberrant endosomes when an Enhancement of calpain autolysis by IST1 ATPase-defective VPS4 mutant (VPS4BE235Q, used in this study) is expressed in HeLa cells [28,33] However, overexpression of FLAG–VPS4BE235Q reduced 30 K generation (Fig 9B), suggesting that proper recruitment of calpain is important for its activation In the case of conventional calpains, a C2-like domain has been suggested to partially contribute to Ca2+-dependent membrane binding [41] However, we previously reported that the subcellular distribution of calpain is not significantly affected by Ca2+, and that mGFP– calpain 7DMIT coexpressed with monomeric red fluorescent protein–VPS4BE235Q does not accumulate on aberrant endosomes [28] These observations strongly suggest that MIT domains are responsible for regulating the subcellular localization of calpain As shown in Fig 9A, overexpression of FLAG–IST1 did not enhance the autolysis of mGFP–calpain in cultured cells On the other hand, overexpression of FLAG– IST1DMIM1,2 suppressed the autolysis This observation might be explained by regarding IST1 as a regulator of the intracellular localization of calpain 7, because IST1 was previously reported to contribute to recruitment of VPS4 to an ESCRT-III-accumulated region in the cell [32,33] Given that endogenous IST1 is sufficient for the recruitment of calpain around ESCRTs, overexpression of FLAG–IST1 would have no additive effects On the other hand, overexpressed FLAG– IST1DMIM1,2 would occupy the ESCRT surface, and hamper binding of endogenous IST1, resulting in failure of calpain recruitment and exhibiting a dominant-negative effect To test this hypothesis, we performed fluorescence microscopic analyses, and investigated the subcellular localization of overexpressed FLAG–IST1 ⁄ IST1DMIM1,2 and mGFP–calpain in HeLa cells These proteins displayed diffuse or partially colocalized punctate distribution around nucleus There were no significant differences in the punctate distribution of mGFP–calpain between cells coexpressing FLAG–IST1 and and those coexpressing FLAG-IST1DMIM1,2 (data not shown) Thus, it is not clear why FLAG–IST1 had no enhancing effects on autolysis and FLAG–IST1DMIM1,2 inhibited the autolysis of mGFP–calpain Other unknown cytosolic factors that physically associate with IST1 but whose amounts are limited might be involved in enhancing the autolysis of mGFP–calpain When fungal calpain (PalB) cleaves PacC (a transcription factor acting on alkaline adaptation), PalA functions as a scaffold to recruit PacC to endosomal membranes by recognizing two YPXL motifs present in the C-terminal half of PacC [16] A human ortholog of PalA, ALIX (also known as AIP1), functions in the budding of enveloped RNA viruses from plasma FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS 4421 Enhancement of calpain autolysis by IST1 Y Osako et al membranes [42] ALIX is recruited to plasma membranes by Gag proteins of HIV-1 and equine infectious anemia virus through binding of the V domain of ALIX to YPX(n)L late-domain motifs (n = 1–3) [42,43] As virus-encoded aspartyl proteases are already well known to process Gag precursor proteins, calpain may not be involved in virus budding The conservation of the YPX(n)L motif for binding to ALIX ⁄ PalA, however, hints an approaching way to search for potential calpain substrates As IST1 is involved in cytokinesis rather than endosomal sorting [32,33], calpain might process factors that work in cell division Studies are in progress to search for YPX(n)L-containing ALIX-interacting proteins for the investigation of potential