Báo cáo khoa học: Androgen receptor function is modulated by the tissue-specific AR45 variant ppt

Androgen receptor function is modulated by the tissue-specific AR45 variant Isabelle Ahrens-Fath*, Oliver Politz, Christoph Geserick† and Bernard Haendler Research Laboratories of Schering AG, Berlin, Germany Keywords androgen receptor; cofactor; heart; prostate Correspondence B Haendler, CRBA Oncology, Schering AG, D-13342 Berlin, Germany Fax: +49 30 468 18069 Tel: +49 30 468 12669 E-mail: bernard.haendler@schering.de Present address *Paion Research Center, Berlin, Germany †Spanish National Cancer Center, Madrid, Spain (Received 10 August 2004, revised September 2004, accepted September 2004) doi:10.1111/j.1432-1033.2004.04395.x A naturally occurring variant of the human androgen receptor (AR) named AR45 has been identified It lacks the entire region encoded by exon of the AR gene and is composed of the AR DNA-binding domain, hinge region and ligand-binding domain, preceded by a novel seven amino-acid long N-terminal extension A survey of human tissues revealed that AR45 was expressed mainly in heart and skeletal muscle In cotransfection experiments, AR45 inhibited AR function, an effect necessitating intact DNA- and ligand-binding properties Overexpression of AR45 reduced the proliferation rate of the androgen-dependent LNCaP cells, in line with the repressive effects of AR45 on AR growth-promoting function AR45 interacted with the AR N-terminal domain in two-hybrid assays, suggesting that AR inhibition was due to the formation of AR–AR45 heterodimers Under conditions where the transcriptional coactivator TIF2 or the oncogene b-catenin were overexpressed, AR45 stimulated androgen-dependent promoters in presence of dihydrotestosterone AR45 activity was triggered additionally by the adrenal androgen androstenedione in presence of exogenous TIF2 Altogether, the data suggest an important role of AR45 in modulating AR function and add a novel level of complexity to the mode of action of androgens The surprising finding that the human genome only codes for 20 000–25 000 genes suggests that several processes contribute to additional complexity levels One such mechanism is the generation of multiple RNA forms from a single gene through use of different promoters or alternative splicing [1–3] The corresponding protein variants may exert very different and sometimes opposite biological functions [1–3] Abnormal splicing is responsible for about 50% of genetic disorders [4], including some forms of Parkinson’s Disease, of cystic fibrosis, of polycystic kidney disease and progeria [5–8] Changes in splicing patterns have also been linked to cancer [9]; for example a role of the insulin receptor, cyclin D1 and Mdm2 isotypes in tumour progression has been documented [10–12] Consequently, therapeutic modalities aiming at correcting abnormal splicing events have already been envisaged [13] Steroid receptors belong to a unique superfamily of ligand-activated transcription factors that have very pleiotropic effects [14] They are organized in a modular fashion and act by binding to DNA response elements found in the regulatory regions of their target genes [14] Due to the involvement of these receptors in several major diseases, extensive research has been carried out to identify agonistic and antagonistic ligands with beneficial effects An unresolved issue concerns the tissue- and cell-specific activities observed with selective receptor modulators [15–17] Different panels of cofactors may account for some of these effects [18] Another possibility arises from the existence of variant forms of steroid receptors The estrogen receptor (ER) probably belongs to the most diversified family Two isoforms, ERa and ERb, exist, and have different tissue distri- Abbreviations AR, androgen receptor; DAPI, 4,6-diamidino-2-phenylindole; DBD, DNA-binding domain; DHT, dihydrotestosterone; ECL, electrochemiluminescence; ER, estrogen receptor; FBS, fetal bovine serum; GFP, green fluorescent protein; LBD, ligand-binding domain; MEM, minimal essential medium; NTD, N-terminal domain; PSA, prostate-specific antigen 74 FEBS Journal 272 (2005) 74–84 ª 2004 FEBS I Ahrens-Fath et al bution [15] In addition, many ER splice variants have been described, mainly in tumours [19] The biological function of ER variants has only been studied in a few cases Examples include ERa46, an ERa form lacking the region encoded by the first exon, which modulates the activity of ERa in MCF7 cells [20], and ERbcx, a C-terminally truncated form containing 26 specific amino acids, which forms heterodimers with ERa to inhibit its function [21] The progesterone receptor exists as two isoforms, PRA and PRB, differing by the length of the N-terminal end and originating from translation reinitiation at an internal methionine codon Studies with transgenic mice show that the ratio of both forms is essential for proper development of the mammary gland [22] Analysis of human endometrial tumours indicates that loss of the B-form is linked to poor prognosis [23] Concerning the glucocorticoid receptor, a splice variant named GRb that lacks the region encoded by the most 3¢ exon and is unable to bind to glucocorticoids has been described Overexpression of GRb leads to glucocorticoid resistance in a number of pathological conditions [24] In the case of the mineralocorticoid receptor a variant lacking the hinge and ligand-binding regions but able to increase the activity of the full-length receptor has been described [25] Several variant forms of the androgen receptor (AR) have been found A short AR-A form arising, as for PRA from internal translational reinitiation, has been described [26] Recent data, however, question its existence in human tissues [27] A few cases of exon skipping leading to androgen insensitivity have been reported [28] Finally, polymorphisms affecting the length of glutamine, proline and glycine repeats exist [28] They may lead to severe pathologies, as observed in Kennedy’s disease, a progressive motor