0

ph 7 5 with inactivated human serum and yeast extract

Báo cáo y học:

Báo cáo y học: "Duodenal enteroglucagonoma revealed by differential comparison of serum and tissue glucagon reactivity with Siemens'''' Double Glucagon Antibody and DakoCytomation''''s Polyclonal Rabbit Anti-Human Glucagon: a case report" ppsx

Báo cáo khoa học

... motility, and absorptive function Gut 1 971 , 12 :77 3 -78 2 11 Doherty GM: Rare endocrine tumours of the GI tract Best Pract Res Clin Gastroenterol 20 05, 19 (5) :8 07- 8 17 doi: 10.1186/ 1 75 2-19 47- 4- 178 Cite ... Enteroglucagonoma Annu Rev Physiol 19 97, 59 :2 57 - 271 Stevens FM, Flanagan RW, O'Gorman D, Buchanan KD: Glucagonoma syndrome demonstrating giant duodenal villi Gut 1984, 25 :78 4 -79 1 10 Gleeson MH, Bloom ... pancreas Best Pract Res Clin Gastroenterol 20 05, 19 (5) : 75 3 -78 1 Roggli VL, Judge DM, McGavran MH: Duodenal glucagonoma: a case report Hum Pathol 1 979 , 10(3): 350 - 353 Mansour JC, Chen H: Pancreatic endocrine...
  • 3
  • 371
  • 0
Lab 9.3.5 Troubleshooting Routing Issues with show ip route and show ip protocols

Lab 9.3.5 Troubleshooting Routing Issues with show ip route and show ip protocols

Quản trị mạng

... ping, check the routing table with the show ip route command From the Gadsden router, type the following: 2-6 CCNA 2: Routers and Routing Basics v 3.0 - Lab 9.3 .5 Copyright  2003, Cisco Systems, ... 2: Routers and Routing Basics v 3.0 - Lab 9.3 .5 Copyright  2003, Cisco Systems, Inc Step 13 Verify connectivity between Gadsden router and host in Birmingham a Use the ping command to verify ... virtual terminal and enable passwords Finally, configure the interfaces on each router Step Configure the routing protocol on the Birmingham router a Go to the proper command mode and enter the...
  • 6
  • 333
  • 1
Lab 9.3.5 Troubleshooting Routing Issues with show ip route and show ip Protocols

Lab 9.3.5 Troubleshooting Routing Issues with show ip route and show ip Protocols

Quản trị mạng

... check the routing table with the show ip route command From the Gadsden router, type the following: GAD#show ip route 2-6 CCNA 2: Routers and Routing Basics v 3.0 - Lab 9.3 .5 Copyright  2003, Cisco ... previous steps, log off by typing exit and turn the router off 4-6 CCNA 2: Routers and Routing Basics v 3.0 - Lab 9.3 .5 Copyright  2003, Cisco Systems, Inc Erasing and reloading the router Enter into ... router and host in Birmingham a Use the ping command to verify connectivity from Gadsden router to a host in Birmingham b From the Gadsden router, type the following: 3-6 CCNA 2: Routers and Routing...
  • 6
  • 419
  • 0
Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx

Tài liệu Báo cáo khoa học: Comparison of membrane fraction proteomic profiles of normal and cancerous human colorectal tissues with gel-assisted digestion and iTRAQ labeling mass spectrometry pptx

Báo cáo khoa học

... 319 T N N D 3 25 T D 306 N B 344 T T N B 3 57 A 352 T D 3 25 N T N B 3 67 T B 355 T N A 361 N T N B 373 N T N B 370 T N B 368 T N N B 378 N B 384 T C 3 85 T N N C 380 T N B 390 T C 3 95 T T C 393 N ... ANXA4 SLC25A4 HLA-A1 SLC25A6 SLC25A5 ATP5H COX7C ATP5F1 MT-ND4 MT-CO2 MT-ND2 COX5B MT-ATP6 COX4l1 CLDN3 MTCH2 ATP1B1 SLC25A24 MT-CO1 ATP2A2 SSR1 ZCD1 NNT SLC25A1 SQRDL MGST3 TAPBP ATP5J2 ATP5L VDAC3 ... 114 1 15 116 1 17 114 1 15 116 1 17 B-1 N B-2 T N D-1 T N T D-2 N T 114 1 15 116 1 17 114 1 15 116 1 17 LC-MS/MS analysis iTRAQ Quantitation by Multi-Q 90 52 Dataset D 27 23 25 9 30 78 Functional classification...
  • 11
  • 590
  • 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Báo cáo khoa học

