Báo cáo khoa học: Nop53p interacts with 5.8S rRNA co-transcriptionally, and regulates processing of pre-rRNA by the exosome ppt

Nop53p interacts with 5.8S rRNA co-transcriptionally, and regulates processing of pre-rRNA by the exosome Daniela C Granato1, Glaucia M Machado-Santelli2 and Carla C Oliveira1 Department of Biochemistry, Institute of Chemistry, University of Sao Paulo, Brazil ˜ Department of Cellular and Development Biology, Institute of Biomedical Sciences, University of Sao Paulo, Brazil ˜ Keywords exosome activation; pre-60S; pre-rRNA processing; protein–RNA interaction; ribosome biogenesis Correspondence C C Oliveira, Department of Biochemistry, Institute of Chemistry, University of Sa ˜o Paulo, Av Prof Lineu Prestes 748, Sao ˜ Paulo, CEP 05508-900, Brazil Fax: +55 11 38155579 Tel: +55 11 30913810 (ext 208) E-mail: ccoliv@iq.usp.br (Received April 2008, revised 22 May 2008, accepted 20 June 2008) doi:10.1111/j.1742-4658.2008.06565.x In eukaryotes, pre-rRNA processing depends on a large number of nonribosomal trans-acting factors that form intriguingly organized complexes One of the early stages of pre-rRNA processing includes formation of the two intermediate complexes pre-40S and pre-60S, which then form the mature ribosome subunits Each of these complexes contains specific prerRNAs, ribosomal proteins and processing factors The yeast nucleolar protein Nop53p has previously been identified in the pre-60S complex and shown to affect pre-rRNA processing by directly binding to 5.8S rRNA, and to interact with Nop17p and Nip7p, which are also involved in this process Here we show that Nop53p binds 5.8S rRNA co-transcriptionally through its N-terminal region, and that this protein portion can also partially complement growth of the conditional mutant strain Dnop53 ⁄ GAL::NOP53 Nop53p interacts with Rrp6p and activates the exosome in vitro These results indicate that Nop53p may recruit the exosome to 7S pre-rRNA for processing Consistent with this observation and similar to the observed in exosome mutants, depletion of Nop53p leads to accumulation of polyadenylated pre-rRNAs Synthesis of mature ribosomal subunits in yeast involves many steps of rRNA processing, directed by at least 180 factors that include proteins and snoRNP complexes The protein factors include rRNA-modifying enzymes, endonucleases, exonucleases, RNA helicases, GTPases and snoRNA-associated proteins [1,2] Three of the rRNAs (18S, 5.8S and 25S) are transcribed as a 35S precursor, which undergoes a series of processing reactions, including endo- and exonucleolytic cleavage and nucleotide modifications Some of the processing factors and ribosomal proteins assemble into the complex early during transcription [3–6], leading to formation of various pre-ribosomal particles, the first of which is the 90S complex [7,8] Most of the factors forming the 90S complex are involved in processing of 18S rRNA, or are part of the 40S ribosome subunits [7,8] Co-purification of proteins and mass spectrometry studies have identified many of the factors involved in rRNA processing, such as the small ribosomal subunit (SSU) complex processome and Dim2p [9,10] The processing factors of the large ribosomal subunit bind later during transcription of the 35S pre-rRNA, or after the early cleavages at sites A0, A1 and A2 that separate the pre-40S and pre-60S complexes [8,11,12], and include some of the large ribosomal subunit proteins, as well as 27S processing factors [11] As some ribosomal proteins bind early during rRNA transcription, they also play an important role in rRNA processing Rpl3p and the IPI complex have recently been shown to be involved in cleavages at ITS2, and their depletion leads to accumulation of the pre-rRNAs 35S and 27S, and a decrease in mature 25S levels [2,9] Abbreviations ETS, external transcribed spacer; IPI, involved in processing of ITS2; ITS2, internal transcribed spacer 2; LSU, large ribosomal subunit; snoRNP, small nucleolar ribonucleoprotein; SSU, small ribosomal subunit; TAP, tandem affinity purification; TEV, tobacco etch virus protein; YNB, yeast minimal synthetic medium 4164 FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS D C Granato et al The exosome is a complex of exoribonucleases that is involved in the late steps of pre-rRNA processing, and is directly responsible for the 3¢ fi 5¢ exonucleolytic digestion of the 3¢ extension of the 7S pre-rRNA and formation of the mature 5.8S rRNA [13] Interestingly, despite being directly involved in the late steps of processing, depletion of essential subunits of the exosome leads to accumulation of the pre-rRNAs 35S, 27S and 7S [13–16] The exosome is also involved in processing of snoRNAs and degradation of defective rRNAs and cytoplasmic mRNAs [17,18] These results