neuron degeneration caused by an extended polyglutamine repeat in the N-terminal domain of the AR Here we describe the identification and characterization of AR45, a human AR variant composed of a unique N-terminal extension linked to the DNA-binding domain (DBD), hinge region and ligand-binding domain (LBD) of the AR The restricted expression pattern, the inhibitory effect on AR function and the cofactor-dependent activity suggest an important biological role of AR45 in modulating androgen action Results Identification of AR45, a novel variant of the human AR 5¢ Rapid amplification of cDNA ends (RACE) was performed on human placental RNA using a reverse FEBS Journal 272 (2005) 74–84 ª 2004 FEBS Androgen receptor variant form primer directed against the hinge domain of the AR and a forward primer recognizing the common 5¢ end of the reverse-transcribed RNA This allowed the amplification of a 500 bp-long DNA fragment, much shorter than the expected AR product DNA sequencing revealed that this fragment coded for the AR DBD and hinge region preceded by a novel, short N-terminal extension, rather than the 538 amino acid-long N-terminal moiety encoded by exon of the AR gene (Fig 1) A primer specific for the extreme 5¢ region was then used together with a primer recognizing the 3¢ end of the AR coding part to amplify the complete coding region of this novel AR form The deduced amino acid sequence (Fig 1A) revealed that it contained an intact DBD, hinge region and LBD However, it lacked the entire region encoded by exon of the AR which was replaced by a short, unique seven amino acid-long N-terminal extension The deduced molecular mass was about 45 kDa, hence the name AR45 Homology search revealed that the AR45-specific coding region was located on chromosome Xq11, between exons and of the AR gene The complete DNA sequence of this novel exon, which we named 1B, together with flanking intron regions is depicted in Fig 1B Exon 1B localized  22.1 kb downstream of AR exon (Fig 1C) and was not predicted by annotaA B C Fig Sequence of AR45 and position of exon 1B in the AR gene (A) Deduced amino acid sequence of AR45 The unique N-terminal extension is in bold The exon limits are indicated with converging arrowheads and the domain boundaries with colons The residues mutated for functional studies are underlined (B) DNA and deduced amino acid sequences of exon 1B The open reading frame is shown in bold capital letters The flanking intron regions are in italics (C) Localization of exon 1B in the AR gene Exon numbers are shown above the representation, intron sizes are given below in kb These sequence data have been submitted to the DDBJ ⁄ EMBL ⁄ GenBank databases under accession number AX453758 75 Androgen receptor variant form I Ahrens-Fath et al tion programs of the human genome Its extremities nevertheless conformed to the splicing rules AR45 is mainly expressed in heart RT-PCR was carried out on a panel of human tissues to determine the expression pattern of AR45 mRNA A primer corresponding to the AR45-specific upstream region was used together with a primer recognizing the AR common part The strongest signal was observed in heart, followed by skeletal muscle, uterus, prostate, breast and lung Weaker signals were seen in other tissues, including testis (Fig 2A) In comparison, very low levels of the AR transcript were detected in heart, as compared to liver or testis (Fig 2B) The transcript levels of the ribosomal S9 protein were determined as a control (Fig 2C) Initial studies with an antibody directed against the AR LBD indicated that a band of about 45 kDa was present in human heart extracts (not shown) However, in the absence of an antibody recognizing the specific N-terminal extension of AR45, it cannot be excluded that this band corresponds to a degradation product of the AR presence of 3H-labeled R1881 and increasing amounts of cold R1881 (Fig 3A) CV-1 cells were transfected with a pSG5-based expression vector for AR45 or AR The results showed specific R1881 binding to AR45 with a calculated IC50 of 22 nm This was very close to the IC50 found for AR, which was 16 nm When correcting for the amount of AR45 or AR protein expressed in the cells, as determined by Western blot analysis and quantification of electrochemiluminescence (ECL) signals, comparable levels of total [3H]R1881 bound to both forms were found (not shown) The R243H mutant form of AR45 was used as negative control It corresponds to AR R774H, a mutant unable to bind to androgens [29,30] As expected, no specific binding was measured (not shown) The subcellular localization of AR45 was determined by transfecting an expression vector coding for AR45 with an N-terminally fused green fluorescent A 35000 ARwt AR45 30000 25000 The hormone-binding properties of AR45 were assessed by competitive binding experiments in 20000 cpm AR45 is bound by androgen and localizes to the cell nucleus 15000 10000 5000 ch ea m us c br le ea s he t ar t 1e-9 1e-8 1e-7 1e-6 1e-5 1e-4 R1881 [M] B m us tra cle ch br ea ea lu st ng dn te ey st is br n he ar t ki ut pr os ta er te u liv s er AR45 B 1e-10 tra br A n te st is ki dn ey liv er ut er u pr s os t lu ate ng er u pr s os t lu ate ng tra ch ea m us c br le ea s he t ar t ut C br n te st is ki dn ey liv er AR S9 Fig Analysis of tissue distribution of AR45 by RT-PCR analysis of human RNA First-strand cDNA from the indicated organs was used as template for PCR amplification Transcript levels of (A) AR45, (B) AR and (C) ribosomal protein S9 (S9) 76 Fig AR45 binds to androgen and localizes to the cell nucleus (A) CV-1 cells were seeded in six-well plates and transfected with lg of expression plasmids for AR (d) or AR45 (m) For the binding test, the indicated concentrations of unlabeled R1881 were mixed with the tracer The radioactivity of whole cell extracts was determined The results are a representative of two separate experiments (B) Subcellular localization of AR45 Left panel: PC-3 cells were seeded in 24-well plates and transfected with 2.5 lg of an AR45–GFP