patient apos s therapeutic history in medical records and in guideline recommendations for chronic diseases using a unique model
Jim ledin embedded control systems in c and c++ an introduction for software developers using MATLAB 2004
... in a SISO system for control system design purposes For instance, assume the aircraft is flying straight and level and must maintain a desired altitude A SISO system for altitude control uses ... is suitable for use in SISO systems As described in Chapter 1, it often is possible to approximate a MIMO system as a set of SISO systems for design purposes When this approximation is reasonable, ... Mathematica® Control System Professional This tool handles linear SISO and MIMO system analysis and design in the time and frequency domains This is an add-on to the Mathematica product Mathematica...
- 268
- 2,445
- 0
Stream Prediction Using A Generative Model Based On Frequent Episodes In Event Sequences doc
... search session as a character sequence This allows for easy manipulation and analysis, and also removes identifying information, protecting privacy without destroying the salient aspects of search ... transaction databases (Connections between frequent itemsets and generative models has already been established [7]) A mixture of generative models for transaction databases also has a wide range of applications ... observed for May 2007, Nov 2006 and Dec 2006 data sets Also, the computational costs of estimating W th order Markov chains and using them for prediction via a string-matching technique increases rapidly...
- 9
- 497
- 0
Báo cáo hóa học: " Associations between disease severity, coping and dimensions of health-related quality of life in patients admitted for elective coronary angiography – a cross sectional study" pdf
... regression analyses used the statistical program R [40], while SPSS version 15 (SPSS Inc, Chicago, IL, USA) was used for descriptive analyses A p-value of < 0.05 was classified as statistically significant ... AFS was 0.77 Anxiety and depression were assessed by self-report using the Hospital Anxiety and Depression Scale (HADS), which consists of seven items for anxiety (HADS -A) and seven for depression ... mass index (BMI) kg/m2 CCS classification of angina a Class (no angina) Class I Class II Class III NYHA classification of dyspnea b NYHA I (no dypnea) NYHA II NYHA III-IV Coronary artery disease...
- 12
- 463
- 0
báo cáo hóa học:" Health-related quality of life in patients waiting for major joint replacement. A comparison between patients and population controls" pot
... analysis Data were analysed using SPSS for Windows, version 12.0.1 Descriptive statistics were used to describe demographic characteristics Comparative analyses of demographic characteristics between ... HRQoL instrument We assessed HRQoL using 15D The 15D is a generic and standardised HRQoL instrument consisting of 15 dimensions: moving, seeing, hearing, breathing, sleeping, eating, speech, elimination, ... followup data for patients in a prospective multi-centre study aimed at assessing the costs and effects of waiting Methods Data collecting Patients were enrolled into this study in three Finnish hospitals...
- 7
- 447
- 0
Báo cáo y học: "Validation of the International Classification of Functioning, Disability and Health Core Set for chronic widespread pain from the perspective of fibromyalgia patient" potx
... providers and personal assistants e415 Individual attitudes of extended family members e555 Associations and organisational services, systems and policies 13 e560 Media services, systems and policies ... were linked to ICF categories based on established linking rules [26,27] in a systematic and standardized way According to these linking rules, health professionals trained in the ICF are advised ... agreement and indicates no additional agreement beyond what is expected by chance alone The Kappa analysis was performed with SAS for Windows, version 9.1 (SAS Institute Inc., Cary, NC, USA) Results...
- 12
- 574
- 0
Báo cáo y học: "Direct cord implantation in brachial plexus avulsions: revised technique using a single stage combined anterior (first) posterior (second) approach and end-to-side side-to-side grafting neurorrhaphy" pot
... C5,6,7,8T1 avulsions In Cases and 2, the biceps and anterior, lateral and posterior deltoid, the supraspinatus, the subscapularis, pectoral and clavicular heads of pectoralis major, latissimus dorsi, ... Pain In adult total avulsions (Cases and 2), pain persisted and had a grade of In C5,6 ruptures C7,8T1 avulsions, pain disappeared, but patients complained of a sensation of tingling on combined ... joints and avulsed root stumps present within the spinal canal He was not able to reach those roots avulsed out of the spinal canal and migrated distally [8] In the posterior subscapular approach...
- 17
- 424
- 0
Báo cáo y học: " Comparison of the efficacy of lamivudine and telbivudine in the treatment of chronic hepatitis B: a systematic review" pdf
... was assessed using the QUOROM guidelines as well as using the Jadad scale[12] Data analysis Data analysis was carried out with the use of Review Manager Software 5.0(Cochrane Collaboration, Oxford, ... made substantial contributions to its design, acquisition, analysis and interpretation of data LZC, and XHD, participated in the design, acquisition, analysis and interpretation of data All authors ... both authors (S S Zhao and L H Tang) using a pre-designed data extraction form and the information subsequently was entered into Review Manager (RevMan 5.0) Information was extracted on data source;...
- 11
- 398
- 0
báo cáo khoa học: " Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover) using a large insert BAC library" ppsx
... TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT (701) TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT ... http://www.biomedcentral.com/1471-2229/9/94 100 (1) ATGATACTAACCAAAATAGCCCTAAAGAACAAGAACAAAAAGCATCACCTAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT (1) ATGATACTAACCAAAATAGTCCTAAAGAACAAGAACAAAAATCATCACCAAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT ... CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA (601) CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA...
- 11
- 275
- 0
Báo cáo y học: " Cervicocephalic kinesthetic sensibility and postural balance in patients with nontraumatic chronic neck pain – a pilot study" pps
... immediate analysis of results Postural performance was assessed in a calm, undisturbed room Participants stood without shoes on the force platform, body in anatomical position and arms at their sides ... using GraphPad StatMate (version 2.00; GraphPad Software, San Diego, California, USA) Data analysis was performed by an independent statistician Probability values less than 0.05 (5%) were considered ... Findings of Others Although our sample was small, and HRA and CSP results varied among participants, one of six test movements for HRA showed significant differences, suggesting a possible interaction...
- 10
- 396
- 0
Báo cáo y học: "Commonly applied positive end-expiratory pressures do not prevent functional residual capacity decline in the setting of intra-abdominal hypertension: a pig model" pot
... period allowing for abdominal, respiratory and haemodynamic stabilization Measurements and calculations Haemodynamic parameters All pressures including IAP were measured with a transducer (Hospira, ... (Figures and 3, and Tables 1, and 3) Effect of PEEP at different levels of IAP on CO, DO2 SvO2, and SVR PEEP was associated with a dose-related decrease in CO and DO2 at baseline IAP and at grade ... normal saline (Sirecust 126; Siemens Medical Electronics) For each IAP and PEEP setting, three CO measurements were performed and averaged Functional residual capacity FRC was measured using...
- 11
- 406
- 0
assessment of implementation of government strategies in improving competitiveness of telecommunication companies in vietnam basis for policy redirection using pest analysis and solution
... organization, has its owned name, assets, transaction-based stabilization, the business registration in accordance with the law in order to carry out business activities Business Law (2005) explained that ... his services but a stage in the supply chain and placed in the customer 's location to consider + Dynamic analysis, instead of the old style analysis (using international prices, interested in service ... political stability and political institutions, openness and clear of all policies and guidelines of the State political factor is always competitive environment stability for businesses and investors...
- 146
- 576
- 2
WNT SIGNALING IN ZEBRAFISH FIN REGENERATION: CHEMICAL BIOLOGY USING A GSK3β INHIBITOR
... PH3-positive cells per unit area was calculated for each fin β-catenin Staining Analysis Fin regenerates were collected at dpa and stained using anti-β-catenin antibody, as described above Intensity ... immediately surrounding the blastema in control fins; whereas, nM LSN 2105786 treated fins showed an expansion of the expression domain as well as intensified staining Staining intensity at dpa was ... is a well-established drug target for regulating Wnt signaling, and zebrafish GSK3β is very similar to human GSK3β Human GSK3β contains 420 amino acids versus 421 in zebrafish GSK3β A 408 amino...
