ptio2 a clinical comparison of two monitoring devices pdf
Báo cáo y học: "Bone healing after median sternotomy: A comparison of two hemostatic device" pdf
... Healing Total Healing Partial Healing No Healing Total Healing 2 Partial Healing Total Healing Total Healing Total Healing Total Healing No Healing Partial Healing Partial Healing Total Healing ... Healing Partial Healing Partial Healing Total Healing Total Healing Partial Healing Total Healing Total Healing No Healing Total Healing Mean 1.6 0.8 1.9 Sd 0.5 0.7 0.4 p-value Ostene™ vs Bone wax ... hemostatic treatment as an adjacent procedure to sternotomy Materials and methods All animal handling and caretaking was conducted in accordance with guidelines given by the Danish Inspectorate of...
- 8
- 373
- 0
báo cáo hóa học:" Proximal screws placement in intertrochanteric fractures treated with external fixation: comparison of two different techniques" pdf
... to the American Society of Anesthesiologists, 47 patients were scored as ASA and 23 patients as ASA In group A, 12 patients had an AO type A1 fracture and 23 patients had an AO type A2 fracture ... Postoperative Management Evaluation during treatment included plain radiographs and pain assessment using the visual analog scale (VAS) Clinical evaluation of patients was assessed with the Harris ... of high-risk patients with several co-morbidities An additional advantage of external fixation was the possibility of application under local anesthesia for patients who have poor general health...
- 7
- 234
- 0
báo cáo hóa học:" A comparison of two headless compression screws for operative treatment of scaphoid fractures" doc
... Dias JJ, Dhukaram V, Abhinav A, Bhowal B, Wildin CJ: Clinical and radiological outcome of cast immobilization versus surgical treatment of acute scaphoid fractures at a mean follow-up of 93 months ... The Acutrak screw has a head diameter of 4.1 mm and a tip diameter of 4.0 mm The variable thread pitch causes the screw to advance through the two bone fragments at different rates, causing gradual ... reason that the Acutrak screw provided greater final compression than the Synthes system may relate to the thread pattern The Acutrak is a fully threaded design that generates a large amount of...
- 6
- 550
- 0
báo cáo hóa học:" A comparison of two headless compression screws for operative treatment of scaphoid fractures" pdf
... Dias JJ, Dhukaram V, Abhinav A, Bhowal B, Wildin CJ: Clinical and radiological outcome of cast immobilization versus surgical treatment of acute scaphoid fractures at a mean follow-up of 93 months ... The Acutrak screw has a head diameter of 4.1 mm and a tip diameter of 4.0 mm The variable thread pitch causes the screw to advance through the two bone fragments at different rates, causing gradual ... reason that the Acutrak screw provided greater final compression than the Synthes system may relate to the thread pattern The Acutrak is a fully threaded design that generates a large amount of...
- 6
- 403
- 1
Báo cáo lâm nghiệp: "A comparison of two modelling studies of environmental effects on forest carbon stocks across Europe" ppsx
... ha–1 y–1 Albania Austria Belgium Bosnia Bulgaria Belarus Croatia Czech Republic Denmark Estonia Finland France Germany Greece Hungary Iceland Ireland Italy Latvia Lithuania Macedonia Netherlands ... boreal, temperate and Mediterranean average annual temperature anomaly (relative to 1961 to 1990 average) and variation in atmospheric CO2 concentration from EuroBiota input climate data Legend text ... EuroBiota, are shown in Figure Temperature anomalies are actually applied in EuroBiota to the mean 1961 to 1990 daily climatology for each month in each separate 0.5° cell separately An illustration...
- 13
- 327
- 0
Báo cáo lâm nghiệp: "Variation in the composition and content of ellagitannins in the heartwood of European oaks (Quercus robur and Q petraea). A comparison of two French forests and variation with heartwood age" ppt
... estimate of mean heartwood age as a and the mean total ellagitannins found in samples from each forest (table II) as T the concentrations of tannins in the , a oh new, outermost heartwood T can ... is also apparent and the data were log-transformed, resulting in more homogeneous variances A balanced, nested analysis of variance was used to compare the variation between and within trees and ... ellagitannins varied between sites, the percentage of each ellagitannin was calculated in relation to total soluble ellagitan- nins A nested analysis of variance was carried out on arcsine-transformed...
- 14
- 384
- 0
Báo cáo y học: "Comparison of two protective lung ventilatory regimes on oxygenation during one-lung ventilation: a randomized controlled trial" pps
... Esteban A, Anzueto A, Frutos F, Alia A, Brochard L, Stewart TE, Benito S, Epstein SK, Apezteguia C, Nightingale P, Arroglia AC, Tobin MJ, Mechanical Ventilation International Study Group: Characteristics ... the measurement period surgical manipulation of the lung was not allowed A power analysis based on a previous study [15] revealed a total sample size of 38 patients was required to achieve a power ... electrocardiogram and SpO2 A 14-gauge IV catheter was inserted in an upper extremity vein and a 20-gauge catheter was inserted in a radial artery to permit continuous recording of arterial pressure After...