... laser and a BP5 05 55 0 nm band pass filter for detecting green fluorescence Array hybridizations with cDNA probes The human multiple tissue expression array from Clontech ( #77 75- 1) was hybridized with ... and NF-jB activation Mol Cell Biol 19, 77 59 77 70 38 Breeden L & Nasmyth K (19 85) Regulation of the yeast HO gene Cold Spring Harb Symp Quant Biol 50 , 643– 650 39 Czubaty A, Girstun A, Kowalska-Loth ... SKAR within the RRM (amino acids 277 – 348) and phosphorylates two serines at positions 383 and 3 85 (Fig 2) Interestingly, we have found that the bipartite region of PDIP46 ⁄ SKAR interacting with...
  • 14
  • 517
  • 0
Tài liệu Báo cáo khoa học: Allosteric modulation of myristate and Mn(III)heme binding to human serum albumin Optical and NMR spectroscopy characterization pptx

Tài liệu Báo cáo khoa học: Allosteric modulation of myristate and Mn(III)heme binding to human serum albumin Optical and NMR spectroscopy characterization pptx

Báo cáo khoa học

... 10)6 1 .7 · 10 )5 7. 2 · 10)6 8 .5 · 10)8 3 .7 · 10 )7 5 .7 · 10 )7 1.4 · 10 )7 0.012 0.030 2.8 · 10 )5 1.1 · 10)6 1.3 · 10 )5 7. 9 · 10 )7 9.4 · 10)6 2.6 · 10)6 1.4 · 10 )7 0.0 27 0.028 8.8 · 10)6 fitting models: ... 1 .5 · 10 )5 3.4 · 10 )7 8.2 · 10 )7 3.4 · 10 )7 3.2 · 10 )7 9.2 · 10)8 0.011 0.030 2.9 · 10 )5 1.0 · 10)6 1.1 · 10)6 9.3 · 10)8 1.1 · 10)6 1.2 · 10 )5 9.2 · 10)8 0.0 27 0.028 9.2 · 10)6 1 .7 · 10 )5 7. 2 ... Pharmacol 48, 870 – 8 75 FEBS Journal 272 (20 05) 4 672 –4683 ª 20 05 FEBS Myristate and Mn(III)heme binding to HSA–heme 40 Kragh-Hansen U (1981) Molecular aspects of ligand binding to serum albumin Pharmacol...
  • 12
  • 515
  • 0
Essential Windows Phone 7.5: Application Development with Silverlight docx

Essential Windows Phone 7.5: Application Development with Silverlight docx

Kỹ thuật lập trình

... Properties panel FIGURE 5. 20 Dragging a new control FIGURE 5. 21 Margin and alignment layout FIGURE 5. 22 Column and row gutters 149 150 152 155 155 1 57 158 159 160 160 161 FIGURE 5. 23 Splitting the ... application FIGURE 5. 57 Pivot control user interface FIGURE 5. 58 Editing a PivotItem 184 FIGURE 5. 59 Changing device properties 1 75 1 75 176 177 179 180 181 181 183 183 184 1 85 FIGURE 6.1 Important ... panel 170 171 171 172 172 173 173 174 FIGURE 5. 43 Applying a behavior FIGURE 5. 44 Changing behavior properties FIGURE 5. 45 Multiple behaviors FIGURE 5. 46 ApplicationBar explained FIGURE 5. 47 Adding...
  • 512
  • 5,333
  • 0
Báo cáo khoa học: Ibuprofen binding to secondary sites allosterically modulates the spectroscopic and catalytic properties of human serum heme–albumin doc

Báo cáo khoa học: Ibuprofen binding to secondary sites allosterically modulates the spectroscopic and catalytic properties of human serum heme–albumin doc

Báo cáo khoa học

... HSAheme-Fe(III) (i.e K2 and K3) were obtained spectrophotometrically, at pH 7. 0 (1.0 ã 10)1 m phosphate buffer) and 20.0 C Ibuprofen-dependent absorbance changes were recorded between 350 and 450 nm Small ... (20 05) The extraordinary ligand binding properties of human serum albumin IUBMB Life 57 , 78 779 6 Ghuman J, Zunszain PA, Petitpas I, Bhattacharya AA, Otagiri M & Curry S (20 05) Structural basis of the ... Reactions with Ligands North Holland Publishing Co., Amsterdam and London Goldstein S, Lind J & Merenyi G (20 05) Chemistry of peroxynitrites and peroxynitrates Chem Rev 1 05, 24 57 2 470 Herold...
  • 9
  • 489
  • 0
Báo cáo khoa học: Epoxidation of benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity of the membrane pot

