... hormone-refractory prostate carcinoma cells: mechanistic studies Int J Oncol 2002, 20:681-9 Yasukawa K, Ikeya Y, Mitsuhashi H, Iwasaki M, Aburada M, Nakagawa S, Takeuchi M, Takido M Gomisin A inhibits ... ultrasound-guided intratumoral injection of "Star-99" in treatment of hepatocellular carcinoma of nude mice World J Gastroenterol 2003, 9: 701-5 Nandakumar KS, Lakshmi Rao K, Pardhasaradhi BV, Khar A Upregulation ... 12-O-tetradecanoylphorbol-13acetate in two-stage carcinogenesis in mouse skin Oncology 1992, 49:68-71 Chang YS, Seo EK, Gyllenhaal C, Block KI Panax ginseng: a role in cancer therapy? Integr Cancer...
Ngày tải lên: 03/11/2012, 09:54
... gathering the data for use in training and testing the neural network A large training data reduces the risk of under-sampling the nonlinear function, but increases the training time To improve training, ... consolidation SELECTION OF STRAIN RATE r= V − Vmin Vmax − Vmin Data Collection Data Normalization Parametric Studies (3) Training and Testing ANN in which LI is the liquidity index with soil saturated, ... which have not been included in database, are also inferred to compare with the predicted value Properties of the soil used for verification of the ANN models are summarized in Table Table Properties...
Ngày tải lên: 22/03/2013, 15:01
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... a wind farm of HAWT using GA gives a uniform grid arrangement similar that obtained by Grady et al [2]; this is different than that obtained by Mosetti [1] who obtained a somewhat random arrangement ... of Engineering in department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail address: rka@wustl.edu ... University in St Louis He received B.S in Mechanical Engineering from Shanghai Jiao Tong University in China in 2008 and M.S in Mechanical Engineering from Washington University in St Louis in 2010 Xiaomin's...
Ngày tải lên: 05/09/2013, 17:03
Using a DataReader Object in Visual Studio .NET
... SqlDataReader object to a string Also notice you include the namespace when referencing the SqlDataReader class: you use System.Data.SqlClient SqlDataReader when creating the SqlDataReader object ... System.Data.SqlClient.SqlDataReader mySqlDataReader = sqlCommand1.ExecuteReader(); while (mySqlDataReader.Read()) { listView1.Items.Add(mySqlDataReader["CustomerID"].ToString()); listView1.Items.Add(mySqlDataReader["CompanyName"].ToString()); ... the password for the database connection to the ConnectString property of your SqlConnection object For my installation of SQL Server, the password to access the Northwind database is sa, and...
Ngày tải lên: 07/11/2013, 10:15
Tài liệu Using a DataView to Control Edits, Deletions, or Additions in Windows Forms pdf
... adding, editing, or deleting the data in the control Binding a DataGrid to a DataTable binds to the default view of the underlying DataTable The DataView class represents a view of the DataTable ... SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable dtOrders = new DataTable("Orders"); da.FillSchema(dtOrders, SchemaType.Source); ... delete records in the underlying DataTable The properties described in Table 7-14 control the data modification permitted in a DataView Table 7-14 DataView properties Property Description AllowDelete...
Ngày tải lên: 14/12/2013, 18:16
A study on differences of using pasive voi in english and vietnamese = nghiên cứu về sự khác nhau trong cách dùng câu bị động của tiếng anh và tiếng việt luận văn tốt nghiệp đại học
... verb and a certain subject Consider ( Active) : I saw a table in the bar ( Passive): A table was seen by me in the bar. The passive one sounds artificial and unlikely to be said But if the active ... contrast and implications for teaching and learning languages made above, I hope that this paper can help students and teachers have better knowledge and correct translations of the passive-meaning ... have in our mind the idea that b and c in Vietnamese are totally strange to to be in English, which intrinsically has a compulsory form B and c in Vietnamese are not obligatory to express passive...