expression construct and treated with R1881 Fluorescence microscopy was used to visualize the chimeric AR45 protein Right panel: nuclear staining with DAPI FEBS Journal 272 (2005) 74–84 ª 2004 FEBS I Ahrens-Fath et al Androgen receptor variant form A R243(774)H AR45 14000 3500 10000 R.L.U 2000 1500 6000 4000 500 2000 0 ng 25 50 100 ng 25 100 12000 10000 10000 R L U 14000 12000 8000 R.L.U 50 R84(615) C31(562)G 14000 6000 8000 6000 4000 4000 2000 2000 0 ng 25 50 100 ng 25 AR45 B 50 100 C31(562)G 3000 2500 2500 2000 R L U 2000 1500 1000 ng 1500 1000 500 500 0 protein (GFP) moiety into PC-3 cells Following R1881 treatment, we observed an exclusively nuclear localization of AR45 (Fig 3B, left panel) 4,6-Diamidino-2-phenylindole (DAPI) staining was performed to visualize the cell nuclei (Fig 3B, right panel) Transfection of a control GFP plasmid gave fluorescent signals in both the cytoplasm and nucleus (not shown) AR45 inhibits AR transcriptional activity Initial cell-based transactivation studies with different cell lines and with constructs containing various androgen-responsive promoters showed that AR45 did not stimulate reporter gene activity in the presence or absence of ligand (not shown) We therefore sought to determine whether AR45 might be an inhibitor of AR function Transient transfection studies were performed in CV-1 cells using AR45- and AR-expressing plasmids, in the presence of the MMTV-Luc reporter plasmid (Fig 4A) Using increasing amounts of AR45 plasmid for transfection, a concentration-dependent inhibition of androgen-stimulated AR activity was observed To find out whether androgen- and DNAbinding were important for this effect, we devised FEBS Journal 272 (2005) 74–84 ª 2004 FEBS 8000 1000 R.L.U Fig AR45 inhibits AR function (A) CV-1 cells were transfected with a reporter vector harbouring the MMTV promoter (40 ng), an expression vector for AR (10 ng) and with the indicated amounts (ng) of expression plasmids for AR45 or a mutated form Treatment was with nM R1881 (grey bars) or with vehicle (white bars) The results are a representative of three separate experiments and the bars are the mean ± SEM of sextuplicate values (B) PC-3 cells were transfected with a reporter vector harbouring the PSA promoter (40 ng), an expression vector for AR (10 ng) and with the indicated amounts (ng) of expression plasmids for AR45 or a mutated form Treatment was with nM R1881 (grey bars) or with vehicle (white bars) The results are a representative of three separate experiments and the bars are the mean ± SEM of sextuplicate values Position of the mutations was indicated relative to the AR45 amino sequence For clarity, the corresponding location in the AR was also given in parentheses 12000 2500 R L U 3000 25 50 ng 25 50 several mutant forms of AR45 AR45 R243H corresponds to AR R774H, a mutant form not bound by androgens [29,30] Cotransfection experiments revealed that the AR45 R243H mutant did not inhibit AR function AR45 C31G and DR84 correspond to AR C562G and DR615, two mutants that no longer bind to DNA [29,30] These AR45 mutants also did not repress AR activity in transactivation assays Suprisingly, a stimulatory effect was elicited by all three AR45 mutants at the highest plasmid concentration used To show that repression was not limited to a single cell line, we performed similar cotransfection experiments in the prostate cancer cell line PC-3 and obtained comparable results (not shown) The results were further confirmed with the prostatespecific antigen (PSA) promoter (Fig 4B) Here we also observed an inhibitory effect of AR45 on AR activity following overexpression in PC-3 cells As before, this was not seen with the mutant AR45 C31G, which does not bind to DNA The results show that AR45 acts as an inhibitor of AR function This may result from competition of AR45 homodimers or of AR45–AR heterodimers with AR homodimers for binding to DNA response elements 77 Androgen receptor variant form A I Ahrens-Fath et al A 35000 30000 R.L.U AR45 AR 25000 20000 15000 10000 5000 actin B AR45 AR NTD + + + + + + B 128 2000 R.L.U AR 85 2500 1500 1000 500 AR45 42 C 1400 1200 R.L.U 1000 800 600 400 200 R1881 (M) 10 -10 10-9 Fig AR45 inhibits LNCaP cell proliferation (A) Total RNA was purified from LNCaP cells grown in the presence (lane 1) or absence (lane 2) of 0.1 nM R1881 and reverse-transcribed Primers specific for AR45 or AR were used for PCR amplification The levels of actin were determined as control (B) Nuclear extracts were prepared from LNCaP cells grown in presence of nM R1881 and analyzed by Western blot using an antibody directed against the LBD (lane 4) Nuclear extracts from PC-3 cells transfected with an expression vector for AR45 or for AR were analysed in parallel (lanes and 3) In vitro translated AR45 was loaded on lane Molecular mass markers are indicated in kDa (C) LNCaP cells grown in presence of the indicated R1881 concentrations were seeded in 10-cm Petri dishes and transfected with 20 lg of an AR45-expressing vector The number of viable cells was measured after days by quantifying the ATP levels (grey bars) In the control experiment empty pSG5 plasmid was used (white bars) The results are a representative of two separate experiments and the bars are the mean ± SEM of quadruplicate values AR45 inhibits proliferation of LNCaP cells We next determined the biological effects of AR inhibition by AR45 in LNCaP cells First, the endogenous expression levels of AR45 mRNA were assessed in LNCaP cells by RT-PCR, using similar conditions as above Specific AR45 transcripts were detected in LNCaP cells grown in the presence or absence of R1881 (Fig 5A) When analyzing LNCaP nuclear 78 AR45 AR NTD Fig AR45 interacts with the AR NTD CV-1 cells were seeded in 96-well plates and transfected with expression vectors for AR45 and for a fusion between the AR NTD and the activation domain of NF-jB (40 ng each) Treatment was with nM R1881 (A) Reporter plasmid (80 ng) containing the MMTV promoter was cotransfected (B) Reporter plasmid containing the Pem