calpain substrates Experimental procedures Antibodies and reagents The following mouse mAbs were used: mAb against FLAG (clone M2; Sigma, St Louis, MO, USA), and mAb against GFP (clone B-2; Santa Cruz Biotechnology, Santa Cruz, CA, USA) Anti-GFP serum (A6455) was obtained from Invitrogen ⁄ Molecular Probes (Carlsbad, CA, USA) Rabbit pAb against recombinant human calpain and mouse mAb against human calpain were raised as described previously [28] Peroxidase-conjugated goat anti(mouse IgG) and anti-(rabbit IgG) were obtained from Jackson Immunoresearch Laboratories (West Grove, PA, USA) N-ethylmaleimide, leupeptin, pepstatin A (pepstatin), phenylmethanesulfonyl fluoride and calpain inhibitor I (ALLNal) were obtained from Nacalai Tesque (Kyoto, Japan) Antipain and E-64 were obtained from the Peptide Institute (Osaka, Japan) Pefabloc and ovocystatin were obtained from Calbiochem (San Diego, CA, USA) MG-132 was obtained from Wako Pure Chemical Industries (Osaka, Japan) d-Desthiobiotin was purchased from IBA GmbH (Gottingen, Germany) ¨ Construction of plasmids Cloning of human calpain cDNA and construction of mammalian expression plasmids for various mGFP-fused calpain mutants (FLAG–CHMP1B, FLAG–CHMP4b, FLAG–CHMP6 and FLAG–VPS4BE235Q) and the bacterial expression plasmid for GST–CHMP6NT was performed as described previously [13,28,44] A mammalian expression plasmid for mGFP–calpain 7–Strep was constructed as follows The DNA fragment encoding Strep-tag II was amplified by PCR, with pEXPR-IBA105-C [45] as a template and a pair of primers (forward, 5¢-CCGCTCGAG GCTAGCTGGAGCCACCCG-3¢, containing an additional XhoI site, underlined; and reverse, 5¢-TAGAAGGCACAG 4422 TCGAGGCTG-3¢) The PCR product was digested with XhoI, and then ligated into the XhoI site of the vector downstream of the stop-codon-mutated calpain cDNA (AAGCTTGGTGGAAGCGGTGGTTCTCTCGAG; mutated stop codon italicized and XhoI site underlined) From that vector, a DNA fragment corresponding to a part of calpain (amino acids 390–813) followed by Strep-tag II was isolated by BamHI digestion and inserted into the BamHI site of pmGFP–calpain To construct pCMV3xFLAG–IST1 and pGEX–IST1, an IST1 cDNA fragment was amplified by PCR, using a cDNA clone KIAA0174 (GenBank ID: D79996.1) encoding 364 amino acids containing four tandem MP repeats, obtained from Kazusa DNA Research Institute (Chiba, Japan), using a pair of primers (forward, 5¢-CTAGAATT CAACAGCACAGCATGCTGG-3¢; reverse, 5¢-AGAGAA TTCTGCCTGGTTTAAGAGACC-3¢; restriction sites underlined) The amplified cDNA fragment was first inserted into the Zero Blunt TOPO PCR Cloning vector (Invitrogen), and the EcoRI fragment was then inserted into the EcoRI site of pCMV3xFLAG-B [46] Expression vectors for IST1 mutants of MIM were obtained by PCRbased site-directed mutagenesis with a Quik-Change SiteDirected Mutagenesis Kit (Stratagene, Cedar Creek, TX, USA), using specific primers (Table S1) and either pCMV3xFLAG–IST1 or pCMV3xFLAG–IST1L326D as a template The mutations were confirmed by nucleotide sequencing For bacterial expression of GST–IST1MIM, a cDNA fragment encoding amino acids 300–364 was amplified by PCR, with a pair of primers (forward, 5¢-TAGGA TCCCCTGGACCCAAGCCAGAAG-3¢; reverse, 5¢-AGA GAATTCTGCCTGGTTTAAGAGACC-3¢; restriction sites underlined) and pCMV3xFLAG–IST1 as a template The amplified cDNA fragment was first inserted into the Zero Blunt TOPO PCR Cloning vector (Invitrogen), and the BamHI–EcoRI fragment was then inserted into the BamHI–EcoRI site of pGEX4T-2 The mutant of pGST– IST1MIML326D,L353A was obtained by the same method, with