skeletal metastasis using a model in nude rats
Using a model-based approach to teach English writing to 10th graders in Ba Dinh high school, Nga Son, Thanh Hoa = Sử dụng bài viết mẫu để dạy viết tiếng Anh ch
... approach into teaching composition in a real classroom Practically, the research provides language teachers and learners with a number of activities and exercises using the model- based approach ... (listening, speaking, reading, and writing) so that Vietnamese, L2 students are able to communicate well in the target language However, teaching-learning quality at many places is still far from ... (1983), there are six approaches to teaching writing, namely: The Controlled-to-Free Approach, The Free-Writing Approach, The Paragraph-Pattern Approach, The Grammar-Syntax-Organization Approach, The...
- 55
- 551
- 0
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf
... changed our experimental setup Instead of dividing datasets during 10-fold cross-validation into training and test subsets with the ratio of 9:1 we randomly split the data into training, validation ... with increasing experience in terms of training set size We want to remind the reader that our two algorithms are aimed at small datasets We randomly split each dataset into 10 subsets where each ... subset was a test set and the corresponding remaining sets were merged to a training set We kept the labels of the training set to determine model parameters through maximum likelihood estimates and...
- 9
- 557
- 0
Báo cáo khoa học: "Flexible Guidance Generation using User Model in Spoken Dialogue Systems" pdf
... and dialogue modeling In Proc ICSLP Robert Kass and Tim Finin 1988 Modeling the user in natural language systems Computational Linguistics, 14(3):5–22 Kazunori Komatani and Tatsuya Kawahara 2000 ... Shijo-Kawaramachi to Arashiyama? User: Yes Sys: Bus number 11 bound for Arashiyama has departed Sanjo-Keihanmae, two bus stops away Figure 1: Example dialogue of the bus system learning algorithm using ... that annotated models of a user change during a dialogue, especially from ’indeterminable’ to ’low’ or ’high’ The number of labeled utterances is shown in Table Using the labeled data, we evaluated...
- 8
- 317
- 0
Báo cáo y học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pptx
... trail was maintained throughout the analysis process Triangulation Within the qualitative data analysis process, triangulation was used to refute or confirm emerging findings within each data ... with a validation process, thereby increasing the trustworthiness of our findings Quantitative data analysis Numeric data analysis was managed in SPSS, Version 15 Analysis of each survey instrument ... (informal leader 10); 'However, again because we've not been a culture that is very strong on accountability, if you don't hit that target again and again and again, what does that mean' (formal leader...
- 19
- 457
- 0
báo cáo khoa học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pdf
... trail was maintained throughout the analysis process Triangulation Within the qualitative data analysis process, triangulation was used to refute or confirm emerging findings within each data ... with a validation process, thereby increasing the trustworthiness of our findings Quantitative data analysis Numeric data analysis was managed in SPSS, Version 15 Analysis of each survey instrument ... (informal leader 10); 'However, again because we've not been a culture that is very strong on accountability, if you don't hit that target again and again and again, what does that mean' (formal leader...
- 19
- 354
- 0
yatcb lesson plans using a song in mode 2
... Rush in California; then present their findings or create a multimedia account, e.g imagining they are involved and recording their experiences with audio/video/photography/theatre, etc You Are ... write a text (e.g an informal email) including all of them; write the text again using literal English instead of idioms; what’s the difference? Further Study • SS research the period described in ... syllables, and stressed vowel sounds; notice different stress (rhythm) because it’s a song; notice more deliberate phrasing and clear SP accent; watch a performance of the song in its original language...
- 2
- 154
- 0
Stream Prediction Using A Generative Model Based On Frequent Episodes In Event Sequences doc
... engine could offer users a new interface a ordance (e.g., sort search results based on different meta-data), or search paradigm (e.g., engage in an instant messaging conversation with a domain ... requiring only one automaton per candidate episode All automata are initialized at the start of every sequence, Xi ∈ DY , and the automata make transitions whenever suitable events appear as we ... Y) An outline of the training phase is given in Algorithm The algorithm is assumed to have access to some historical (or training) data in the form of a long event stream, say sH To build a prediction...