Báo cáo khoa học: Epoxidation of benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity of the membrane pot

Báo cáo khoa học

... nitrogen and resuspended in 1. 25 mL of 50 mM Tris buffer, pH 7. 5, containing 100 mM NaCl and 2% sodium cholate nmol P 450 and 0 .5 nmol human NADPH cytochrome P 450 reductase were added to 250 lL of ... 6.0 7. 5 2 .7 ± ± ± ± ± ± 0.3 4.2 1 .5 2.1 1.6 0.3 0 .5 0.9 0 .7 0.4 2.2 0 .7 ± ± ± ± ± ± 0.1 0.12 0.04 0.03 0.3 0.2 11.4 14.3 5 .7 6 .5 39.9 21.9 ± ± ± ± ± ± 3 .7 3.2 0.9 0.9 8.0 7. 5 1.2 2.8 1.3 0 .7 6.0 ... 7, 8-diol [7] with the following modifications: incubations contained 50 mM Tris/HCl (pH 7. 5) , 100 mM NaCl with either (+)- or (–) -7, 8-diol, and vesicles with pmol CYP1A1 (for (–) -7, 8-diol) and 10...
  • 7
  • 376
  • 0
Báo cáo khoa học: Identification and characterization of oxidized human serum albumin A slight structural change impairs its ligand-binding and antioxidant functions pptx

Báo cáo khoa học: Identification and characterization of oxidized human serum albumin A slight structural change impairs its ligand-binding and antioxidant functions pptx

Báo cáo khoa học

... 1109 856 77 93 8 57 1134 Hcy 851 77 24 851 4382 852 1066 A N H N H N H N (h) H N H 64 (kDa) ALVLIAFQYLQQ34CPFEGHFEDVK B Cys 852 4404 856 1099 856 4443 856 77 82 B 120 C 856 1083 852 854 856 ... 1301 .55 66328.1 )112.2 c d e f 1303 . 75 1306.10 1306. 95 1308.02 66440.3 6 656 0.1 66603.2 66 658 .1 119.8 162.9 2 17. 8 g h i 1309.28 1306.34 1308.26 6 672 2.3 66 57 2 .3 66 670 .3 282.0 132.0 230.0 j 1309 .51 ... HSA Undigested HSA (%) 851 77 14 852 1 052 851 43 65 100 80 60 40 20 n+ molecule [M + nH] was theoretically calculated to be 255 2.2682 (1+), 1286.6380 (2+) and 851 .4 279 (3+), respectively, from...
  • 12
  • 479
  • 0
Báo cáo khoa học: Methylene analogues of adenosine 5¢-tetraphosphate Their chemical synthesis and recognition by human and plant mononucleoside tetraphosphatases and dinucleoside tetraphosphatases pot

Báo cáo khoa học: Methylene analogues of adenosine 5¢-tetraphosphate Their chemical synthesis and recognition by human and plant mononucleoside tetraphosphatases and dinucleoside tetraphosphatases pot

Báo cáo khoa học

... adenosine 5 -tetraphosphate (p4A or ppppA) [1 5] and adenosine 5 -pentaphosphate (p5A or pppppA) [2], and the dinucleoside 5 ,5 ¢¢-P1,Pn-polyphosphates (NpnN¢s, where N and N¢ are 5 -O-nucleosides and ... Identification and characterization of adenosine 5 -tetraphosphate in human myocardial tissue J Biol Chem 278 , 177 35 177 40 Pintor J, Pelaez T & Peral A (2004) Adenosine tetraphosphate, Ap4, a physiological ... contained Hepes ⁄ KOH buffer (pH 8.2) and mm MgCl2, for the human enzyme Hepes ⁄ KOH (pH 7. 0) and mm CoCl2, and for the yeast exopolyphosphatase sodium acetate buffer (pH 4 .7) and mm CoCl2 Incubations...
  • 10
  • 501
  • 0
Báo cáo khoa học: Multiple-probe analysis of folding and unfolding pathways of human serum albumin docx

Báo cáo khoa học: Multiple-probe analysis of folding and unfolding pathways of human serum albumin docx