indicate that the exosome has two types of substrates, one type that requires maturation through removal of 3¢ extensions, and another type that has not been correctly processed and is going to be subjected to rapid and complete degradation For the exosome to differentiate between these two kinds of substrates, it requires either RNA signals or association with other proteins [19] One of the exosomeinteracting proteins is Rrp47p, which also participates in 3¢ fi 5¢ processing of nuclear stable RNAs [20] The exosome also associates with the TRAMP complex (composed of the factors Trf4p ⁄ Trf5p–Air1p ⁄ Air2p– Mtr4p) that is responsible for the polyadenylation of aberrant RNAs, thereby stimulating exosome activity in vitro and in vivo [21–24] Many other exosome-interacting proteins have been identified in yeast Rrp43p has been reported to interact with Nip7p and Nop17p [25,26] The nuclear Lsm complex has been shown to be a necessary cofactor for 5¢ and 3¢ exoribonucleases involved in the processing of 7S pre-rRNA [27] The Rex complex, formed by the RNase D class of RNases, is also required for 5.8S rRNA maturation [28] In addition, the Ski complex, formed by proteins Ski2p, Skip3p and Ski8p, is an exosome cofactor involved in 3¢ fi 5¢ cytoplasmic mRNA degradation [29,30] Nop53p has been shown to bind 5.8S rRNA, and its depletion leads to accumulation of 7S, a phenotype similar to that caused by the depletion of core exosome subunits [31] Nop53p interacts with the nucleolar proteins Nop17p and Nip7p [31], both of which interact with the exosome and are involved in pre-rRNA processing [25,26] In this study, we demonstrate that Nop53p binds 5.8S rRNA through its N-terminal region, and that Nop53p is recruited to pre-rRNA early during transcription We also show that Nop53p interacts directly with the exosome subunit Rrp6p and with the TRAMP subunit Trf4p, and demonstrate that Nop53p activates the exosome in in vitro RNA degradation assays These results indicate that Nop53p is an exosome regulatory factor Nop53p activates the exosome in vitro Results Nop53p is recruited co-transcriptionally to pre-rRNA Nop53p is a nucleolar protein that has previously been shown to be involved in pre-rRNA processing and to co-immunoprecipitate the 27S and 7S pre-rRNAs and the mature 5.8S rRNA [31–33], and to bind 5.8S rRNA in vitro [31] In order to determine whether Nop53p interacts with the pre-rRNA early during transcription, chromatin immunoprecipitation (ChIP) experiments were performed, using the fusion protein protein A–Nop53p, and protein A as a negative control Immunoprecipitated chromatin was analyzed by PCR reactions using primers complementary to various regions of the rDNA, or to the snR37 (box H ⁄ ACA) and snR74 (box C ⁄ D) snoRNA genes, with the latter being used as controls The results show that protein A–Nop53p immunoprecipitates 5.8S and 25S chromatin and, to a lesser extent, 18S chromatin (Fig 1) In order to verify whether protein A–Nop53p chromatin binding was dependent on active transcription, ChIP was also performed in the presence of RNases A ⁄ T1 The results show that, in the presence of RNases A ⁄ T1, protein A–Nop53p chromatin immunoprecipitation is reduced to the same levels as the control protein A (Fig 1) Further evidence for the Nop53p co-transcriptional interaction with pre-rRNA was obtained by observation of direct interaction between Nop53p and RNA polymerase I transcription factor Rrn3p [34] by protein pull-down (Fig 1E) In these experiments, recombinant GST–Rrn3p pulled down His–Nop53p, whereas GST did not (Fig 1E) These results indicate that Nop53p binds 5.8S rRNA co-transcriptionally, which is in accordance with its nucleolar localization Analysis of Nop53p regions involved in RNA interaction Although Nop53p binds RNA [31], no RNA recognition motif could be identified in its sequence In order to determine the region of Nop53p that is responsible for the interaction with RNA in the pre-60S complex, truncated Nop53p mutants were obtained, which correspond to the breakdown fragments of Nop53p visualized on SDS–PAGE gels (Fig 1) [31], and may contain stable structural domains of the protein Co-immunoprecipitation experiments were then performed using the truncated mutants fused to protein A (A–N-Nop53p and A–C- FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS 4165 Nop53p activates the exosome in vitro D C Granato et al Fig Nop53p immunoprecipitates 5.8S chromatin and interacts with RNA polymerase I A ChIP assay with A–Nop53p or protein was performed, followed by PCR reactions with primers for amplification of various regions of the rDNA and snoRNAs (A) PCR for amplification of 18S and 25S chromatin regions (B) Amplification of 5.8S region using samples from ChIP in the absence (upper panel) or