- 5
- 360
- 0
Báo cáo y học: "Comparison of mannitol and methacholine to predict exercise-induced bronchoconstriction and a clinical diagnosis of asthma" pdf
... in escalating doses and a hand-held dry powder inhaler device Safety and efficacy of mannitol as a BPT were established in a large Phase III clinical trial in patients with asthma and in healthy ... results of the methacholine and mannitol tests The information available was likely to be more than most clinicians would have available at assessment and thus as close to a clinical gold standard as ... Medical Group, Inc., CA; Paul Qaqundah, Pediatric Care Medical Group, Inc CA; Javier Quesada, West Coast Clinical Trials, CA; Paul Ratner, Sylvana Research Associates, PA, TX; Kenneth Rundell,...
- 13
- 407
- 0
Báo cáo y học: "Comparison of two percutaneous tracheostomy techniques, guide wire dilating forceps and Ciaglia Blue Rhino: a sequential cohort study" docx
... insertion of a cannula In the CBR group two patients underwent surgical tracheostomy: in one patient the trachea was difficult to locate, and the cannula was placed pretracheally as a result of guide ... intensive care unit should visit patients, discharged to the general ward with a cannula in place, on a daily basis There are only few data available concerning late complications of percutaneous tracheostomy ... of the cannula by a mucous plug, leading to a cardiorespiratory arrest Another patient sustained a cardiorespiratory arrest shortly after decannulation, possibly due to aspiration Both patients...
- 7
- 347
- 0
Báo cáo y học: " Low NO bioavailability in CCl4 cirrhotic rat livers might result from low NO synthesis combined with decreased superoxide dismutase activity allowing superoxide-mediated NO breakdown: A comparison of two portal hypertensive rat models wit
... one-way-analysis of variance in case of normally distributed data with equal variances If other cases, we used analysis of variance-on-ranks, where the sum of ranks of each group was compared ... weight (Table 2) Statistical analysis Data are given as mean (SD) or as median [range] for respectively normally and non-normally distributed data We made comparisons of the groups (normal, PPVL, ... were taken: a lysate of human aorta endothelial cells (Transduction Labs, Lexington, USA) for eNOS; a homogenate of rat brains for nNOS; and a liver of a rat given LPS 800 µg/kg IV (Sigma, St...
- 8
- 216
- 0
Báo cáo y học: " Laypersons can successfully place supraglottic airways with 3 minutes of training. A comparison of four different devices in the manikin." docx
... naùve intubator Br J Anaesth 2000;84:103105 Choyce A, Avidan MS, Shariff A, Del Aguila M, Radcliffe JJ, Chan T A comparison of the intubating and standard laryngeal mask airways for airway management ... (Statistical Solutions, Saugus, MA, USA) Statistical analysis was performed using GraphPad Prism 5.0 for Mac (GraphPad Software, San Diego, CA, USA) Metric scaled data were analyzed calculating ... presented was rotated after every 35 participants to eliminate any bias A resuscitation scenario with a manikin (Ambu Airway Manđ, Ambu GmbH, Bad Nauheim, Germany) laying on the floor was prepared All...
- 23
- 417
- 0
Báo cáo y học: "Changes in 10-12 year old’s fruit and vegetable intake in Norway from 2001 to 2008 in relation to gender and socioeconomic status - a comparison of two cross-sectional groups" pptx
... correlation of this scale was 0.75 [20] The correlation between the scale and a validation method (7 day food diary) was 0.32 in a separate validation study of 85 6th grade pupils, a correlation ... interval FV intake, fruit and vegetable intake EDU high, higher parental education EDU low, lower parental education Hilsen et al International Journal of Behavioral Nutrition and Physical Activity ... +(bmod2*SEamod2)) An examination of the residuals did not reveal unacceptable departures from normality Since interaction terms have less power, p values, as an indicator of the significance, of interaction...
- 8
- 277
- 0
Application and Comparison of Two Biotic Ligand Models Predicting Copper Toxicity and Accumulation in Heavy Metal Tolerant Moss
... photograph was extracted and the brightness was adjusted using a commercial image analysis software (SimpleVmpViewer) The transformed image was binarized, and the area covered by the moss was measured ... photograph of the moss was taken again All incubations were performed under aseptic condition The area covered by the moss was measured by an image analysis Only the saturated portion of the ... model and the accumulation model so far More detailed modeling of the BLM about heavy metal detoxification and conformation change of BL leads to more appropriate prediction of heavy metal toxicity...