Báo cáo khoa học

... over the range of 57 5 – 6 75 nm using 55 0 nm as an excitation wavelength Steady-state unfolding of HSA probed by intrinsic tryptophan fluorescence HSA (2 lM) in 25 mM phosphate buffer pH was denatured ... at °C against 25 mM phosphate buffer pH Native or refolded HSA (3 lM) was incubated with different concentrations (0 50 lM) of dicumarol for 30 at 25 °C in 25 mM phosphate buffer pH The binding ... Mol Pharmacol 16, 76 7– 77 7 Kragh-Hansen, U (1988) Evidence for a large and flexible region of human serum albumin possessing high affinity binding sites for salicylate, warfarin, and other ligands...
  • 9
  • 415
  • 0
Essential Windows Phone 7.5: Application Development with Silverlight (Microsoft Windows Development Series) pdf

Essential Windows Phone 7.5: Application Development with Silverlight (Microsoft Windows Development Series) pdf

Hệ điều hành

... application FIGURE 5. 56 A pivot application FIGURE 5. 57 Pivot control user interface FIGURE 5. 58 Editing a PivotItem 184 FIGURE 5. 59 Changing device properties 1 75 1 75 176 177 179 180 180 181 181 ... Properties panel FIGURE 5. 20 Dragging a new control FIGURE 5. 21 Margin and alignment layout FIGURE 5. 22 Column and row gutters 149 150 152 155 155 1 57 158 159 160 160 161 FIGURE 5. 23 Splitting the ... FIGURE 5. 42 Behaviors in the Assets panel 170 171 171 172 172 173 173 174 FIGURE 5. 43 Applying a behavior FIGURE 5. 44 Changing behavior properties FIGURE 5. 45 Multiple behaviors FIGURE 5. 46 ApplicationBar...
  • 89
  • 459
  • 0
Báo cáo khoa học: Allosteric and binding properties of Asp1–Glu382 truncated recombinant human serum albumin – an optical and NMR spectroscopic investigation pot

Báo cáo khoa học: Allosteric and binding properties of Asp1–Glu382 truncated recombinant human serum albumin – an optical and NMR spectroscopic investigation pot

Báo cáo khoa học

... Fe(III)heme–tHSA complex formation, at pH 7. 0 and 25 °C Fig S2 Fe(III)heme binding to tHSA, at pH 7. 0 and 25 °C Fig S3 Drug binding to Fe(III)heme–tHSA, at pH 7. 0 and 25 °C Fig S4 Fe(III)heme binding ... micelles with an extinction coefficient of 14 .5 mm)1 cm)1 (at 53 5 nm) [53 ] The ibuprofen solution was prepared by dissolving the drug in 1.0 · 10)1 m phosphate buffer, at pH 7. 0 and 25. 0 °C The ... magnetic field J Chem Phys 128, 052 3 15, doi: 10.1063/1.28339 57 Sharp RR (2002) Closed-form expressions for level-averaged electron spin relaxation times outside the 2 250 48 49 50 51 52 53 Zeeman Limit:...
  • 10
  • 338
  • 0
Báo cáo khoa học: Modulation of heme and myristate binding to human serum albumin by anti-HIV drugs An optical and NMR spectroscopic study potx

Báo cáo khoa học: Modulation of heme and myristate binding to human serum albumin by anti-HIV drugs An optical and NMR spectroscopic study potx

Báo cáo khoa học

... carbamazepine binding to human serum albumin Modulation of HSA ligand binding by anti-HIV drugs 43 44 45 46 47 48 49 50 51 52 53 54 55 J Chromatogr B Anal Technol Biomed Life Sci 816, 57 66 Darbyshire ... (2002) Practical aspects of the ligand-binding and enzymatic 450 0 17 18 19 20 21 22 23 24 25 26 27 28 properties of human serum albumin Biol Pharm Bull 25, 6 95 70 4 Monzani E, Curto M, Galliano ... the absence and presence of abacavir, nevirapine and atazanavir, at different myristate concentration, pH 7. 0 and 25 °C [Myristate] (M) 1.0 · 10 )5 7. 5 · 10 )5 1.0 · 10)4 a No drug (5. 0 (5. 3 (1.3...
  • 12
  • 348
  • 0
Báo cáo khoa học: Identification and characterization of multiple species of tenascin-X in human serum doc

Báo cáo khoa học: Identification and characterization of multiple species of tenascin-X in human serum doc