presence (lower panel) of RNases A ⁄ T1 (C) Amplification of snoRNA chromatin For (A)–(C), ‘Int’ represents the intergenic region of chromosome V, used as an internal control; I, input; S, sheared; E, eluted (D) Quantification of the bands obtained in the PCR reactions Values represent the ratio of the rDNA bound to column to the input Bars represent standard deviation (E) Western blot for detection of proteins after pull-down assay Total extracts from cells expressing either GST or GST–Rrn3p (TE1) were incubated with glutathione–Sepharose, the flow-through fraction was collected (FT1), and, after washing, total extracts of cells expressing His–Nop53p (TE2) were loaded The flow-through fraction was collected again (FT2), the resin was washed, and the bound fraction was obtained (B) His–Nop53p is pulled down by GST–Rrn3p, but not by GST His–Nop53p was detected using monoclonal antibody against His GST and GST–Rrn3p were detected using anti-GST serum Bands corresponding to full-length and breakdown products of His–Nop53p are indicated on the right The asterisks indicate a protein present in Escherichia coli extract that runs close to His–Nop53p Nop53p) In these experiments, various salt concentrations were used to analyze the strength of the interaction between truncated Nop53p mutants and the pre-60S complex The protein A–Nop53p fusion efficiently precipitated 27S, 7S and 5.8S rRNAs, even in the presence of 500 mm potassium acetate (Fig 2A), indicating that Nop53p binds stably to the pre-60S complex Although Nop53p precipitates 25S, lower relative amounts of this rRNA were co-precipitated at higher salt concentrations, indicating that Nop53p 4166 binds less efficiently to mature 60S subunits, which is also consistent with its nucleolar localization The truncated Nop53p mutant fusion A–N-Nop53p (N-terminal portion of Nop53p) also precipitates pre-60S rRNAs, but much less efficiently than the full-length protein, and only in the presence of up to 300 mm potassium acetate (Fig 2A) Interestingly, the A–C-Nop53p fusion (C-terminal portion of Nop53p) co-purifies 27S, 25S, 7S and 5.8S rRNAs more efficiently than the N-terminal portion of Nop53p FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS D C Granato et al Nop53p activates the exosome in vitro Fig Truncated mutants of Nop53p still associate with pre-60S (A) Co-immunoprecipitation of RNA with full-length or truncated Nop53 Northern blot hybridization of RNA co-immunoprecipitated with protein A–Nop53p, protein A–N-Nop53p or protein A–C-Nop53p Probes used were specific against rRNAs or scR1 (internal control) (B) Western blot of the proteins obtained from the same experiments, detected using anti-mouse IgG (Fig 2A) A–C-Nop53p co-precipitates 27S pre-rRNA even in the presence of 500 mm potassium acetate, indicating that the C-terminal portion of Nop53p is stably bound to pre-rRNP complexes A western blot of bound fractions from the same experiments showed that protein A fusions bound efficiently to the columns under all conditions used (Fig 2B), showing that the differences in efficiency of rRNA precipitation between truncated Nop53p mutants are due to different stabilities of interaction with the pre-60S complex and not inefficient binding to the column In order to determine whether the Nop53p truncated mutants also bind RNA directly, in vitro RNA binding assays were performed In these experiments, full-length Nop53p bound RNAs corresponding to various fragments of pre-rRNA (Fig 3A) Although Nop53p specifically co-immunprecipitates pre-60S chromatin (Fig 1) and rRNAs (Fig 2) [31], Nop53p did not show a clear sequence specificity for binding in these in vitro RNA binding assays Interestingly, however, all the rRNAs regions tested were AU-rich and predicted to form secondary structures N-Nop53p also bound RNA, although not as efficiently as the full-length protein (Fig 3A) C-Nop53p, on the other hand, did not bind RNA in vitro, showing the same result as the negative control GST (Fig 3A) We therefore conclude that Nop53p binds RNA through its N-terminal region and has affinity for AU-rich and structured RNAs In the pre-60S complex, Nop53p binding to rRNA might be more specific and stabilized by protein–protein interactions with its C-terminal portion In order to analyze the affinity of Nop53p for AU-rich RNA sequences in more detail, in vitro RNA binding assays were performed using RNA oligonucleotides Full-length Nop53p bound poly-rU and poly-rAU oligomers, but not poly-rC (Fig 3B), corroborating the results described above In these experiments, 5.8S rRNA was used as a positive control for Nop53p interaction In summary, although no sequence specificity was detected in these in vitro assays, Nop53p showed higher affinity for U- and AU-rich sequences