- 7
- 432
- 0
Comparison of Two Synthesis Routes to Obtain Gold Nanoparticlesin Polyimide
... [g] NaBH4 [g] was obtained The solutions were then allowed to stand until air bubbles had disappeared and were cast onto a nonwoven support material that had been saturated with DMA An automated ... illuminated surface, also calculating the minor loss of intensity in the laser pathway The laser was set at an intensity of 0.2 W/cm2 Permeances were calculated as the amount of solvent (V) that passed ... ACKNOWLEDGMENT K.V acknowledges the Fund of Scientific Research Flanders (FWO-Vlaanderen) for financial support as a research assistant This research was done in the framework of an I .A. P.-PAI grant (IAP 6/27)...
- 11
- 451
- 0
Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx
... intonation to Vietnamese EFL learners The pronunciation mistakes made by people learning to speak a foreign language are almost always carry-overs from their native languages Through a comparison ... investigation and choice of dialects are presented Part II provides an overview of the tones and intonation of the Vietnamese language This lays the basis for comparing aspects of Vietnamese intonation ... used as the native language and English as the target language The Vietnamese word structure and the Vietnamese tones, intonation Generally, there are two aspects in Vietnamese that make the language...
- 10
- 1,968
- 17
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
... and a sense cDNA probe (complementary to the antisense) for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT ... Natl Acad Sci USA 95, 14220–14225 Ohto H, Kamada S, Tago K, Tominaga S, Ozaki H, Sato S & Kawakami K (1999) Cooperation of Six and Eya in activation of their target genes through nuclear translocation ... genes and connective tissue patterning Development 121, 693–705 16 Ozaki H, Watanabe Y, Takahashi K, Kitamura K, Tanaka A, Urase K, Momoi T, Sudo K, Sakagami J, Asano M et al (2001) Six4, a putative...
- 16
- 476
- 0
Báo cáo khoa học: "A Practical Comparison of Parsing Strategies" docx
... users unfamiliar with the naval domain That i s , the grammarwas attuned to questions posed by knowledgeable users, answerable from the available database The syntactic categories were labelled ... production of a f u l l syntactic and semantic analysis via phrase-structure rules, feature tests and operations, transformations, and case frames I t was known in advance that not all constructions ... combinations of parser and grammar Linguistic Grammar THE LRC EXPERIMENT In terms of the number of grammar rules found applicable by the parsers, DIAMOND instantiated the fewest (averaging 58 phrases...
- 6
- 455
- 0
How do China and Brazil deal with water pollution challenges? A comparative perspective of two emerging countries’ approach to water pollution problems docx
... of water sanitation plans The National Water Supply and Sanitation Plan (Planasa) was institutionalised in 1971 during the military regime to guarantee financial resources transfers to Sanitation ... July 2010] Agencia Nacional de Aguas (ANA) [Online] Available at: http://www.ana.gov.br/prodes/prodes.asp [Accessed at 12 July 2010] Asia News 2010 [Online] Availabe at: http://www.asianews.it/news-en/Ethnic-unrest-in-Guangxiover-water-pollution-by-industrial-plant-18941.html ... production and put at risk sustainable agriculture development (FAO, 1995) Achieving sustainable agriculture and rural development (SARD) in China and Brazil is not an easy task, as the per capita water...
- 36
- 481
- 0
Báo cáo khoa học: Structure and positioning comparison of two variants of penetratin in two different membrane mimicking systems by NMR pdf
... amplitude The remaining amplitude [40], RA, is defined as: RA ¼ N Á Aparamag: A0 where Aparamag is the amplitude of the crosspeak measured when the paramagnetic agent is added and A0 is the amplitude ... Penetratin was added together with the longchained lipids to reach a peptide concentration of mM The pH was checked and adjusted to around 5.5 for each sample and finally, aqueous KCl was added to a ... with no paramagnetic agent present N is a normalizing factor in order to normalize the remaining amplitude so that the least affected crosspeak has a remaining amplitude of 100% Similarly, the...
- 9
- 373
- 0
Báo cáo Y học: Structural study on lipid A and the O-specific polysaccharide of the lipopolysaccharide from a clinical isolate of Bacteroides vulgatus from a patient with Crohn’s disease ppt
... OPS-rich fraction (30%) Mainly two sugars, Rha and Man, were detected in the OPS-rich fraction on analysis of the sugar constituents (Table 1) The approximate molar ratio of Rha to Man was : Absolute ... Science and Culture of Japan (13670289 to T K.), grants and contracts from International Health Cooperation Research Ó FEBS 2002 (1 1A- 1) from the Ministry of Health and Welfare of Japan, and ÔResearch ... is attached at O4 of residue a [26] Residue b was assigned as b-D-mannopyranose (b-D-Manp) The mannopyranosyl Fig 1H (A) and 13C (B) NMR spectra of the OPS-rich fraction configuration was clearly...
- 7
- 437
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu