using a uidatepicker in timer mode
báo cáo hóa học:" An in vivo evaluation of bone response to three implant surfaces using a rabbit intramedullary rod model" doc
Ngày tải lên :
20/06/2014, 04:20
... (PHA) coating showing 11% osseointegration (intermediate level, anterior quadrant) D: Plasma-sprayed titanium surface with hydroxyapatite (PHA) coating showing 100% osseointegration (diaphyseal ... New Zealand White rabbits were used in our study After institutional review board approval, rabbits underwent bilateral femoral intramedullary implantation under general anesthesia All animals ... IM All animals were allowed unrestricted cage activity, and food and water ad libitum Temperature was maintained at 24°C and humidity at 70% All rabbits tolerated the anesthesia and surgical procedure...
- 8
- 413
- 0
Báo cáo toán học: " Two-stage source tracking method using a multiple linear regression model in the expanded phase domain" pdf
Ngày tải lên :
20/06/2014, 20:20
... moving speaker tracking Generally, an LS-TDE in a single-frame-based process easily confronts the lack of data problem because the Yang and Kang EURASIP Journal on Advances in Signal Processing ... Gaussian assumption becomes invalid thus a delay estimator which does not include a maximum searching process easily fails Conventional linear regression model basically assumes that the phase ... Received: 31 May 2011 Accepted: 10 January 2012 Published: 10 January 2012 References S Nakamura, K Hiyane, F Asano, Y Kaneda, T Yamada, TN Kobayashi, H Saruwatari, Design and collection of acoustic...
- 19
- 455
- 0
Báo cáo y học: "Comparison of metal-dependent catalysis by HIV-1 and ASV integrase proteins using a new and rapid, moderate throughput assay for joining activity in solution" ppt
Ngày tải lên :
10/08/2014, 05:21
... simplified assay measuring the joining activity for retroviral integrases in solution The assay offers several advantages over the gel analyses used in many laboratories Limitations of the gel assays include ... of incubation Figure activity Moderate-throughput solution assay for integrase joining Moderate-throughput solution assay for integrase joining activity Panel A Principles of a solution assay ... processing and joining steps catalyzed by retroviral integrases produce a gapped recombination intermediate The shaded region represents an IN multimer, heavy lines the viral DNA, and thin lines...
- 10
- 414
- 0
Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model
Ngày tải lên :
05/09/2013, 16:11
... Emission type Landfill type CAA Conventional CAA Arid area Inventory Conventional Inventory Arid area Inventory Wet (bioreactor) Source: [11] CAA = Clean Air Act (1970) K (year-1) 0.05 (Default) 0.02 ... corresponding Monte Carlo statistics show the minimum and maximum annual average acceptance rates to be 999.2 mg/year and 1000.8 mg/year respectively The mean, variance, and standard deviation are ... annual acceptance rate, and the age of the landfill were analyzed using Monte Carlo simulation This is because, t heir actual values are not known but are estimated to be in ranges In this simulation,...
- 8
- 540
- 0
Tài liệu STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING A PROJECT MANAGEMENT MATURITY MODEL ppt
Ngày tải lên :
16/01/2014, 16:33
... begins with a project definition process, which is broken down into a technical baseline, a functional or management baseline, and a financial baseline The technical baseline includes, at a minimum: ... critical success factors in achieving project management excellence: qualitative, organizational, and quantitative factors QUALITATIVE FACTORS If excellence in project management means a continuous ... as a whole ORGANIZATIONAL FACTORS Coordination of organizational behavior in project management is a delicate balancing act, something like sitting on a bar stool Bar stools usually come with...
- 271
- 464
- 3
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf
Ngày tải lên :
20/02/2014, 23:20
... (primer A and C, not shown) was abundantly present in JAr and Jeg3 cells while only negligible amounts became apparent in BeWo cells In parallel (using primers A and C) a faint 540 bp band (indicative ... cell association and degradation of 125I-labeled Table Specific binding of 125I-labeled HDL to choriocarcinoma cell lines at °C Binding constants were calculated by non linear regression analysis ... island and cell columns, is formed which maintains the ability of proliferation and invasion Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase...
- 12
- 470
- 0
Báo cáo khoa học: "PART-OF-SPEECH TAGGING USING A VARIABLE MEMORY MARKOV MODEL" doc
Ngày tải lên :
23/03/2014, 20:21
... Statistical decision theory and Bayesian analysis, New-York: Springer-Verlag, 1985 E Brill Automatic grammar induction and parsing free text: A transformation-based approach In Proceedings of ACL ... interested in learning a sub-class of finite state machines which have the following property Each state in a machine M belonging to this sub-class is labeled by a string of length at most L over ... without using a tagged corpus for training as we But the results are not easily comparable with ours since a lexicon is used that lists only possible tags This can result in increasing the error rate...
- 7
- 299
- 0
Báo cáo sinh học: "Pro-apoptotic activity of a-bisabolol in preclinical models of primary human acute leukemia cells" pptx
Ngày tải lên :
18/06/2014, 19:20
... cytotoxicity of a- bisabolol in Ph + cells as compared to imatinib mesylate (A) Scaled a- bisabolol alone (solid line) or in combination with μM imatinib mesylate (dashed line) in representative cases out ... between imatinib mesylate and a- bisabolol were analyzed according to the median-effect method of Chou and Talalay [16] using the CalcuSyn Software (Biosoft, Cambridge, UK) The mean combination index ... Dickinson) A sequential Boolean gating strategy was used to accurately enumerate different populations [15] Cytotoxicity data hierarchical clustering analysis To generate a classification based...
- 13
- 398
- 0
báo cáo hóa học: " A refined in vitro model to study inflammatory responses in organotypic membrane culture of postnatal rat hippocampal slices" potx
Ngày tải lên :
19/06/2014, 22:20
... Sanz O, Acarin L, Gonzalez B, Castellano B: NF-kappaB and IkappaBalpha expression following traumatic brain injury to the immature rat brain J Neurosci Res 2002, 67:772-780 Hawiger J: Innate immunity ... Matsuda S, Sudo S, Fujita H, Sakanaka M, Maeda N: Induction of resting microglia in culture medium devoid of glycine and serine Glia 1998, 24:198-215 Nakamura Y, Si QS, Kataoka K: Lipopolysaccharide-induced ... that before applying an appropriate test (in our case the nonparametric Mann-Whitney U-test) the data should be carefully analysed We also argue that by applying this model it is possible to avoid...
- 15
- 345
- 0
Báo cáo hóa học: " Research Article Flicker Compensation for Archived Film Sequences Using a Segmentation-Based Nonlinear Model" doc
Ngày tải lên :
22/06/2014, 01:20
... estimation are presented in Sections 3.2 and 3.3 Spatial adaptation and incorporation of segmentation information are described in Section Finally, a temporal compensation framework using a motion-compensated ... estimation of a single parameter which although straightforward fails to account for spatial variability In [3] it was observed that archive material typically has a limited dynamic range Histogram ... Schallauer et al [9] and Naranjo and Albiol [4] Vlachos [7] Summary linear compensation—flicker is modelled as a global intensity shift linear compensation—flicker is modelled as a multiplicative...
- 16
- 238
- 0
PROJECT MANAGEMENT USING A PROJECT MANAGEMENT MATURITY MODEL pot
Ngày tải lên :
28/06/2014, 23:20
... begins with a project definition process, which is broken down into a technical baseline, a functional or management baseline, and a financial baseline The technical baseline includes, at a minimum: ... critical success factors in achieving project management excellence: qualitative, organizational, and quantitative factors QUALITATIVE FACTORS If excellence in project management means a continuous ... as a whole ORGANIZATIONAL FACTORS Coordination of organizational behavior in project management is a delicate balancing act, something like sitting on a bar stool Bar stools usually come with...
- 271
- 298
- 0
Báo cáo y học: "Using a human cardiovascular-respiratory model to characterize cardiac tamponade and pulsus paradoxus" pdf
Ngày tải lên :
13/08/2014, 16:20
... constraint as it affects chamber mechanics is AV interaction Pericardial constraint increases AV interaction and results in lowered filling, decreasing LV preload and delaying leftward septal movement ... time intervals during pericardial effusion The American Journal of Cardiology 1983, 51:1033-1035 Akamatsu S, Terazawa E, Kagawa K, Arakawa M, Dohi S: Transesophageal Doppler echocardiographic assessment ... 1 1A) , tracking the low-amplitude intrathoracic pressure, has no significant influence in shaping cardiac pressures within the cardiac cycle In severe tamponade however, PPERI bears a cardiac variation...