Truncated Nop53p mutants still localize to the nucleolus Although Nop53p is a nucleolar protein, no nuclear localization signal could be detected in its sequence In FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS 4167 Nop53p activates the exosome in vitro D C Granato et al Fig RNA binding assay with truncated Nop53p mutants (A) Radioactively labeled in vitro transcribed fragments of rRNA were incubated with 10 pmol of full-length Nop53p, or the truncated forms GST–NNop53p or GST–C-Nop53p, or with GST RNA–protein complexes were analyzed by native gel electrophoresis and visualized by phosphorimaging Lanes 1, 6, 11 and 16, RNAs incubated with full-length Nop53p; lanes 2, 7, 12 and 17, RNAs incubated with GST–C-Nop53p; lanes 3, 8, 13 and 18, RNAs incubated with GST–N-Nop53p; lanes 4, 9, 14 and 19, RNAs incubated with GST; lanes 5, 10, 15 and 20, free RNA (B) Nop53p shows a preference for U-rich sequences Increasing amounts of Nop53p were incubated with various RNA oligonucleotides Free RNA and RNA–protein complexes (RNP) are indicated on the right No protein was added in lanes 1, 5, and 13 order to identify the portion of Nop53p that is responsible for its subcellular localization, the truncated mutants of the protein were fused to a GFP tag (GFP–N-Nop53p and GFP–C-Nop53p) Confocal images of split fluorescence channels showed the same pattern of localization for RFP–Nop1p and GFP–NNop53p and GFP–C-Nop53p Interestingly, although GFP–C-Nop53p is concentrated in the nucleolus, it can also be visualized throughout the nucleus The co-localization of GFP–Nop53p truncated mutants and RFP–Nop1p was confirmed by fluorescence profiles in several cell images (Fig 4A,B) These results indicate that protein interactions might be responsible for directing Nop53p to the nucleus and for its concentration in the nucleolus 4168 The N-terminal half of Nop53p complements a conditional mutant strain As shown above, the N-terminal portion of Nop53p binds 5.8S rRNA directly and is concentrated in the nucleolus, whereas the C-terminal portion of Nop53p might interact with the proteins in the pre-60S complex, but is less concentrated in the nucleolus These results raised the question of whether any of the truncated mutants of Nop53p, when under control of a constitutive promoter, could complement the growth of the conditional strain Dnop53 ⁄ GAL::A-NOP53 in glucose medium Interestingly, N-Nop53p partially complements growth of the conditional strain (Fig 5A) When pre-rRNA processing was analyzed in these FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS D C Granato et al Nop53p activates the exosome in vitro Fig Subcellular localization and protein interaction of the Nop53p N- and C-terminal fragments Yeast strain NOP53 expressing GFP–NNop53p and RFP–Nop1p (A) or GFP–C-Nop53p and RFP–Nop1p (B) was analyzed by laser scanning confocal microscopy Each channel labeling is shown separately and merged in the lower right panels The upper panels show representative profiles of green and red fluorescence, indicating RFP–Nop1p (red line) and GFP–N-Nop53p (green line) or GFP–C-Nop53p (green line) co-localization transformants, it was possible to see that, although 27S pre-rRNA and 25S rRNA levels in the strains Dnop53 ⁄ GAL::A-NOP53 expressing either N-Nop53p or C-Nop53p were very similar to those of the control strain Dnop53 ⁄ GAL::A-NOP53 ⁄ pGAD, expression of N-Nop53p led to lower accumulation of the 7S pre-rRNA intermediate (Fig 5B) The strain expressing C-Nop53p showed higher levels of 7S pre-rRNA and lower levels of the mature 5.8S rRNA (Fig 5B) Quantification of 7S ⁄ 5.8S ratio in these strains showed that N-Nop53p partially complements the function of the Dnop53 ⁄ GAL::A-NOP53 strain (Fig 5C) These results indicate that direct binding to 5.8S rRNA is important for Nop53p function Dnop53::GAL-NOP53 accumulates polyadenylated forms of pre-rRNA Nop53p affects pre-rRNA processing, and its depletion leads to the accumulation of 27S and 7S pre-rRNAs, which are degraded from the 5¢ end [31] Therefore, cells depleted of Nop53p show similar phenotypes to exosome mutants, indicating that unprocessed rRNA intermediates may accumulate in a polyadenylated form in the Dnop53::GAL-NOP53 strain, as demonstrated for Drrp6 mutants [35,36] In order to analyze the polyadenylation of rRNA processing intermediates in the Dnop53::GAL-NOP53 strain, total RNA was extracted after 12 h of Nop53p depletion, and poly-A RNA was isolated using oligo(dT) cellulose columns Analysis of the purified poly-A RNA demonstrated that 27S and 7S pre-rRNAs accumulated in the polyadenylated form in Dnop53::GAL-NOP53 (Fig 6A), indicating that these RNAs are not efficiently processed or degraded by the exosome in the absence of Nop53p In order to determine whether the