- 51
- 110
- 0
Social Media and Internet-Based Data in Global Systems for Public Health Surveillance A Systematic Review
... systems have not applied algorithms and statistical baselines to information before it is presented to users, which is a standard feature of most established indicator-based systems Event-based systems ... extraction criteria was available (Tables and 3) System Category Event-based surveillance systems can be classified as news aggregators, automatic systems, or moderated systems.25 News aggregators ... incorporate human input and review, allowing users to add comments, tags, and ranks during the data-processing phases and confirmation and feedback during the dissemination phases Systems without...
- 27
- 318
- 0
Survey of cellular factors modulating the HIV 1 integration complex activity using a unique protein screening system in vitro
... described in 2.5.1) An additional PCR was performed using a common set of forward (5’GGGGACAAGTTTGTACAAAAAAGCAGGCTgcgaattcatcgatagatctgat-3) and reverse (5’GGGGACCACTTTGTACAAGAAAGCTGGGTCctacttgtcatcgtcatccttg-3’) ... correct size of the candidate protein Protein concentration was determined by Bradford method (Bio-Rad) using BSA as a protein standard 2.5.4 Microtiter plate-based assay using GST-tagged candidate ... cycle involves proviral gene expression and viral RNA translation using host machineries, assembly of new virion progenies, budding, maturation and infection of new targets (Al-Mawsawi and Neamati,...
- 125
- 395
- 0
Assessment of implementation of government strategies in improving competitiveness of telecommunication companies in vietnam basis for policy redirection using PEST analysis and solution
... from reports and studies in recent years Statistical analysis The thesis analyzed using one-way ANOVA with Post Hoc Tests deep analysis to analyze the differences in the impact assessment of the ... SPSS spreadsheet Research Instrument The researcher will use a questionnaire and document analysis as the main instruments for data gathering The questionnaires shall contain items to be asked ... text was issued too much and fast, sometimes inconsistent, has caused confusion for businesses in the recognition and response treatment in accordance with the law change The regulation is too...
- 14
- 176
- 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... different settings, and enable researchers to take into account additional variables in subsequent analyses Our study shows that variation and bias in field data (records of metritis scores and metritis ... cows and herds, so as to be able to create meaningful data valid in large scale analyses (across herds and veterinary practices) Such veterinarians would generally want to focus on possibilities ... to a quantitative analysis This may allow subsequent analytical control of bias Sources of bias and variation in veterinary records Records of metritis scores, ideal for monitoring of disease incidence,...
- 10
- 587
- 0
At the Sign of the Barber''''s Pole Studies In Hirsute History potx
... his appointees, heirs, and assigns of my said estate, called Pepper Park, shall be void; and I devise the same estate to my son William, his appointees, heirs, and assigns And in case my said son ... discontent, and rise against the law, when they see magistrates, and bailies, and deacons, and the provost himsel', wi' heads as bald an' as bare as one o' my blocks.'" It was not in Scotland alone ... cygnis rare birds on the earth, and as scarce as black swans You shall have also your fragrant waters for your face, wherewith you shall be all besprinkled; your musick again, and pleasant harmony...
- 43
- 384
- 0
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot
... common disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence ... Yabe H, Abe S, Fukunaga M, Terada M, et al.: Guidelines for diagnosis and management of Paget 's disease of bone in Japan J Bone Miner Metab 2006, 24:359-367 Kanis JA: Pathophysiology and treatment ... Yabe H, Abe S, Terada M, Yoh K, et al.: Prevalence and clinical features of Paget 's disease of bone in Japan J Bone Miner Metab 2006, 24:186-190 Takata S, Hashimoto J, Nakatsuka K, Yoshimura...
- 4
- 402
- 0
báo cáo hóa học:" Patient-recorded outcome to assess therapeutic efficacy in protoporphyria-induced dermal phototoxicity: a proposal" docx
... edema and skin lesions may develop and an incapacitating pain may occur The pain cannot be alleviated by pain killers such as acetaminophen or salicylic acid derivatives Even nonsteroidal-anti-rheumatics ... Cronbach 's alpha requires a multi-item assessment The patient ratings on these items are statistically related to each other so as to estimate the underlying construct, and Cronbach 's alpha is a ... testing and retesting of stable patients PP-related phototoxicity occurs in separate attacks; therefore patients not exhibit stable symptoms Hence repeatability assessment was replaced by analyzing...
- 13
- 238
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25