promoter (80 ng) was cotransfected The results are a representative of three separate experiments and the bars are the mean ± SEM of sextuplicate values extracts with an antibody directed against the AR LBD, several protein bands migrating ahead of fulllength AR were seen, including one of a size compatible with that of AR45 (Fig 5B, lane 4) Indeed, a protein band of similar size was also seen in PC-3 cells transfected with an AR45-expressing plasmid (lane 2), but not with an AR-expressing plasmid (lane 3) Also, AR45 produced by an in vitro translation procedure migrated at the same level (lane 1) Even though the identity of the 45 kDa protein detected in LNCaP cells was not demonstrated due to the unavailability of a specific antibody, the results showed that AR45 expression was at best low Proliferation tests were carried out with LNCaP cells grown in the presence of 0.1 or nm R1881 Following transfection of an AR45-expressing plasmid, a significant reduction in the number of viable cells was measured after three days at both hormone concentrations, indicating that inhibition of cell proliferation had taken place (Fig 5C) AR45 interacts with the N-terminal region of the AR Having determined that AR45 inhibited AR activity, we sought to find out whether this was due to a direct FEBS Journal 272 (2005) 74–84 ª 2004 FEBS I Ahrens-Fath et al A B C Androgen receptor variant form interaction by performing a mammalian two-hybrid assay Expression vectors coding for full-length AR45 and for a fusion protein between various domains of the AR N-terminal domain (NTD) and the activation domain of NF-jB were cotransfected into CV-1 cells Using an MMTV reporter construct we observed a strong, androgen-dependent interaction between AR45 and the AR NTD (Fig 6A) No interaction was observed between AR45 and the DBD, hinge region or LBD of the AR (not shown) Additional experiments were performed with a reporter construct harbouring the androgen-dependent Pem promoter [31] The Pem gene codes for a homeobox protein of the pairedlike family involved in male reproductive functions [32] and its promoter has recenly been shown to contain highly selective androgen-responsive elements [31,33] By performing similar two-hybrid assays, we also observed an androgen–dependent interaction between AR45 and the AR NTD (Fig 6B) but not with other regions of the AR (not shown) These results indicate that AR45 binds to androgenresponsive promoters and directly interacts with the AR NTD AR45 stimulates androgen-dependent promoters in presence of cofactors and adrenal androgen D Fig Activation of AR45 by cofactors and androstenedione Transfections were carried out in 96-well plates in presence of 30 ng of AR45 plasmid, 120 ng of cofactor plasmid and 40 ng of reporter plasmid (A) CV-1 cells were transfected with expression vectors for AR45 and for the indicated cofactors A reporter construct containing the MMTV promoter was cotransfected Treatment was with nM DHT (grey bars) or with vehicle (white bar) (B) PC-3 cells were transfected with expression vectors for AR45 and TIF2 A reporter construct containing the MMTV promoter was cotransfected Treatment was with nM DHT (grey bars) or with vehicle (white bar) (C) PC-3 cells were transfected with expression vectors for AR45 and TIF2 A reporter construct containing the PSA promoter was cotransfected Treatment was with nM DHT (grey bars) or with vehicle (white bar) (D) PC-3 cells were transfected with expression vectors for AR45 and TIF2 A reporter construct containing the MMTV promoter was cotransfected Treatment was with nM androstenedione (grey bars) or with vehicle (white bar) The results are a representative of two separate experiments and the bars are the mean ± SEM of sextuplicate values FEBS Journal 272 (2005) 74–84 ª 2004 FEBS The absence of stimulatory activity of AR45 might be linked to poor coactivator recruitment, due to the absence of the NTD This might be overcome by the overexpression of cofactors To test this hypothesis, we analyzed the effects of two AR cofactors known to interact with the AR LBD TIF2 and AR45 were overexpressed in CV-1 cells (Fig 7A) Subsequent dihydrotestosterone (DHT) treatment led to a sevenfold increase of MMTV-driven reporter activity When coexpressing the oncoprotein, b-catenin, a fourfold stimulation was seen (Fig 7A) A similar induction was also seen when using the S33F b-catenin mutant, a form with enhanced stability previously identified in several tumours, including prostate carcinoma (Fig 7A) There was no significant effect of AR45 and cofactor overexpression on reporter gene activity in the absence of DHT (not shown) To rule out that the observed AR45 activity was cell- or promoter-specific, we coexpressed AR45 and TIF2 in PC-3 cells, and used the PSA promoter as well as the MMTV promoter in the reporter plasmids In these cells, TIF2 overexpression enhanced DHT-dependent AR45 activity sixfold on the MMTV promoter and twofold on the PSA promoter (Fig 7B,C) In the absence of DHT, no significant difference was noted for MMTV or PSA promoter activity following AR45 and TIF2 over79 Androgen receptor variant form expression (not shown) Finally we tested the effects of androstenedione on AR45 function This hormone is synthesized primarily by the adrenal glands and is not suppressed by chemical castration used to treat prostate cancer patients, which led to speculations about a role in refractory tumours [27] TIF2 and AR45 were overexpressed in PC-3 cells Following androstenedione treatment, we measured a twofold stimulation of the MMTV promoter (Fig 7D) Altogether these data document that under conditions where coactivators are overexpressed, a stimulation of AR45 by androgens such as DHT or androstenedione may be observed Discussion Here we report the cloning and characterization of human AR45 cDNA, which codes for a variant form of the AR AR45 lacks the entire region encoded by exon of the AR gene and possesses instead a unique seven amino acid-long stretch This AR45-specific region is entirely encoded by a hitherto undescribed exon 1B lying between the first and the second exon of the AR gene AR45 may therefore originate from transcription controlled by a novel promoter region lying upstream of exon 1B Interestingly, the consensus binding sequence CAAGTG for the heart-specific transcription factor Nkx2.5 [34] and motifs with 90% identity to the binding site GGGRNNYCCC for p65, a subunit of the NF-jB transcription factor that regulates gene expression in heart [35], are found in the region immediately upstream of exon 1B (not shown) Detailed studies are now needed to determine whether this region directs heart-selective expression of AR45 An alternative splicing event is less likely, because no sequence corresponding to an additional, more upstream exon was found in our 5¢ RACE-PCR experiments Nonetheless this cannot entirely be ruled out and tissue-specific splicing mechanisms have already been described for other steroid receptors [36,37] The role of androgens in the heart has been documented by many studies Hypertension and myocardial ischemia are associated with elevated androgen levels [38] Direct modulatory effects of androgens and estrogens on the left-ventricular mass have been postulated [39] Due to the comparatively low levels of AR in heart, AR45 may play an important regulatory role, as an inhibitor of AR function or possibly also as an activator in its own right, depending on the promoter context and availability of cofactors AR45 may act as a dominant-negative inhibitor of AR function As intact ligand- and DNA-binding regions are mandatory for 80 I Ahrens-Fath et al this, the formation of AR45 homodimers and of AR45–AR heterodimers on DNA response elements may both account for the effect The formation of AR45–AR heterodimers is likely as previous experiments with a truncated rat AR form lacking most of the NTD have been shown to interact with full-length AR in electrophoretic mobility shift assays [40,41] If such heterodimers cannot recruit the full coactivator set needed for activity, dominant-negative effects may be observed The important role of the NTD, which is absent in AR45, has been documented by several studies [40–42] The hormone-dependent interaction between this region and the LBD of the AR is essential for activity Its disruption by introducing appropriate mutations in the NTD or by overexpressing an N-terminal AR peptide leads to the impairment of AR function [43,44] The amino- to carboxy-terminus interaction probably forms a platform for recruitment of several important cofactors [45–47] Chaperones (e.g Bag1L), cofactors (e.g ARA160 and ART27) and signaling effectors (e.g Akt) have been reported to bind to the AR NTD [48] It is therefore likely that AR45 functions mainly as a repressor of AR function Our cellular assays show, however, that in an environment where a cofactor such as TIF2 or an oncoprotein such as b-catenin is overexpressed, AR45 may stimulate the expression of androgen-dependent promoters following DHT and also adrenal androgen binding This might have implications in the progression of prostate carcinoma, a disease in which androgens and the AR play the main role [49–51] Enhanced TIF2 protein levels have been found in the majority of recurrent prostate cancers [52] Elevated transcript levels of b-catenin, including mutant forms coding for proteins with enhanced stability, have also been found in prostate tumours [53] In addition, a nuclear colocalization with the AR and a strictly ligand-dependent interaction have been reported for b-catenin [54] Enhanced TIF2 or b-catenin expression may therefore lead to aberrant AR45 activity and the stimulation of prostate tumour cell proliferation Our additional finding that androstenedione, a low-affinity adrenal androgen, may stimulate AR45 when cofactors are overexpressed, suggests a mechanism by which treatment-refractory prostate tumours may bypass testosterone deprivation In the light of a recent study demonstrating that the AR is a major player in both early and late androgen-independent stages of prostate cancer [50], a survey of AR45 levels in tumour resections (surgical removal of tissue) should help clarify the role of this variant form in disease progression In conclusion, we have identified AR45, a naturally occurring variant of the AR It may either repress or FEBS Journal 272 (2005) 74–84 ª 2004 FEBS I Ahrens-Fath et al stimulate AR activity, depending on the respective levels of each protein and of cofactors such as TIF2 and b-catenin This study raises the possibility of a role of AR45 in modulating androgen effects in heart, where this form is most abundantly expressed, or in prostate tumours, where aberrant expression of cofactors may modify its activity Androgen receptor variant form formed with the Herculase enhanced DNA polymerase (Stratagene) Following purification on an agarose gel, the amplified DNA was cloned into pCR-TOPO II (Invitrogen) and sequenced Site-directed mutagenesis of AR45 to generate the C31G, DR84 and R243H forms, and of b-catenin to generate the S33F form was performed with the QuickChange kit (Stratagene) using appropriate mutating oligonucleotides, following the manufacturer’s instructions Experimental procedures Chemicals and plasmids Methyltrienolone (R1881), dihydrotestosterone (DHT) and androstenedione (4-androstene-3,17-dione) were from Dupont NEN (Boston, MA, USA) RPMI 1640, minimal essential medium (MEM), OPTI-MEM, streptomycin, penicillin, geneticin and l-glutamine were obtained from Gibco BRL Life Technologies (Eggenstein, Germany) Fetal bovine serum (FBS) was from PAA (Pasching, Austria) FuGene was from Roche Molecular Biochemicals (Mannheim, Germany) The oligonucleotides were purchased from MWG Biotech (Ebersberg, Germany) or Roth (Karlsruhe, Germany) Plasmids were from Stratagene (pSG5, pCMV-BD; Amsterdam, the Netherlands), Invitrogen (pCR-TOPO II; Karlsruhe, Germany) or Promega (pGL3-Basic, pGL3-Promoter; Mannheim, Germany) Cloning procedures and site-directed mutagenesis Human placental RNA (1 