Ngày tải lên: 18/12/2013, 10:03
Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university
... Cognitive Strategies Employing actions Practicing Receiving and sending messages Analyzing and reasoning Creating structures for Centering learning Arranging and planning learning Evaluating learning ... gathering and organizing materials, arranging a study space and a schedule, monitoring mistakes, and evaluating task success, and 27 evaluating the success of any type of learning strategy) are ... Adjusting/ Approximating Speaking Speaking Speaking, Writing Speaking, Writing Speaking, Writing the message i Coining words j Using a circumlocution or Speaking, Writing Speaking, Writing synonym...
Ngày tải lên: 27/12/2013, 20:26
Tài liệu Báo cáo "Numerical simulations of overland floods in urban areas using a conservative Godunov-type scheme " pptx
Ngày tải lên: 13/02/2014, 12:20
Tài liệu Báo cáo khoa học: "Word Order in German: A Formal Dependency Grammar Using a Topological Hierarchy" pptx
... our findings are presented, without recourse to any mathematical formalism, in the usual terminology of traditional German grammars In Section 3, a mathematical formalism is proposed to state ... field can be occupied by a non-verbal phrase or by a verb creating an embedded domain Formalization A grammar in the formalism we introduce in the following will be called a Topological Dependency ... creation rules Creation of the main domain in the initial field: (Vfin, i, md, [) Creation of an embedded domain in a major field: (V¬fin, f, ed, ]) Creation of a verbal cluster in the right bracket...
Ngày tải lên: 20/02/2014, 18:20
Tài liệu Báo cáo khoa học: "Choosing the Word Most Typical in Context Using a Lexical Co-occurrence Network" ppt
... disambiguation using statistical models of Roget's categories trained on large corpora In Proceedings of the14th lnternational Conference on Computational Linguistics (COLING-92), pages 4~ a a.50 ... Stanford, CA, March Elhadad, Michael 1992 Using Argumentation to Control Lexical Choice: A Functional Unification Implementation Ph.D thesis, Columbia University Golding, Andrew R and Yves Schabes ... Corpora, Copenhagen, August Ng, Hwee Tou and Hian Beng Lee 1996 Integrating multiple sources to disambiguate word sense: An exemplar-based approach In Proceedings of the 34th Annual Meeting of...
Ngày tải lên: 22/02/2014, 03:20
Báo cáo " A study on urban development through land surface temperature by using remote sensing: in case of Ho Chi Minh City " potx
... The study area Fig The study area 2.2 Data sets Landsat TM and Aster images were used as the main data source in this research Two Landsat TM images have seven bands, included six reflective bands in ... mean that vulnerability will increase at the same time as the impacts of climate change become increasingly manifest Actions by planners, designers and infrastructure owners in sustainable management ... always in industrial zones and urban areas This implies that urban growth brings up surface temperature by replacing natural vegetation with non-evaporating, non-transpirating surfaces such as impermeable...
Ngày tải lên: 05/03/2014, 16:20
Studying Aesthetics in Photographic Images Using a Computational Approach pot
... aesthetics and originality ratings for a given image A plot of 3581 unique photograph ratings can be seen in Fig As can be seen, aesthetics and originality ratings have approximately linear correlation ... subjective, and there are no agreed standards for rating This may render absolute scores less meaningful Again, ratings above or below certain thresholds on an average by a set of unique users generally ... Overall Accuracy Class Low accuracy Class High accuracy 78 76 90 Accuracy (in percentage) Accuracy (in percentage) 95 85 80 75 70 74 Overall Accuracy Class Low accuracy Class High accuracy 72 70...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx
... neutral red, and fixed with 1% formaldehyde containing 1% CaCl2 for The dye incorporated into viable cells was extracted with 50% ethanol containing 1% acetic acid, and absorbance at 540 nm was measured ... disorders including Alzheimer’s, polyglutamine and Parkinson’s disease are though to be caused by an accumulation of protein aggregates in the brain [24], and Hsps such as Hsp70 and Hsp40 are shown ... Ishihara, K., Yasuda, K & Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. ,...