Báo cáo khoa học

... 27 32 are compared, however, with antibodies against FNIII29–30 and 27 32 a band migrating at  75 kDa can be distinguished This 75 kDa band is not recognized by the FNIII 27 28 antibody The background ... compilation ª 20 07 FEBS D F Egging et al Multiple species of tenascin-X in human serum Percentage 250 200 * * 150 100 50 0 5 6– 15 16–18 Age (years) >18 Fig TNX levels measured in serum from children ... antibody against FNIII 27 32 has a higher affinity for the 140– 150 kDa species compared with the 75 kDa TNX species Sequence coverage by MS ⁄ MS of the affinity-purified 140– 150 and 75 kDa TNX species...
  • 10
  • 314
  • 0
Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf

Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf

Báo cáo khoa học

... 3. 35 3.43 3.44 2. 97 2 .53 1. 95 2. 25 2.29 2.12 1. 47 2 .55 3 .78 5. 61 5. 05 4.46 3. 57 2. 45 3.68 4. 35 a From [54 ] bFrom [55 ] compounds studied and the tryptophan residue was obtained and the r0, distance ... 3 .76 5. 86 1.64 1. 35 1 .56 1. 57 6 .58 1.32 2 .76 8. 35 9.28 · · · · · · · · · · · 10–14 10–16 10–14 10–13 10–13 10–13 10–14 10–14 10– 15 10) 15 10) 15 Ro (nm) r (nm) 2.08 1 .55 2 .54 3. 35 3.43 3.44 2. 97 ... 1 37 160 Anisotropy values 0.160 0.162 0.1 57 0. 158 0. 158 0. 154 0. 152 0.160 0.162 0. 158 0.1 57 0. 159 0.1 57 0.160 0.149 0.142 0.136 0.1 27 0.120 0.116 0.109 0.0 97 0.092 0.080 Table Corrected fluorescence...
  • 17
  • 457
  • 0
Báo cáo khoa học: Nop53p interacts with 5.8S rRNA co-transcriptionally, and regulates processing of pre-rRNA by the exosome ppt

Báo cáo khoa học: Nop53p interacts with 5.8S rRNA co-transcriptionally, and regulates processing of pre-rRNA by the exosome ppt

Báo cáo khoa học

... NOP53::KANR ⁄ YCpGAL-A-NOP53 NOP53, YCp33GAL-A NOP53, YCp33GAL-A-NOP53 NOP53, YCp33GAL-A-N-NOP53 NOP53, YCp33GAL-A-C-NOP53 Dnop53, YCp33GAL-A-NOP53,pGAD-NOP53 Dnop53,YCp33GAL-A-NOP53,pGAD-N NOP53 ... Camr]* Euroscarf Euroscarf Dnop53 ⁄ GAL:: NOP53 (YDG 151 ) YDG 152 YDG 153 YDG 154 YDG 155 YDG 156 YDG1 57 YDG 158 YDG 159 YDG160 YDG161 DH5a BL21 Codon Plus (DE3) RIL 4 174 [31] [31] [31] This study This ... GTTCGCCTAGACGCTCTCTTC CCTTCTCAAACATTCTGTTTGG [51 ] [52 ] [16] P7 25SFor3 252 25SRev 350 1 18SFor701 18SRevPE SnR37For SnR37Rev SnR74For SnR74Rev Cr.V interg For Cr.V interg Rev 5. 8SFor28 65 5S scR1Rev UC1 ITS2 For 3020...
  • 15
  • 380
  • 0
Báo cáo khoa học: The relationship between thermal stability and pH optimum studied with wild-type and mutant Trichoderma reesei cellobiohydrolase Cel7A ppt

Báo cáo khoa học: The relationship between thermal stability and pH optimum studied with wild-type and mutant Trichoderma reesei cellobiohydrolase Cel7A ppt

Báo cáo khoa học

... Biochem 270 ) 8 47 References Fig The far-UV CD spectra of T reesei wild-type Cel7A and pH mutant E223S/A224H/L225V/T226A/D262G at pH 5. 8 and pH 8.0 and 25 °C Spectra of the wild-type Cel7A at pH 5. 8 ... Cel7A at pH 5. 0 and pH 8.0 measured by tryptophan fluorescence Fluorescence intensity was measured with excitation at 2 85 nm and the two buffers used were 50 mM sodium acetate, pH 5. 0 (d) and 50 ... from 0 .5 to lM Buffers used were 50 mM sodium acetate (pH 3 .5 5. 6), 50 mM potassium phosphate (pH 6–8) and 50 mM Tris/HCl (pH 9.0) CD spectroscopy CD measurements were performed on a Jasco J -72 0...
  • 8
  • 422
  • 0

Xem thêm