- 9
- 497
- 0
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx
... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
- 10
- 541
- 0
báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf
... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
- 10
- 401
- 0
báo cáo hóa học:" An in vivo evaluation of bone response to three implant surfaces using a rabbit intramedullary rod model" doc
... (PHA) coating showing 11% osseointegration (intermediate level, anterior quadrant) D: Plasma-sprayed titanium surface with hydroxyapatite (PHA) coating showing 100% osseointegration (diaphyseal ... New Zealand White rabbits were used in our study After institutional review board approval, rabbits underwent bilateral femoral intramedullary implantation under general anesthesia All animals ... IM All animals were allowed unrestricted cage activity, and food and water ad libitum Temperature was maintained at 24°C and humidity at 70% All rabbits tolerated the anesthesia and surgical procedure...
- 8
- 413
- 0
Báo cáo toán học: " Two-stage source tracking method using a multiple linear regression model in the expanded phase domain" pdf
... moving speaker tracking Generally, an LS-TDE in a single-frame-based process easily confronts the lack of data problem because the Yang and Kang EURASIP Journal on Advances in Signal Processing ... Gaussian assumption becomes invalid thus a delay estimator which does not include a maximum searching process easily fails Conventional linear regression model basically assumes that the phase ... Received: 31 May 2011 Accepted: 10 January 2012 Published: 10 January 2012 References S Nakamura, K Hiyane, F Asano, Y Kaneda, T Yamada, TN Kobayashi, H Saruwatari, Design and collection of acoustic...
- 19
- 455
- 0
Báo cáo sinh học: "Evaluating antibiotics for use in medicine using a poloxamer biofilm model" potx
... Streptococcus mutans in plaque [13], to look at homoserine lactones and biocide efficacy in biofilms [14] and also to study biofilms and coaggregation in the freshwater bacteria Blastomonas natataria and ... Table 1: Mean [± standard error] zones of clearance (mm) around all the antibiotics for Gram negative bacteria [NM – Not measured Amoxycillin/ Clavulanic acid Ampicillin/ Sulbactam Ampicillin/ ... efficacy against a named organism, in this case E.coli, would be investigated using a zone of inhibition test (ZOI), according to NCCLS guidelines [16] on agar Where a zone of clearing was detected...
- 10
- 256
- 0
báo cáo khoa học: "Estimation of realized heritability in a selected population using mixed model methods" ppsx
... various values of n and h’ showing that q&dquo; q q increase as , h’ increases and that q, and q decrease and q increases as n increases The cumulative selection differentials in this and case ... selected using the measured trait and they each have n sons in year and in year One son is selected from each of the s sire families in year and has n sons in year There is now overlap ip year with ... that , By adding together equations so that the mean for animals not selected it can be shown that merit of animals in year t is half the mean merit of their fathers The in year t is the mean...
- 9
- 287
- 0
Báo cáo y học: "Storage and allogeneic transplantation of peripheral nerve using a green tea polyphenol solution in a canine model'''' ppsx
... female animals Each animal was acclimatized before the surgical procedures, housed in a separate cage, and given standard dog food and water three times a day All experiments were performed in accordance ... nerves remained in the nerve allografts in the PA0.1 and PA0.05 groups but that no cells of donor origin survived in the nerve allografts in the PA0.025 group Nakayama et al Journal of Brachial Plexus ... Tacrolimus, an update of its pharmacology and clinical efficacy in the management of organ transplantation Drug 1997, 54:925 12 Undre NA, Stevenson P, Schafer A: Pharmacokinetics of tacrolimus: clinically...
- 8
- 400
- 0
Báo cáo y học: "Development of a model of focal pneumococcal pneumonia in young rats" ppsx
... Vaccine and Pediatrics, Pearl River, NY) and David Briles (University of Alabama, Birmingham) and passaged through rats via intraperitoneal challenge as described previously [7] Passaged strains ... result in pneumonia in approximately 50% of animals, without causing bacteremia Using a similar inoculum with a serotype 19F isolate (106 cfu), pneumonia was produced in all challenged animals, ... determined intravenous catheter immediately upon dissection An animal was considered as having had pneumonia if any area of polymorphonuclear infiltration or infiltrative consolidation of lung parenchyma...
- 6
- 272
- 0
Báo cáo khoa học: "Effects of dopexamine on the intestinal microvascular blood flow and leucocyte activation in a sepsis model in rats" pptx
... the aim being to maintain adequate oxygen delivery to all organs and to the gut in particular In addition to noradrenaline (norepinephrine), adrenaline (epinephrine), dopamine and dobutamine, ... dopexamine infusion during intestinal hypotension, but dopexamine brought about intestinal vasodilatation [10] In postoperative cardiosurgical patients dopexamine increased jejunal mucosal perfusion ... leucocyte activation (a marker of inflammation) in experimental sepsis Key messages • Dopexamine improved intestinal microvascular blood flow in a sepsis model in rats • Dopexamine reduced endotoxin-induced...