Ngày tải lên: 17/03/2014, 10:20
Stream Prediction Using A Generative Model Based On Frequent Episodes In Event Sequences doc
... requiring only one automaton per candidate episode All automata are initialized at the start of every sequence, Xi ∈ DY , and the automata make transitions whenever suitable events appear as we ... engine could offer users a new interface a ordance (e.g., sort search results based on different meta-data), or search paradigm (e.g., engage in an instant messaging conversation with a domain ... Y) An outline of the training phase is given in Algorithm The algorithm is assumed to have access to some historical (or training) data in the form of a long event stream, say sH To build a prediction...
Ngày tải lên: 23/03/2014, 13:20
Monetary Policy in the Eurozone: Evaluating the European Central Bank’s interest rate decisions and the needs of member states using a Taylor rule ppt
... country has a number of implications Martin Feldstein argues, with claims based on 1999 data, that “monetary policy that was too expansionary for Spain and Ireland, causing a substantial acceleration ... Bergsten and Kirkegaard 2012 Shambaugh 75 Shambaugh 76 Shambaugh 77 Shambaugh 11 78 Shambaugh 17 79 Shambaugh 13 80 Shambaugh 17 81 Shambaugh 29 74 Srivangipuram 28 As these crisis are in some way linked ... zone are almost exactly analogous to the flaws in the international monetary system.” As the European Central Bank is tasked with not only maintaining price stability, but also “supporting economic...
Ngày tải lên: 29/03/2014, 13:20
Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc
... Nishida E, Kadowaki T, Matsuzaki F, Iida K, Harada F, Kasuga M, Sakai H & Yahara I (1986) Two mammalian heat shock proteins, HSP90 and HSP100, are actin-binding proteins Proc Natl Acad Sci USA 83, ... binding an activating regulatory coprotein to an inactive catalytic subunit can activate a kinase In many signal-transducing protein kinases, site-specific phosphorylation by an upstream protein ... unphosphorylated proteins in SDS ⁄ PAGE [5] Protein kinase activity in cells is regulated in many different ways Releasing an inhibitory subunit from a catalytic subunit can activate a kinase By contrast,...
Ngày tải lên: 30/03/2014, 03:20
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx
... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... http://www.virologyj.com/content/1/1/11 Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Quantification of the effects of an alpha-2 adrenergic agonist on reflex properties in spinal cord injury using a system identification technique" pptx
... referred the patients and participated in interpreting data, and WZR participated in interpreting data and writing the manuscript All authors read and approved the final manuscript Acknowledgements ... because of their time constraints, and their data are not included here Patients had sustained a traumatic, motor incomplete non-progressive spinal cord injury, with an American Spinal Injury Association ... 28 Mathias CJ, Luckitt J, Desai P, Baker H, el Masri W, Frankel HL: Pharmacodynamics and pharmacokinetics of the oral antispastic agent tizanidine in patients with spinal cord injury J Rehabil...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " Results of Clinicians Using a Therapeutic Robotic System in an Inpatient Stroke Rehabilitation Unit" potx
... preferred a familiar Canadian measure, the CMSA This impairment measure divides arm and hand recovery into separate motor stages (1-7), allowing patients to be placed in similar bins as well as allowing ... Research Ethics Boards The Ministry of Health in Canada approved the system as a new class II medical device in Canada for investigational trials If the individuals met the inclusion criteria and ... seated in a chair or wheelchair in front of the computer screen at a height adjustable table The trunk was not restrained, but the therapist ensured that the patient was sitting upright, using...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " A validation study using a modified version of Postural Assessment Scale for Stroke Patients: Postural Stroke Study in Gothenburg (POSTGOT)" doc
... SwePASS in the acute stage Page of after stroke, both in clinical and research settings In addition, the SwePASS was easy to apply and fast to administer in clinic Additional material Additional file ... SwePASS in the intrarater study The rs were high (in line with adopting Table Participant characteristics for the study populations in the two reliability investigations Intrarater Interrater ... modified PASS, SwePASS, in patients Table Interrater reliability; Spearman’s (rs) and Percentage Agreement (PA) using the SwePASS (n 15) Item Spearman’s p PA (rs) Supine to affected side lateral 0.85...
Ngày tải lên: 19/06/2014, 08:20