- 28
- 335
- 0
Báo cáo sinh học: " The analysis of disease biomarker data using a mixed hidden Markov model (Open Access publication)" ppt
Ngày tải lên :
14/08/2014, 13:21
... make-up of the cows The t of the HMM was assessed on simulated data based on parameters obtained in a survey of clinical mastitis cases Bayesian estimates of the parameters were obtained using ... subclinical mastitis in England and Wales, the mean incidence of clinical mastitis recorded by the farmer was 47 cases per 100 cows per year [3] In Canada, Sargeant et al [21] have observed that 19.8% ... Switzerland, Roesch et al [19] reported 40% cows showing at least one positive California Mastitis Test in at least one quarter at 31 days and 102 days post partum In a survey of clinical and subclinical...
- 19
- 388
- 0
Stream Prediction Using A Generative Model Based On Frequent Episodes In Event Sequences doc
Ngày tải lên :
23/03/2014, 13:20
... engine could offer users a new interface a ordance (e.g., sort search results based on different meta-data), or search paradigm (e.g., engage in an instant messaging conversation with a domain ... requiring only one automaton per candidate episode All automata are initialized at the start of every sequence, Xi ∈ DY , and the automata make transitions whenever suitable events appear as we ... Y) An outline of the training phase is given in Algorithm The algorithm is assumed to have access to some historical (or training) data in the form of a long event stream, say sH To build a prediction...
- 9
- 497
- 0
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx
Ngày tải lên :
18/06/2014, 22:20
... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
- 10
- 541
- 0
báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf
Ngày tải lên :
20/06/2014, 04:20
... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
- 10
- 401
- 0
Báo cáo hóa học: " Source Depth Estimation Using a Horizontal Array by Matched-Mode Processing in the Frequency-Wavenumber Domain" pot
Ngày tải lên :
22/06/2014, 23:20
... source information, and mode excitation factors cannot be extracted using the same approach (which is based on the vertical sampling of the data) In this paper, we propose an alternative method, based ... consider an omnidirectional point source at depth z = zs and range r = which radiates a broadband signal in a shallow water waveguide The acoustic field is sampled by a horizontal line array (HLA) of ... example of a particular environmental mismatch: error on water depth estimation for data recorded on a horizontal line array The recorded data are simulated in an oceanic waveguide made of a...
- 16
- 364
- 0
Modelling Load Shifting Using Electric Vehicles in a Smart Grid Environment pdf
Ngày tải lên :
28/06/2014, 23:20
... at: shinichi.inage.wk@hitachi.com or David Elzinga at david.elzinga@iea.org International Energy Agency Shin-ichi Inage WO R K I N G PA P E R Modelling Load Shifting Using Electric Vehicles in ... predictable and can be estimated from traffic and road-use data Figure indicates a typical daily travelling pattern of gasoline-driven cars in Japan It shows that 50% of gasoline-fuelled cars travel ... than 30 km per day, and that 30% of gasoline-fuelled cars travel less than 15 km per day Figure 5: Typical daily travelling patterns of gasoline-fuelled cars in Japan Source: Sagawa and Skaguchi,...
- 76
- 184
- 0
Báo cáo sinh học: "Evaluating antibiotics for use in medicine using a poloxamer biofilm model" potx
Ngày tải lên :
08/08/2014, 19:20
... Streptococcus mutans in plaque [13], to look at homoserine lactones and biocide efficacy in biofilms [14] and also to study biofilms and coaggregation in the freshwater bacteria Blastomonas natataria and ... Table 1: Mean [± standard error] zones of clearance (mm) around all the antibiotics for Gram negative bacteria [NM – Not measured Amoxycillin/ Clavulanic acid Ampicillin/ Sulbactam Ampicillin/ ... efficacy against a named organism, in this case E.coli, would be investigated using a zone of inhibition test (ZOI), according to NCCLS guidelines [16] on agar Where a zone of clearing was detected...
- 10
- 256
- 0