- 8
- 380
- 0
Báo cáo y học: "Scenario based outdoor simulation in pre-hospital trauma care using a simple mannequin model" ppsx
... how all members of the team participate and engage in the scenario training Simulation is widely used [12] in medical training particularly in hospital operating room anaesthesia training or teaching ... training It is of importance to participate and act in a realistic manner, use gloves, use stretchers in the same was as in a real-patient situation Involving other members of staff and using ... real equipment in the scenario is important for keeping participants in the zone as well as for maintaining a high degree of realism in the scenarios Bredmose et al Scandinavian Journal of Trauma,...
- 6
- 304
- 0
Báo cáo sinh học: " Exploration of lagged relationships between mastitis and milk yield in dairy cows using a Bayesian structural equation Gaussian-threshold model" pdf
... specifications The data were analyzed using a standard multivariate linear sire model (LM), a recursive multivariate linear sire model (R-LM), a standard Gaussian-threshold (GT) sire model, and a recursive ... between mastitis and MY during the first 180 days of first-lactation Norwegian Red cows For comparison, the data were also analyzed using standard multivariate linear and Gaussian-threshold models, as ... (Tab IV) DISCUSSION 4.1 Estimation of recursive effects using Gaussian-threshold vs linear models Many diseases are measured as categorical, rather than quantitative, traits and often as binary...
- 25
- 378
- 0
Báo cáo y học: "MONKEY: identifying conserved transcription-factor binding sites in multiple alignments using a binding site-specific evolutionary model" ppsx
... CATTTGCCACTCACGAACAAGAATAAAAGAATTTAGGTATTCTAGAATGCCCAAAAGGTAACGGCAATACA AAATTGCCACTTACGAAGGAGAATAAAACAGCTCAGATATTCTTAGACACTCCAAGGGCAGTGACAATACA AAATTGCCACTCAGGAAAGAGAAGTGATATAATTAGATGTTCT AGTATTCAAAAGACAGCATCAGTGAT ... REB1 AGCGAGAAACAAAGGGATAGAGGAAAAAAATTTTCTCCGTCGGCCGCGGGTGGCAAAAGC AGCGAGGAACCA -GAAAAGAATAAAAAATTTTCTCGGTCGGCCGCGGGTGGCAAAAGC AGCGAGAAACTT GAAAACGGAGAGAAAATTTTCTCCGTCGGCCTCGGGTGGCAAAAAC AGCGAGGAGCCT-GAAAACCACAGAAAATTTTTTCTCCGTCGGCCGCGGGTGGCAAAAGC ... YLR387C_Spar YLR387C_Smik YLR387C_Skud YLR387C_Sbay 1E-11 AAATTGCCACTCACGAAAGAGAATAAAACGACTTAGTCAT-ATGCAATAGTCACAAGACGGTGGCAACACA AAATTGCCACTCACGAAGGAGAATAAAACAACTCAGTCGTCATGCAATACCCAAAAGACGGTGGCAATAAA...
- 15
- 288
- 0
Báo cáo y học: "Novel gene and gene model detection using a whole genome open reading frame analysis in proteomics" ppt
... on statistical data analysis, and all of the HUPO PPP participating laboratories for making their data available for this analysis The collaborative HUPO Plasma Protein study and the data analysis ... software packages rely on a protein database against which to search As a result, even the most exhaustive protein database search is limited to the data available in the current public databases ... 18 18 0 Apolipoprotein A- I precursor (Apo-AI; ApoA-I; contains apolipoprotein A- I(1-242)) APOA2 ENSG00000158874 5 Apolipoprotein A- II precursor (Apo-AII; ApoA-II; contains apolipoprotein A- II(1-76))...
- 13
- 395
- 0
- using a datareader object in visual studio net
- a transfer model using a typed feature structure
- strategic planning for project management using a project management maturity model pdf
- 856 parallel to serial conversion using a parallel in shift register
- 9 scoring data using a model
- 5 using a view in your application s gui
- pricing contingent claims using the black scholes formula in a model with dividends
- using a table in a navigation controller in a tab
- using a uidatepicker in timer mode
- patient apos s therapeutic history in medical records and in guideline recommendations for chronic diseases using a unique model
- using a captcha in your google app engine application
- using a resource in your code
- using a workbook in a browser
- using a lawyer in mediation
- 13 resizing a model in multiple directions
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25