pCMV3xFLAG–IST1L326D,L353A as a template A pair of oligonucleotides encoding the His6 sequence (forward, 5¢-TCGACCACCATCACCATCACCATTGACA-3¢; reverse, 5¢-GGCCTGTCAATGGTGATGGTGATGGTGG-3¢) and those encoding the PreScission Protease recognition sequence (forward, 5¢-AATTCCTGGAAGTTCTGTTCCA GGGTCCAA-3¢; reverse, 5¢-TCGATTGGACCCTGGAAC AGAACTTCCAGG-3¢) were inserted into the SalI–NotI site and the EcoRI–SalI site of pGEX-6p-3 (GE Healthcare, Amersham Place, Little Chalfont, UK), and the resultant plasmid was named pGST–pHis After a pair of oligonucleotides including the BglII site (forward, 5¢-GATCCAAGAT CTCTG-3¢; reverse, 5¢-AATTCAGAGATCTTG-3¢; BglII site underlined) had been inserted into the BamHI–EcoRI sites of pGST–pHis, a cDNA fragment encoding amino acids 1–165 of calpain (calpain 7MIT) was amplified by using a pair of primers (forward, 5¢-GAGAGATCT FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS Y Osako et al CTATGGACGCCACAGCACTGGAGC-3¢; reverse, 5¢-GAG AGAGATCTTTGGCTTAACACTTGTTGAACTG-3¢; BglII site underlined), and inserted Mammalian expression vectors for mGFP259 and mGFP239 were obtained by PCR-based site-directed mutagenesis with a Quik-Change Site-Directed Mutagenesis Kit (Stratagene), using specific primers and templates (Table S1) In this study, pmGFP-C1 [28] was used as an expression vector for mGFP265 Cell culture HEK293T cells were cultured in DMEM supplemented with 5% heat-inactivated fetal bovine serum, 100 mL)1 penicillin and 100 lgỈmL)1 streptomycin at 37 °C in humidified air containing 5% CO2 Expression and purification of recombinant proteins Escherichia coli BL21 cells were transformed with each expression plasmid for GST and GST-fused proteins (GST– IST1, GST–IST1MIM, GST–IST1MIML326D,L353A, GST– CHMP6NT, GST–pHis and GST–MIT–pHis) Expression of GST–IST1, GST–IST1MIM and GST–IST1L326D,L353A was induced with 0.5 mm isopropyl thio-b-d-galactoside for h at 30 °C, and the proteins were purified by binding to glutathione–Sepharose 4B beads according to the manufacturer’s instructions GST–CHMP6NT was expressed and purified essentially in the same way as described above, except for the use of elution buffer containing 10 mm reduced glutathione Purified proteins were dialyzed against NaCl ⁄ Pi (137 mm NaCl, 2.7 mm KCl, mm Na2HPO4 and 1.5 mm KH2PO4, pH 7.3), and stored at °C until use Expression of GST–pHis and GST–MIT–pHis was induced with 0.5 mm isopropyl thio-b-d-galactoside overnight at 16 °C, and the proteins were purified by binding to TALON metal affinity resin (Clontech, Palo Alto, CA, USA), according to the manufacturer’s instructions To obtain recombinant calpain MIT domains, GST–MIT– pHis was purified by HisTrap HP (GE Healthcare), followed by GSTrap HP (GE Healthcare), according to the manufacturer’s instructions The eluate was incubated with PreScission protease (GE Healthcare) at °C overnight to remove the N-terminal GST tag and the C-terminal His6tag After being dialyzed against HiTrap Q HP starting buffer (50 mm phosphate buffer, pH 6.0, 50 mm NaCl, 0.5% Tween-20), the processed protein was applied to a HiTrap Q HP (GE Healthcare), washed with starting buffer and low-salt washing buffer (50 mm phosphate buffer, pH 6.0, 100 mm NaCl, 0.5% Tween-20), and then eluted with elution buffer (50 mm phosphate buffer, pH 6.0, 200 mm NaCl, 0.5% Tween-20) Purified proteins were stored at °C until use Enhancement of calpain autolysis by IST1 Purification of recombinant human CSD1 was performed as described previously [47] Pulldown assay of GST–MIT–pHis binding to FLAG-tagged CHMPs and IST1 At 24 h