lg; Stratagene) was reverse-transcribed using the 5¢-SMART RACE kit (BD Bioscience Clontech; Heidelberg, Germany) and used as the template for PCR amplification This was performed with the Advantage-2 PCR kit (BD Bioscience Clontech) using a reverse primer directed against the AR hinge region (5¢-CA GATTACCAAGCTTCAGCTTCCG-3¢) and the forward 5¢-Smart II primer that binds to the common end of the SMART cDNA population Reaction conditions were: five cycles of s at 94 °C, at 72 °C; five cycles of s at 94 °C, 10 s at 70 °C, at 72 °C; 27 cycles of s at 94 °C, 10 s at 68 °C, at 72 °C Following agarose gel separation, a 500 bp-long DNA fragment was generated, as visualized after gel electrophoresis It was cloned into the pCR-TOPO II plasmid and sequenced The corresponding full-length cDNA was amplified from placental DNA using a forward primer derived from the specific 5¢ extremity and a reverse primer recognizing the 3¢ end of the AR This allowed the amplification of 1200 bp-long fragment which was purified on a gel, cloned and sequenced Cloning of TIF2 and b-catenin coding sequences was carried out using primers flanking the coding region and human universal cDNA (QUICK-Clone II, BD Bioscience Clontech) as the template PCR amplification was per- FEBS Journal 272 (2005) 74–84 ª 2004 FEBS RT-PCR analysis of AR45 mRNA expression AR45 RNA levels were determined by semiquantitative RT-PCR Total RNA from different human organs was obtained from BD Bioscience Clontech LNCaP total RNA was purified using the RNeasy kit (Qiagen, Hilden, Germany) Reverse-transcription was carried out using the First-Strand cDNA kit (Stratagene) and semiquantitative PCR analysis performed with the Advantage-2 kit (Stratagene) The following primers were used for AR45: 5¢-ACA GGGAACCAGGGAAACGAATGCAGAGTGCTCCTGA CATTGCCTGT-3¢ and 5¢-TCACTGGGTGTGGAAATA GATGGGCTTGA-3¢ Reaction conditions were: five cycles of s at 94 °C, at 72 °C; five cycles of s at 94 °C, 10 s at 70 °C, at 72 °C; 23 cycles of s at 94 °C, 10 s at 68 °C, at 72 °C The following primers were used for AR, 5¢-GGGTGAGGATGGTTCTCCCC-3¢ and 5¢-CTGGACTCAGATGCTCC-3¢ The reaction conditions were as above, except that the annealing temperatures were 54 °C for five cycles, 52 °C for five cycles and 50 °C for 27 cycles The amplification products were separated on a 1% (w ⁄ v) agarose gel and stained with 0.5 lgỈmL)1 ethidium bromide Western blot analysis Following separation on precast 4–12% Bis ⁄ Tris gels (NuPAGE Novex, Invitrogen), the proteins were transferred onto poly(vinylidene difluoride) membranes (Roche Molecular Biochemicals) Incubation with the primary antibody AR C-19 (sc-815; Santa Cruz Biotechnology, Santa Cruz, CA, USA) was for 12 h at °C and at a : 2000 dilution For the secondary, peroxidase-labeled anti-rabbit whole IgG (A-0545, Sigma-Aldrich, Munich, Germany), incubation was for h at room temperature and at a : 5000 dilution Detection was performed using the electrochemiluminescence (ECL) kit and ECL hyperfilms (Amersham Pharmacia Biotech, Freiburg, Germany) In vitro translation AR45 cDNA cloned into the pCRII-TOPO plasmid (1 lg) was in vitro-translated using the TNT T7 ⁄ SP6 Coupled Reticulocyte Lysate system and the SP6 RNA polymerase, 81 Androgen receptor variant form following the manufacturer’s instructions (Promega) The reaction products were stored at )70 °C in small aliquots Cell culture and transfections Cell lines were obtained from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany), except the PC-3 ⁄ AR cells, a stable, AR-expressing cell line derived from PC-3 cells CV-1 cells were grown at 37 °C in a 5% (v ⁄ v) CO2 atmosphere in MEM, 10% (v ⁄ v) FBS, 100 mL)1 penicillin, 100 lgỈmL)1 streptomycin, mm l-glutamine PC-3 cells were grown at 37 °C in 5% (v ⁄ v) CO2 in F-12K medium, 5% (v ⁄ v) FBS, 100 mL)1 penicillin, 100 lgỈmL)1 streptomycin, mm l-glutamine PC-3 ⁄ AR cells were grown at 37 °C in 4.5% (v ⁄ v) CO2 in RPMI 1640, 10% (v ⁄ v) FBS, 100 mL)1 penicillin, 100 lgỈmL)1 streptomycin, mm l-glutamine, 600 lgỈmL)1 geneticin LNCaP cells were grown at 37 °C in 5% (v ⁄ v) CO2 in RPMI 1640, 5% (v ⁄ v) FBS, 100 mL)1 penicillin, 100 lgỈmL)1 streptomycin, mm l-glutamine, 0.1 nm R1881 For the transactivation assays, the CV-1 and PC-3 cells were seeded in 96-well plates at a concentration of 10 000– 15 000 cells per 100 lL per well in medium supplemented as above except that 5% (v ⁄ v) charcoal-stripped FBS was used Transfections were carried out 18–19 h later using FuGene in OPTI-MEM and 40 ng of reporter plasmid based on pGL3-Basic For LNCaP cells, seeding was in sixwell plates (5 · 105 cellsỈwell)1) for 22 h Transfection was with X-treme GENE (Roche Molecular Biochemicals) using 10 lg of reporter plasmid Expression plasmids for AR45, AR or cofactors were cotransfected as indicated The amount of transfected plasmids was kept constant by adding the appropriate concentrations of pSG5 containing a neutral insert Induction was performed h later by adding nm (CV-1 and PC-3 cells) or nm R1881 (LNCaP cells) Alternatively nm androstenedione was used Measurement of luciferase activity was carried out after 18 h in a Lumicount luminometer, following the addition of 100 lL of LucLite Plus reagent (both Packard, Dreieich, Germany) The activity of a constitutively active luciferase vector was determined in parallel to assess transfection efficiency For all points the average value of six wells treated in parallel was taken The experiments were repeated independently at least three times For the androgen binding test, CV-1 cells were seeded in six-well plates (2 · 105 cellsỈwell)1) and transfected 24 h later with pSG5-AR45 or pSG5-AR (6 lgỈwell)1) A mutant corresponding to the nonandrogen-binding form R774H was used in the control experiment The level of AR45 or AR was determined by Western blot analysis as above Quantification of the ECL signal was performed in a Kodak Image Station (Rochester, NY, USA) For determination of the nuclear localization, PC-3 cells (1.25 · 105 cells in 0.5 mL) were seeded in 24-well 82 I