effect of Nop53p depletion on 5.8S processing by the exosome was indirect, or whether it involved direct exosome binding, protein interaction experiments were performed We FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS 4169 Nop53p activates the exosome in vitro D C Granato et al Fig Analysis of complementation of Dnop53 ⁄ GAL::A-NOP53 by truncated mutants of Nop53p (A) Analysis of complementation of strain Dnop53 ⁄ GAL::A-NOP53 by truncated Nop53p mutants, under the control of a constitutive promoter, by growth in glucose medium N-Nop53p partially complements growth on glucose plates (B) rRNA processing was analyzed in yeast strains Dnop53 ⁄ GAL::A-NOP53 expressing either Nop53p, N-Nop53p or C-Nop53p by Northern blot hybridization with probes against rRNAs, indicated on the right (C) Quantification of the 7S ⁄ 5.8S rRNA ratio, showing the efficiency of 5.8S rRNA maturation in cells expressing the truncated forms of Nop53p have previously tried to identify interactions between Nop53p and the exosome subunits using the twohybrid system, but no positive interaction was detected [31] Therefore, we tested the interaction between Nop53p and some of the exosome subunits using GST pull-down assays In these experiments, we detected a specific interaction between the recombinant proteins His–Nop53p and GST–Rrp6p (Fig 6B) Control experiments with GST–Mtr3p showed that His– Nop53p does not interact with this other exosome subunit, nor does it interact with GST, which was used as a negative control (Fig 6B) Despite the higher level of GST expression compared to GST–Rrp6p or to GST– Mtr3p, His–Nop53p was only pulled down by GST– Rrp6p, confirming the specificity of this interaction These results led to the conclusion that, by binding to the 5.8S rRNA and through its interaction with Rrp6p, Nop53p may direct the exosome to the 7S intermediate for processing The TRAMP complex has been shown to be responsible for polyadenylation of the RNAs that are substrates for degradation by the exosome [22] As depletion of Nop53p leads to the accumulation of polyadenylated pre-rRNAs, this raises the question of whether Nop53p also interacts with TRAMP subunits 4170 The TRAMP subunit Trf4p was therefore fused to GST, expressed in Escherichia coli, and its interaction with Nop53p tested through GST pull-down The results show that GST–Trf4p pulls down His–Nop53p, but the negative control GST does not (Fig 6C) These results indicate that Nop53p not only interacts with the exosome, but also with the TRAMP complex, corroborating the view that it is a regulatory factor for processing of 7S pre-rRNA Nop53p activates the exosome RNase activity in vitro In order to test whether the Nop53p–Rrp6p interaction is important for control of exosome function, in vitro RNA degradation assays were performed Yeast exosome was isolated by tandem affinity purification (TAP)–Rrp43p purification and was incubated with a substrate RNA for in vitro RNA degradation, in the presence of Nop53p or BSA, the latter being used as a negative control (Fig 7A) The results show that TAP–Rrp43p exosome degrades an in vitro transcribed RNA corresponding to a region of ITS2, a natural exosome substrate during rRNA maturation (Fig 7A; lane 2) Upon incubation of the substrate RNA with FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS D C Granato et al Nop53p activates the exosome in vitro Fig Analysis of rRNA polyadenylation in the strain Dnop53 ⁄ GAL::A-NOP53 and interaction with the exosome (A) Total RNA was isolated from strains NOP53 and Dnop53 ⁄ GAL::A-NOP53, and run through oligo(dT)–Sepharose columns Polyadenylated RNAs were analyzed by Northern blot hybridization against probes specific for rRNAs I, input; FT, flow-through; EL, eluted polyadenylated RNA (B, C) Western blot for detection of proteins after pull-down assay (B) Total extract from Escherichia coli cells expressing either GST, GST–Rrp6p or GST– Mtr3p (TE1) was incubated with glutathione–Sepharose resin, the flow-through fraction was collected (FT1), and, after washing, the total extract of cells expressing His– Nop53p (TE2) was loaded The flow-through fraction was collected again (FT2), the resin was washed (not shown), and bound fraction was obtained (B) His–Nop53p is pulled down by GST–Rrp6p His–Nop53p was detected using antibody against His GST, GST–Rrp6p and GST–Mtr3p were detected using anti-GST serum Bands corresponding to full-length and breakdown products of fusion proteins are indicated on the right (C) Same procedure as in (B), but with total extract from E coli cells expressing either GST or GST–Trf4p (TE1), or expressing His– Nop53p (TE2) His–Nop53p is pulled down by GST–Trf4p the TAP–Rrp43p complex, there is a 20% decrease in the intensity of the substrate band and a corresponding