after transfection with expression vectors by the conventional calcium phosphate precipitation method, HEK293T cells were washed with NaCl ⁄ Pi, and harvested cells were lysed in buffer A (10 mm Tris ⁄ HCl, pH 7.4, 142.5 mm KCl, 0.2% NP-40) supplemented with protease inhibitors (0.4 mm phenylmethanesulfonyl fluoride, 0.2 mm pefabloc, lgỈmL)1 leupeptin, lm E-64, lm pepstatin) and mm b-mercaptoethanol Supernatants (cleared lysates) obtained by centrifugation at 15 000 g were incubated with glutathione–Sepharose beads immobilizing GST–pHis (negative control) or GST–MIT–pHis for h at °C with gentle mixing After Sepharose beads had been recovered by low-speed centrifugation (700 g) for and washed three times with buffer A, proteins bound to the beads (pulldown products) were subjected to SDS ⁄ PAGE followed by WB analyses Proteins transferred to poly(vinylidene difluoride) membranes (Immobilon-P; Millipore, Bedford, MA, USA) were probed with appropriate antibodies WB chemiluminescent signals were detected with a LAS3000mini lumino-image analyzer (Fujifilm, Tokyo, Japan), using Super Signal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL, USA) Bands of GST-fusion proteins were detected by staining the PVDF membranes with CBB In vitro binding assay using recombinant proteins Ten micrograms of GST (negative control) or GST–IST1 proteins was immobilized on glutathione–Sepharose beads and mixed with 10 lg of recombinant calpain MIT domains diluted in buffer B (50 mm Tris ⁄ HCl, pH 8.0, 350 mm NaCl, 0.2% NP-40, mm dithiothreitol) for h at °C After Sepharose beads had been pelleted by brief centrifugation (1 000 g, min) and washed three times with buffer B, bound protein complexes were separated on a 15% gel by SDS ⁄ PAGE Protein bands were detected by CBB staining Coimmunoprecipitation assay One day after HEK293T cells had been seeded, they were transfected with lg of expression plasmid DNA After 24 h, cells were harvested in NaCl ⁄ Pi and lysed in buffer A containing protease inhibitors, as described above Cleared lysates of cells were incubated with anti-GFP serum for h and protein G–Sepharose Fast Flow (GE Healthcare) for h at °C, the beads were washed three times with buffer A, and bound proteins were subjected to WB analysis with appropriate antibodies as described above FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS 4423 Enhancement of calpain autolysis by IST1 Y Osako et al Purification of mGFP–calpain 7–Strep from HEK293T cells At 24 h after transfection with expression vectors by the conventional calcium phosphate precipitation method, HEK293T cells were washed with NaCl ⁄ Pi, and harvested cells were lysed in buffer C (20 mm Hepes ⁄ NaOH, pH 7.4, 150 mm NaCl, mm dithiothreitol, mm pefabloc) supplemented with 0.1% Triton X-100 Cleared lysates obtained by centrifugation at 10 000 g were incubated with Strep-Tactin Sepharose beads (IBA GmbH) overnight at °C with gentle mixing The beads were recovered by low-speed centrifugation (600 g) for min, and washed five times with buffer C supplemented with 0.1% Triton X-100 and once with buffer C Proteins were eluted with buffer D (buffer C containing mm d-desthiobiotin and mm b-mercaptoethanol in place of dithiothreitol) After purification, proteins were immediately used for autolysis assays Autolysis assay In each experiment, purified mGFP–calpain 7–Strep ( 0.7 lg) in buffer D was incubated at 30 °C for 20 h The reaction was stopped by adding · SDS sample buffer and boiling at 95 °C for To examine the autolysisenhancing effect, mGFP–calpain 7–Strep was incubated with one of the following proteins: GST–MIM, GST– MIML326D,L353A or GST–CHMP6NT (1 lg) To examine the effect of protease inhibitors and the thiol-reactive compound, mGFP–calpain 7–Strep was incubated with GST– MIM in buffer D supplemented with one of the following proteins ⁄ chemicals: lm recombinant human CSD1, 0.5 lm ovocystatin, 20 lm MG-132, 20 lm antipain, 20 lm ALLNal, 20 lm or mm leupeptin, 10 lm or mm E-64, mm pefabloc, or 10 mm N-ethylmaleimide After incubation, all samples were analyzed by SDS ⁄ PAGE and WB with mAb against GFP to detect autolyzed mGFP–calpain 7–Strep Acknowledgements We thank E Goto for technical assistance We also thank K Hitomi and all members of the Laboratory of Molecular and Cellular Regulation for valuable suggestions and discussion This work was supported by a Grant-in-Aid for Scientific Research on Priority Areas (to M Maki) and a Grant-in-Aid for JSPS Fellows (to Y Osako) References Goll DE, Thompson VF, Li H, Wei W & Cong J (2003) The calpain system Physiol Rev 83, 731–801 4424 Sorimachi H & Suzuki K (2001) The structure of calpain J Biochem 129, 653–664 Suzuki K, Hata S, Kawabata Y & Sorimachi H (2004) Structure, activation, and biology of calpain Diabetes 53, S12–S18 Maki M, Kitaura Y, Satoh H, Ohkouchi S & Shibata H (2002) Structures, functions and molecular evolution of the penta-EF-hand Ca2+-binding proteins Biochim Biophys Acta 1600, 51–60 Moldoveanu T, Gehring K & Green DR (2008) Concerted multi-pronged attack by calpastatin to occlude the catalytic cleft of heterodimeric calpains Nature 456, 404–408 Hanna RA, Campbell RL & Davies PL (2008) Calcium-bound structure of calpain and its mechanism of inhibition by calpastatin Nature 456, 409–412 Arthur JS, Elce JS, Hegadorn C, Williams K & Greer PA (2000) Disruption of the murine calpain small subunit gene, Capn4: calpain is essential for embryonic development but not for cell growth and division Mol Cell Biol 20, 4474–4481 Huang Y & Wang KKW (2001) The calpain family and human disease Trends Mol Med 7, 355–362 Dutt P, Croall DE, Arthur JS, Veyra TD, Williams K, Elce JS & Greer PA (2006) m-Calpain is required for preimplantation embryonic development in mice BMC Dev Biol (doi:10.1186/1471-213X-6-3) 10 Richard I, Broux O, Allamand V, Fougerousse F, Chiannilkulchai N, Bourg N, Brenguier L, Devaud C, Pasturaud P, Roudaut C et al (1995) Mutations in the proteolytic enzyme calpain cause limb-girdle muscular dystrophy type 2A Cell 81, 27–40 11 Ono Y, Shimada H, Sorimachi H, Richard I, Saido TC, Beckmann JS, Ishiura S & Suzuki K (1998) Functional defects of a muscle-specific calpain, p94, caused by mutations associated with limb-girdle muscular dystrophy type 2A J Biol Chem 273, 17073–17078 12 Hata S, Koyama S, Kawahara H, Doi N, Maeda T, Toyama-Sorimachi N, Abe K, Suzuki K & Sorimachi H (2006) Stomach-specific calpain, nCL-2, localizes in mucus cells and proteolyzes the beta-subunit of coatomer complex, beta-COP J Biol Chem 281, 11214– 11224 13 Futai E, Kubo T, Sorimachi H, Suzuki K & Maeda T (2001) Molecular cloning of PalBH, a mammalian homologue of the Aspergillus atypical calpain PalB Biochim Biophys Acta 1517, 316–319 14 Denison SH, Orejas M & Arst HN Jr (1995) Signaling of ambient pH in Aspergillus involves a cysteine protease J Biol Chem 270, 28519–28522 15 Penalva MA & Arst HN Jr (2004) Recent advances in ˜ the characterization of ambient pH regulation of gene expression in filamentous fungi and yeasts Annu Rev Microbiol 58, 425–451 FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS Y Osako et al 16 Penalva MA, Tilburn J, Bignell E & Arst HN