Ahrens-Fath et al plates on glass coverslips, transfected with 2.5 lg of a GFP-AR45 expression construct and treated h later with nm R1881 After 24 h, the cells were fixed with 3.7% (v ⁄ v) formaldehyde and examined by fluorescence microscopy at 507 nm Alternatively, staining with DAPI (Calbiochem, Bad Soden, Germany) was performed to visualize the nuclei For the proliferation tests, · 105 LNCaP cells were seeded into 10-cm Petri dishes Transfection was with 20 lg of pSG5-AR45 plasmid in Lipofectamine 2000 (Invitrogen) The number of viable cells was determined after days in a Lumicount luminometer (Packard) using the Cell Titer-Glo assay (Promega) The two-hybrid assay was performed in CV-1 cells in the 96-well format (104 cellsỈwell)1) Transfection was for h with FuGene reagent using 80 ng of reporter plasmid, 40 ng of pSG5-AR45 and 40 ng of a pCMV-BD-based plasmid containing different domains of the human AR Treatment was with nm R1881 and luciferase activity was determined after 23 h Androgen-binding assay For the binding test, 200 lL of tracer (0.86 lCi of 3H-labeled R1881 per well, 83.5 CiỈmmol)1; NEN) mixed with 200 lL of different concentrations of cold R1881 were added to transfected CV-1 cells for h at 37 °C The cells were washed, lysed with low-salt buffer [2% (w ⁄ v) SDS, 10% (v ⁄ v) glycerol, 10 mm Tris ⁄ HCl pH 8] for min, transferred into scintillation tubes, supplemented with 3.5 mL of Atomlight scintillator liquid (PerkinElmer, Rodgau-Jugesheim, Germany) and incubated for 18 h in ă the dark Scintillation counting was performed in a 1500 Liquid Scintillation Analyzer (Packard) Acknowledgements We are indebted to Prof G Stock and Dr U.-F Habenicht for continuous interest in this project We thank Prof W.-D Schleuning and Dr K Bosslet for support, and Dr D Zopf, Dr K Barbulescu and Dr D Mumberg for fruitful discussions The expert technical assistance of F Knoth, I Schuttke and M Wostrack ă was much appreciated The PC-3 ⁄ AR cell line and the human AR cDNA were obtained from Prof A Cato (FZ Karlsruhe, Germany), the PSA promoter construct from Prof J Trapman (Erasmus Medical Center, Rotterdam, the Netherlands) References Modrek B & Lee C (2002) A genomic view of alternative splicing Nat Genet 30, 13–19 FEBS Journal 272 (2005) 74–84 ª 2004 FEBS I Ahrens-Fath et al Roberts GC & Smith CW (2002) Alternative splicing: combinatorial output from the genome Curr Opin Chem Biol 6, 375–383 Stamm S (2002) Signals and their transduction pathways regulating alternative splicing: a new dimension of the human genome Hum Mol Genet 11, 2409–2416 Sazani P & Kole R (2003) Therapeutic potential of antisense oligonucleotides as modulators of alternative splicing J Clin Invest 112, 481–486 Buee L, Bussiere T, Buee-Scherrer V, Delacourte A & Hof PR (2000) Tau protein isoforms, phosphorylation and role in neurodegenerative disorders Brain Res Brain Res Rev 33, 95–130 Tsui LC (1992) The spectrum of cystic fibrosis mutations Trends Genet 8, 392–398 Reynolds DM, Hayashi T, Cai Y, Veldhuisen B, Watnick TJ, Lens XM, Mochizuki T, Qian F, Maeda Y, Li L, et al (1999) Aberrant splicing in the PKD2 gene as a cause of polycystic kidney disease J Am Soc Nephrol 10, 2342–2351 Eriksson M, Brown WT, Gordon LB, Glynn MW, Singer J, Scott L, Erdos MR, Robbins CM, Moses TY, Berglund P, et al (2003) Recurrent de novo point mutations in lamin A cause Hutchinson–Gilford progeria syndrome Nature 423, 293–298 Xu Q & Lee C (2003) Discovery of novel splice forms and functional analysis of cancer-specific alternative splicing in human expressed sequences Nucleic Acids Res 31, 5635–5643 10 Denley A, Wallace JC, Cosgrove LJ & Forbes BE (2003) The insulin receptor isoform exon 11-(IR-A) in cancer and other diseases: a review Horm Metab Res 35, 778–785 11 Fridman JS, Hernando E, Hemann MT, de Stanchina E, Cordon-Cardo C & Lowe SW (2003) Tumor promotion by Mdm2 splice variants unable to bind p53 Cancer Res 63, 5703–5706 12 Lu F, Gladden AB & Diehl JA (2003) An alternatively spliced cyclin D1 isoform, cyclin D1b, is a nuclear oncogene Cancer Res 63, 7056–7061 13 Mercatante DR, Sazani P & Kole R (2001) Modification of alternative splicing by antisense oligonucleotides as a potential chemotherapy for cancer and other diseases Curr Cancer Drug Targets 1, 211–230 14 Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P et al (1995) The nuclear receptor superfamily: the second decade Cell 83, 835–839 15 Nilsson S & Gustafsson JA (2002) Estrogen receptor action Crit Rev Eukaryot Gene Expr 12, 237–257 16 Negro-Vilar A (1999) Selective androgen receptor modulators (SARMs): a novel approach to androgen therapy for the new millennium J Clin Endocrinol Metab 84, 3459–3462 FEBS Journal 272 (2005) 74–84 ª 2004 FEBS Androgen receptor variant form 17 Olive DL (2002) Role of progesterone antagonists and new selective progesterone receptor modulators in reproductive health Obstet Gynecol Surv 57, S55–S63 18 McKenna NJ, Lanz RB & O’Malley BW (1999) Nuclear receptor coregulators: cellular and molecular biology Endocr Rev 20, 321–344 19 Hopp TA & Fuqua SA (1998) Estrogen receptor variants J Mammary Gland Biol Neoplasia 3, 73–83 20 Flouriot G, Brand H, Denger S, Metivier R., Kos M, Reid G, Sonntag-Buck V & Gannon F (2000) Identification of a new isoform of the human estrogen receptoralpha (hER-alpha) that is encoded by distinct transcripts and that is able to repress hER-alpha activation function EMBO J 19, 4688–4700 21 Ogawa S, Inoue S, Watanabe T, Orimo A, Hosoi T, Ouchi Y & Muramatsu M (1998) Molecular cloning and characterization of human estrogen receptor betacx: a potential inhibitor of estrogen action in human Nucleic Acids Res 26, 3505–3512 22 Mulac-Jericevic B, Lydon JP, DeMayo FJ & Conneely OM (2003) Defective mammary gland morphogenesis in mice lacking the progesterone receptor B isoform Proc Natl Acad Sci USA 100, 9744–9749 23 Dai D, Wolf DM, Litman ES, White MJ & Leslie KK (2002) Progesterone inhibits human endometrial cancer cell growth and invasiveness: down-regulation of cellular adhesion