Jr (2008) ˜ Ambient pH gene regulation in fungi: making connections Trends Microbiol 16, 291–300 17 Futai E, Maeda T, Sorimachi H, Kitamoto K, Ishiura S & Suzuki K (1999) The protease activity of a calpainlike cysteine protease in Saccharomyces cerevisiae is required for alkaline adaptation and sporulation Mol Gen Genet 260, 559–568 18 Hayashi M, Fukuzawa T, Sorimachi H & Maeda T (2005) Constitutive activation of the pH-responsive Rim101 pathway in yeast mutants defective in late steps of the MVB ⁄ ESCRT pathway Mol Cell Biol 25, 9478– 9490 19 Ciccarelli FD, Proukakis C, Patel H, Cross H, Azam S, Patton MA, Bork P & Crosby AH (2003) The identification of a conserved domain in both spartin and spastin, mutated in hereditary spastic paraplegia Genomics 81, 437–441 20 Hurley JH & Yang D (2008) MIT domainia Dev Cell 14, 6–8 21 Scott A, Gaspar J, Stuchell-Brereton MD, Alam SL, Skalicky JJ & Sundquist WI (2005) Structure and ESCRT-III protein interactions of the MIT domain of human VPS4A Proc Natl Acad Sci USA 102, 13813–13818 ´ 22 Row PE, Prior IA, McCullough J, Clague MJ & Urbe S (2006) The ubiquitin isopeptidase UBPY regulates endosomal ubiquitin dynamics and is essential for receptor down-regulation J Biol Chem 281, 12618– 12624 23 Shim S, Merrill SA & Hanson PI (2008) Novel interactions of ESCRT-III with LIP5 and VPS4 and their implications for ESCRT-III disassembly Mol Biol Cell 19, 2661–2672 24 Saksena S, Sun J, Chu T & Emr SD (2007) ESCRTing proteins in the endocytic pathway Trends Biochem Sci 32, 561–573 ´ 25 Williams RL & Urbe S (2007) The emerging shape of the ESCRT machinery Nat Rev Mol Cell Biol 8, 355–368 26 McDonald B & Martin-Serrano J (2009) No strings attached: the ESCRT machinery in viral budding and cytokinesis J Cell Sci 122, 2167–2177 27 Scott A, Chung HY, Gonciarz-Swiatek M, Hill GC, Whitby FG, Gaspar J, Holton JM, Viswanathan R, Ghaffarian S, Hill CP et al (2005) Structural and mechanistic studies of VPS4 proteins EMBO J 24, 3658– 3669 28 Yorikawa C, Takaya E, Osako Y, Tanaka R, Terasawa Y, Hamakubo T, Mochizuki Y, Iwanari H, Kodama T, Maeda T et al (2008) Human calpain ⁄ PalBH associates with a subset of ESCRT-III-related proteins in its N-terminal region and partly localizes to endocytic membrane compartments J Biochem 143, 731–745 29 Obita T, Saksena S, Ghazi-Tabatabai S, Gill DJ, Perisic O, Emr SD & Williams RL (2007) Structural basis for Enhancement of calpain autolysis by IST1 30 31 32 33 34 35 36 37 38 39 40 41 42 selective recognition of ESCRT-III by the AAA ATPase Vps4 Nature 449, 735–739 Stuchell-Brereton MD, Skalicky JJ, Kieffer C, Karren MA, Ghaffarian S & Sundquist WI (2007) ESCRT-III recognition by VPS4 ATPases Nature 449, 740–744 Kieffer C, Skalicky JJ, Morita E, De Domenico I, Ward DM, Kaplan J & Sundquist WI (2008) Two distinct modes of ESCRT-III recognition are required for VPS4 functions in lysosomal protein targeting and HIV-1 budding Dev Cell 15, 62–73 Bajorek M, Morita E, Skalicky JJ, Morham SG, Babst M & Sundquist WI (2009) Biochemical analyses of human IST1 and its function in cytokinesis Mol Biol Cell 20, 1360–1373 Agromayor M, Carlton JG, Phelan JP, Matthews DR, Carlin LM, Ameer-Beg S, Bowers K & Martin-Serrano J (2009) Essential role of hIST1 in cytokinesis Mol Biol Cell 20, 1374–1387 Rue SM, Mattei S, Saksena S & Emr SD (2008) Novel Ist1–Did2 complex functions at a late step in multivesicular body sorting Mol Biol Cell 19, 475–484 Xiao J, Chen XW, Davies BA, Saltiel AR, Katzmann DJ & Xu Z (2009) Structural basis of Ist1 function and Ist1–Did2 interaction in the multivesicular body pathway and cytokinesis Mol Biol Cell 20, 3514–3524 Bajorek M, Schubert HL, McCullough J, Langelier C, Eckert DM, Stubblefield WM, Uter NT, Myszka DG, Hill CP & Sundquist WI (2009) Structural basis for ESCRT-III protein autoinhibition Nat Struct Mol Biol 16, 754–762 Dimaano C, Jones CB, Hanono A, Curtiss M & Babst M (2007) Ist1 regulates Vps4 localization and assembly Mol Biol Cell 19, 465–474 Xiao J, Xia H, Zhou J, Azmi IF, Davies BA, Katzmann DJ & Xu Z (2008) Structural basis of Vta1 function in the multivesicular body sorting pathway Dev Cell 14, 37–49 Ito T, Tashiro K, Muta S, Ozawa R, Chiba T, Nishizawa M, Yamamoto K, Kuhara S & Sakaki Y (2000) Toward a protein–protein interaction map of the budding yeast: a comprehensive system to examine twohybrid interactions in all possible combinations between the yeast proteins Proc Natl Acad Sci USA 97, 1143– 1147 ´ ´ Rodrı´ guez-Galan O, Galindo A, Hervas-Aguilar A, Arst HN Jr & Penalva MA (2009) Physiological ˜ involvement in pH signaling of Vps24-mediated recruitment of Aspergillus PalB cysteine protease to ESCRTIII J Biol Chem 284, 4404–4412 Tompa P, Emori Y, Sorimachi H, Suzuki K & Friedrich P (2001) Domain III of calpain is a Ca2+-regulated phospholipid-binding domain Biochem Biophys Res Commun 280, 1333–1339 Morita E & Sundquist WI (2004) Retrovirus budding Annu Rev Cell Dev Biol 20, 395–425 FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS 4425 Enhancement of calpain autolysis by IST1 Y Osako et al 43 Bieniasz PD (2009) The cell biology of HIV-1 virion genesis Cell Host Microbe 5, 550–558 44 Yorikawa C, Shibata H, Waguri S, Hatta K, Horii M, Katoh K, Kobayashi T, Uchiyama Y & Maki M (2005) Human CHMP6, a myristoylated ESCRT-III protein, interacts directly with an ESCRT-II component EAP20 and regulates endosomal cargo sorting Biochem J 387, 17–26 45 Horii M, Shibata H, Kobayashi R, Katoh K, Yorikawa C, Yasuda J & Maki M (2006) CHMP7, a novel ESCRT-III-related protein, associates with CHMP4b and functions in the endosomal sorting pathway Biochem J 400, 23–32 46 Katoh K, Shibata H, Suzuki H, Nara A, Ishidoh K, Kominami E, Yoshimori T & Maki M (2003) The ALG-2-interacting protein Alix associates with CHMP4b, a human homologue of yeast Snf7 that is involved in multivesicular body sorting J Biol Chem 278, 39104–39113 47 Maki M & Hitomi K (2000) Purification of recombinant calpastatin expressed in Escherichia coli Methods Mol Biol 144, 85–94 4426 Supporting information The following supplementary material is available: Fig S1 Enhancement of autolysis of mGFP–calpain 7–Strep by GST–IST1 and GST–MIM in vitro Fig S2 Intermolecular proteolysis of mGFP–calpain 7C290S–Strep and mGFP–calpain DMITC290S– Strep by Strep–calpain in vitro Table S1 Primers used for site-directed mutagenesis performed in this study This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors FEBS Journal 277 (2010) 4412–4426 ª 2010 The Authors Journal compilation ª 2010 FEBS ... FLAG -IST1 (WT) was clearly detected, but for FLAG–IST1DMIM1, FLAG–IST1DMIM2, and all MIM Fig Effects of mutations of IST1 MIMs on binding to mGFP? ?calpain 7MIT mGFP? ?calpain 7MIT and various FLAG? ?IST1. .. proteins (GST– IST1, GST–IST1MIM, GST–IST1MIML326D,L353A, GST– CHMP6NT, GST–pHis and GST–MIT–pHis) Expression of GST? ?IST1, GST–IST1MIM and GST–IST1L326D,L353A was induced with 0.5 mm isopropyl thio-b-d-galactoside... Enhancement of calpain autolysis by IST1 or control level for mGFP? ?calpain 7MITa and mGFP– calpain 7DMIT The results indicated that tandem MIT domains are required for efficient calpain 7? ? ?IST1 interaction