molecules through progesterone B receptors Cancer Res 62, 881–886 24 Yudt MR, Jewell CM, Bienstock RJ & Cidlowski JA (2003) Molecular origins for the dominant negative function of human glucocorticoid receptor beta Mol Cell Biol 23, 4319–4330 25 Zennaro MC, Souque A, Viengchareun S, Poisson E & Lombes M (2001) A new human MR splice variant is a ligand-independent transactivator modulating corticosteroid action Mol Endocrinol 15, 1586–1598 26 Wilson CM & McPhaul MJ (1996) A and B-forms of the androgen receptor are expressed in a variety of human tissues Mol Cell Endocrinol 120, 51–57 27 Gregory CW, He B & Wilson EM (2001) The putative androgen receptor-A form results from in vitro proteolysis J Mol Endocrinol 27, 309–319 28 Brinkmann AO (2001) Molecular basis of androgen insensitivity Mol Cell Endocrinol 179, 105–109 29 McPhaul MJ (2002) Androgen receptor mutations and androgen insensitivity Mol Cell Endocrinol 198, 61–67 30 Quigley CA, De Bellis A, Marschke KB, el-Awady MK, Wilson EM & French FS (1995) Androgen receptor defects: historical, clinical, and molecular perspectives Endocr Rev 16, 271–321 31 Barbulescu K, Geserick C, Schuttke I, Schleuning WD ă & Haendler B (2001) New androgen response elements in the murine pem promoter mediate selective transactivation Mol Endocrinol 15, 1803–1816 83 Androgen receptor variant form 32 Wayne CM, Sutton K & Wilkinson MF (2002) Expression of the pem homeobox gene in Sertoli cells increases the frequency of adjacent germ cells with deoxyribonucleic acid strand breaks Endocrinology 143, 4875– 4885 33 Geserick C, Meyer HA, Barbulescu K & Haendler B (2003) Differential modulation of androgen receptor action by deoxyribonucleic acid response elements Mol Endocrinol 17, 1738–1750 34 Harvey RP, Lai D, Elliott D, Biben C, Solloway M, Prall O, Stennard F, Schindeler A, Groves N, Lavulo L, et al (2002) Homeodomain factor Nkx2–5 in heart development and disease Cold Spring Harb Symp Quant Biol 67, 107–114 35 Valen G, Yan ZQ & Hansson GK (2001) Nuclear factor kappa-B and the heart J Am Coll Cardiol 38, 307–314 36 Poola I (2003) Molecular assays to profile 10 estrogen receptor beta isoform mRNA copy numbers in ovary, breast, uterus, and bone tissues Endocrine 22, 101–112 37 Denger S, Reid G, Brand H, Kos M & Gannon F (2001) Tissue-specific expression of human ERalpha and ERbeta in the male Mol Cell Endocrinol 178, 155–160 38 Liu PY, Death AK & Handelsman DJ (2003) Androgens and cardiovascular disease Endocr Rev 24, 313– 340 39 Hayward CS, Webb CM & Collins P (2001) Effect of sex hormones on cardiac mass Lancet 357, 1354–1356 40 Ikonen T, Palvimo JJ & Janne OA (1998) Heterodimerization is mainly responsible for the dominant negative activity of amino-terminally truncated rat androgen receptor forms FEBS Lett 430, 393–396 41 Palvimo JJ, Kallio PJ, Ikonen T, Mehto M & Janne OA (1993) Dominant negative regulation of transactivation by the rat androgen receptor: roles of the N-terminal domain and heterodimer formation Mol Endocrinol 7, 1399–1407 42 Jenster G, van der Korput HA, van Vroonhoven C, van der Kwast TH, Trapman J & Brinkmann AO (1991) Domains of the human androgen receptor involved in steroid binding, transcriptional activation, and subcellular localization Mol Endocrinol 5, 1396–1404 43 Minamiguchi K, Kawada M, Ohba S, Takamoto K & Ishizuka M (2004) Ectopic expression of the amino- 84 I Ahrens-Fath et al 44 45 46 47 48 49 50 51 52 53 54 terminal peptide of androgen receptor leads to androgen receptor dysfunction and inhibition of androgen receptor-mediated prostate cancer growth Mol Cell Endocrinol 214, 175–187 He B, Lee LW, Minges JT & Wilson EM (2002) Dependence of selective gene activation on the androgen receptor NH2- and COOH–terminal interaction J Biol Chem 277, 25631–25639 Haendler B (2002) Androgen-selective gene regulation in the prostate Biomed Pharmacother 56, 78–83 He B & Wilson EM (2002) The NH2-terminal and carboxyl–terminal interaction in the human androgen receptor Mol Genet Metab 75, 293–298 He B, Bai S, Hnat AT, Kalman RI, Minges JT, Patterson C & Wilson EM (2004) An androgen receptor NH2-terminal conserved motif interacts with the COOH terminus of the Hsp70-interacting protein (CHIP) J Biol Chem 279, 30643–30653 Heinlein CA & Chang C (2002) Androgen receptor (AR) coregulators: an overview Endocr Rev 23, 175– 200 Sommer A & Haendler B (2003) Androgen receptor and prostate cancer: molecular aspects and gene expression profiling Curr Opin Drug Discov Devel 6, 702–711 Chen CD, Welsbie DS, Tran C, Baek SH, Chen R., Vessella R., Rosenfeld MG & Sawyers CL (2004) Molecular determinants of resistance to antiandrogen therapy Nat Med 10, 33–39 Balk SP (2002) Androgen receptor as a target in androgen-independent prostate cancer Urology 60, 132–138; discussion 138–9 Gregory CW, He B, Johnson RT, Ford OH, Mohler JL, French FS & Wilson EM (2001) A mechanism for androgen receptor-mediated prostate cancer recurrence after androgen deprivation therapy Cancer Res 61, 4315–4319 Chesire DR, Ewing CM, Sauvageot J, Bova GS & Isaacs WB (2000) Detection and analysis of beta-catenin mutations in prostate cancer Prostate 45, 323–334 Pawlowski JE, Ertel JR, Allen MP, Xu M, Butler C, Wilson EM & Wierman ME (2002) Liganded androgen receptor interaction with beta-catenin: nuclear co-localization and modulation of transcriptional activity in neuronal cells J Biol Chem 277, 20702–20710 FEBS Journal 272 (2005) 74–84 ª 2004 FEBS ... Androgen receptor variant form expression (not shown) Finally we tested the effects of androstenedione on AR45 function This hormone is synthesized primarily by the adrenal glands and is not suppressed... absence of the NTD This might be overcome by the overexpression of cofactors To test this hypothesis, we analyzed the effects of two AR cofactors known to interact with the AR LBD TIF2 and AR45 were... amino acid-long stretch This AR45- specific region is entirely encoded by a hitherto undescribed exon 1B lying between the first and the second exon of the AR gene AR45 may therefore originate from