increase in the intensity of faster-migrating bands that correspond to degradation products (Fig 7A; lane 2) Although Nop53p does not degrade the RNA by itself (Fig 7A; lane 10), addition of 10 pmol Nop53p to the reaction containing the TAP–Rrp43p complex increases the RNase activity of the exosome by 16% (Fig 7A; lane 7) Addition of 20 and 30 pmol Nop53p further increased the RNase activity of the exosome by 27% and 42%, respectively (Fig 7A; lanes and 9) Addition of BSA to the reaction had no effect (Fig 7A; lanes 2–6) Control experiments with TAP– Nop58p-purified box C ⁄ D snoRNP complex showed no degradation of the RNA, as expected (Fig 7A; lanes 11–16) FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS 4171 Nop53p activates the exosome in vitro D C Granato et al with the exosome (Fig 7B) His–Nop53p was also co-purified with TAP–Nop58p, although in much lower levels, probably due to the interaction between Nop53p and the box C ⁄ D assembly factor Nop17p [31] These results strongly indicate that Nop53p is an exosome cofactor, stimulating the RNase activity of the complex Discussion Fig Effect of Nop53p on RNA degradation by the exosome In vitro RNA degradation assay to test the effect of Nop53p on exosome RNase activity (A) A radioactively labeled RNA oligo corresponding to the 5¢ region of the rRNA spacer ITS2 was incubated with 100 ng of the exosome complex isolated using TAP–Rrp43p, or with 100 ng of box C ⁄ D snoRNP isolated using TAP–Nop58p, and 10, 20 or 30 pmol of His–Nop53p or BSA Reaction mixtures were incubated for h at 30 °C, and the products were analyzed by denaturing acrylamide gel electrophoresis The main degradation products generated by the exosome complex are indicated (B) Analysis of protein complexes recovered through TAP purification TAP–Nop58p co-purified Nop1p and TAP–Rrp43p co-purified Mtr3p, indicating that the box C ⁄ D snoRNP and exosome complexes, respectively, were intact Both complexes co-purified His–Nop53p in the pull-down assay, although Nop53p interaction with the exosome was much stronger The recovery of TAP-purified complexes was analyzed by the detection of other subunits of the exosome and box C ⁄ D snoRNP by western blotting (Fig 7B) TAP–Nop58p co-purified endogenous Nop1p and TAP–Rrp43p co-purified Mtr3p, indicating that the box C ⁄ D snoRNP and exosome complexes, respectively, were recovered In addition, incubation of TAP complexes with His–Nop53p from E coli extracts showed that His–Nop53p is recovered with TAP– Rrp43p, further confirming the interaction of Nop53p 4172 We used in vivo and in vitro approaches to characterize the role that Nop53p plays in rRNA processing in yeast It had previously been demonstrated that Nop53p binds 5.8S rRNA and participates in the late steps of maturation of the large ribosomal subunit RNAs [31–33], and here we show that the role played by Nop53p involves protein–protein and protein–RNA interactions Nop53p co-precipitates 5.8S and 25S chromatin and, to a lower extent, 18S chromatin, which indicates that it binds pre-rRNA co-transcriptionally Nop53p recruitment to rDNA chromatin is dependent on active transcription, as no precipitation of chromatin above background level was obtained with A-Nop53p after treatment with RNases We also show here that Nop53p interacts directly with RNA polymerase I transcription factor Rrn3p [34] These data indicate that, although Nop53p is present in the pre-60S complex [1,11] and affects 7S pre-rRNA processing by the exosome [31], it binds 5.8S rRNA co-transcriptionally Other protein complexes have been shown to interact with transcription factors and also influence pre-rRNA processing, including the CURI complex formed by CK2, Utp21, Rrp7p and Ifh1p, which is proposed to couple rRNA and ribosomal protein transcription [37] Some of the U3 snoRNP protein subunits (Utp) have also been shown to bind rRNA early during transcription and to participate in rRNA processing [4,5,7] SSU processome factors, mainly involved in processing of the 18S rRNA, bind the precursor rRNA co-transcriptionally [4] Later during processing, factors involved in the maturation of 27S pre-rRNA assemble onto the RNA, forming the large ribosomal subunit (LSU) complex [8,38] Nop53p may participate in formation of the LSU knob, and as it is present in the gradient fractions that contain LSU pre-rRNAs, it may remain bound to the 5.8S rRNA during its processing [32] The nucleolar localization of Nop53p seems to be the result of protein–protein interactions, as no nuclear localization signal could be identified in the Nop53p sequence and truncated versions of this protein still localize to the nucleolus We have shown that Nop53p interacts with various nuclear proteins – Nop17p, FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS D C Granato et al Nip7p, Rrn3p, Rrp6p and Trf4p (Figs and 6) [31] Identification of these protein interactions indicates that one of these factors, or the whole complex, might be responsible for directing Nop53p to the nucleolus A recent example of an rRNA processing factor that is dependent on protein interaction for its subcellular localization is human hRrp47p, an exosome cofactor, which was shown to depend on its interaction with the exosome subunit PM ⁄ Scl_100 (an Rrp6p ortholog) for direction to the nucleus [39] Interestingly, the Nop53p C-terminal region co-immunoprecipitates the pre-60S complex more efficiently than the N-terminal portion of the protein The Nop53p N-terminal region, on the other hand, is involved in RNA interaction and can partially complement the conditional strain Dnop53 ⁄ GAL::NOP53 in glucose medium These results indicate that interaction with RNA is responsible for Nop53p molecular function in 27S and 7S pre-rRNA processing, and that this interaction may be stabilized in the pre-60S complex through protein interaction with the C-terminal portion of Nop53p Similarly, the ribosomal protein Rpl25p affects processing of 27S pre-rRNA and has three functional domains for nuclear import, RNA binding and 60S subunit assembly [40] Mutations of each of these domains result in defective ITS2 processing and accumulation of pre-rRNA 27S, indicating that assembly of Rpl25p is necessary but not sufficient for processing [40] Despite not having a canonical RNA-binding motif, Nop53p binds RNA, but does not show strict RNA sequence specificity in in vitro RNA binding experiments Similarly, Nop9p, another example of an RNA-binding protein involved in pre-rRNA processing, associates with 20S pre-rRNA but does not show sequence specificity for in vitro binding [41] Depletion of Nop53p leads to accumulation of the 7S pre-rRNA and polyadenylated RNAs, a phenotype very similar to that resulting from depletion of exosome subunits The results shown here indicate that Nop53p function is directly related to the interaction with 5.8S rRNA and the exosome in the pre-60S complex In this context, Nop53p could be responsible for directing the exosome to 7S pre-rRNA, thereby regulating the function of the complex In the absence of Nop53p, the exosome is not efficiently directed to the 7S pre-rRNA for processing, leading to the accumulation of its polyadenylated form As RNAs polyadenylated by the TRAMP complex are targeted for degradation by the exosome [22], polyadenylated 7S was expected to be degraded in strain Dnop53 ⁄ GAL::A-NOP53 However, polyadenylated 7S pre-RNA accumulates in this strain and appears to be degraded in the 5¢ fi 3¢ direction Nop53p activates the exosome in vitro [31], leading to the conclusion that Nop53p is an exosome cofactor Accordingly, in vitro RNA degradation assays with the exosome complex isolated using TAP–Rrp43p showed that, although Nop53p does not degrade RNA by itself, its presence stimulates the RNase activity of the exosome It is possible that the stimulation of the exosome activity is due to recruitment of the complex to the substrate via Nop53p–Rrp6p interaction, or through TRAMP recruitment Interestingly, Nop53p has also been identified as interacting with components of the TRAMP complex [42], corroborating the results shown here A similar role is seen for another RNAbinding protein, of the Nrd1 complex, which can direct the exosome to specific RNA substrates and stimulate exosome degradation of substrates [43] We can conclude that Nop53p must play an important role in exosome activity In summary, we show here that Nop53p binds 5.8S rRNA co-transcriptionally through its N-terminal portion and may interact with other pre-60S processing factors through its C-terminal portion As depletion of Nop53p leads to accumulation of polyadenylated 7S pre-rRNA, and as Nop53p interacts with the exosome subunit Rrp6p and activates the RNase activity of the complex in vitro, Nop53p may be involved in recruitment of the exosome to the 7S pre-rRNA for processing and formation of the mature 5.8S rRNA Experimental procedures Plasmid construction The plasmids used in this study are listed in Table and cloning procedures are summarized below DNA fragments of NOP53 coding for the N-terminal (amino acids 1–210) and C-terminal (amino acids 210–456) portions of the protein were PCR-amplified from Saccharomyces cerevisiae genomic DNA and cloned into vectors pBTM or pGADC2 for two-hybrid analyses and into YCplac33GAL-A, fused to the protein A tag, under the control of the GAL1 promoter [31] Subsequently, the fragments coding for the N- and C-terminal regions of NOP53 were subcloned into pGEX (GE Healthcare, Piscataway, NJ, USA), using the restriction sites BamHI ⁄ SalI and EcoRI ⁄ PstI, respectively, generating vectors pGEX-N-NOP53 and pGEX-C-NOP53 Plasmids pGAD-N-NOP53 and pGAD-C-NOP53, containing NOP53 truncation mutants under the control of the constitutive ADH1 promoter, were also used for complementation analysis of conditional strain Dnop53 ⁄ GAL:: NOP53 The plasmids pYCplac33GAL-A-NOP53, pET28NOP53, pGADC2-NOP53 and pGEM-5.8S have been described previously [31] FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS 4173 Nop53p activates the exosome in vitro D C Granato et al Table Plasmids used in this study Plasmids Relevant characteristics Reference pGADC2 GAL4 activation domain, LEU2 lm GAL4::NOP53, LEU2 lm GAL4::N-NOP53, LEU2 lm GAL4::C-NOP53, LEU2 lm GAL1::ProtA, URA3, CEN4 GAL1::ProtA-NOP53, URA3,CEN4 GAL1::ProtA-N-NOP53, URA3, CEN4 GAL1::ProtA-C-NOP53, URA3, CEN4 MET25::GFP, URA3, CEN6 MET25::GFP-N-NOP53, URA3, CEN6 MET25::GFP-C-NOP53, URA3, CEN6 ADH1::RFP-NOP1, LEU2 lm His::NOP53, KanR GST::N-NOP53, AmpR GST::C-NOP53, AmpR GST::RRN3, AmpR GST::RRP6, AmpR GST::MTR3, AmpR GST::TRF4, AmpR [44] pGAD-NOP53 pGAD-N-NOP53 pGAD-C-NOP53 YCplac33GAL-A YCp33GAL-ANOP53 YCp33GAL-A-NNOP53 YCp33GAL-A-CNOP53 pGFP-N-FUS pGFP-N-NOP53 pGFP-C-NOP53 pRFP-NOP1 pET-NOP53 pGEX-N-NOP53 pGEX-C-NOP53 pGEX-RRN3 pGEX-RRP6 pGEX-MTR3 pGEX-TRF4 [31] This study This study [31] [31] This study This study [45] This study This study [26] [31] This This This This [46] This study study study study study Maintenance and handling of E coli and yeast strain Escherichia coli strains DH5a and BL21(DE3) were maintained in LB medium and manipulated according to standard techniques [47] The yeast strains used in this work, with a brief description of the relevant genetic markers, are shown in Table Growth and handling of S cere- visiae strains were performed as previously described [49] Carbon source-conditional strains were incubated in YP medium containing 2% galactose, and transferred to 2% glucose for the indicated periods of time Yeast strains were transformed using the lithium acetate method [49] Protein pull-down and immunoblot assays Protein A pull-down assays were performed using extracts from 500 mL yeast cultures grown to an attenuance at 600 nm of 1.3–1.5 at 30 °C in yeast minimal synthetic medium (YNB)-Gal and the required supplements Yeast whole-cell extracts were prepared by suspending cells in mL of ice-cold buffer A (20 mm Tris ⁄ HCl pH 8.0, mm magnesium acetate, 150 mm potassium acetate, 0.2% v ⁄ v Triton X-100, mm dithiothreitol, mm phenylmethanesulfonyl fluoride) Cells were disrupted by vortexing with volume of glass beads and the extracts cleared by centrifugation at 16 000 g for 30 at °C [31] Extracts containing protein A fusion proteins were incubated with 200 lL of IgG–Sepharose beads (GE Healthcare) for h at °C The IgG–Sepharose beads were extensively washed with ice-cold buffer A, and bound proteins were suspended in 80 lL of SDS–PAGE sample buffer A similar procedure was used for protein A–N-Nop53p and protein A–CNop53p domain co-immunoprecipitation assays, except that the potassium acetate concentration was raised from 150 to 500 mm during incubation with IgG–Sepharose beads and washing of the beads, Samples were fractionated by SDS– PAGE followed by immunoblot analyses with anti-mouse IgG (GE Healthcare) Pull-down of His–Nop53p was assayed as follows: whole-cell extracts from E coli cells expressing either GST, GST–Rrn3p or GST–Trf4p were generated in low-salt buffer (20 mm Tris ⁄ HCl pH 8.0, mm magnesium acetate, 50 mm potassium acetate, 0.1% v ⁄ v Triton X-100, mm dithiothreitol, mm phenyl- Table Yeast and bacteria strains used in this study Strain Relevant characteristics Reference NOP53 Nop53 ⁄ Dnop53 2n 2n MATa, his3D1 leu2D0, lys2D0 ura3D0 met15D0 MATa ⁄ a, his3D1 ⁄ his3D1 leu2D0 ⁄ leu2D0 lys2D0 ⁄ LYS2 ura3D0 ⁄ ura3D0 MET15 ⁄ met15D0 NOP53 ⁄ NOP53::KANR MET15 his3D1 leu2D0 ura3D0 NOP53::KANR ⁄ YCpGAL-A-NOP53 NOP53, YCp33GAL-A NOP53, YCp33GAL-A-NOP53 NOP53, YCp33GAL-A-N-NOP53 NOP53, YCp33GAL-A-C-NOP53 Dnop53, YCp33GAL-A-NOP53,pGAD-NOP53 Dnop53,YCp33GAL-A-NOP53,pGAD-N NOP53 Dnop53,YCp33GAL-A-NOP53,pGAD-C-NOP53 Dnop53, YCp33GAL-A-NOP53,pGADC2 NOP53, pGFP-N-NOP53,pRFP-NOP1 NOP53, pGFP-C-NOP53,pRFP-NOP1 supE44 DlacU169 (/80 lacZDM15) hsdR17 recA1 endA1 gyrA96 thi1 relA1 E coli B F– ompT hsdS(rB– mB–) dcm+ Tetr gal l (DE3) endA Hte [argU ileY leuW Camr]* Euroscarf Euroscarf Dnop53 ⁄ GAL:: NOP53 (YDG151) YDG152 YDG153 YDG154 YDG155 YDG156 YDG157 YDG158 YDG159 YDG160 YDG161 DH5a BL21 Codon Plus (DE3) RIL 4174 [31] [31] [31] This study This study This study This study This study This study This study This study [48] Stratagene FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS D C Granato et al methanesulfonyl fluoride) and mixed with 500 lL of glutathione–Sepharose beads (GE Healthcare) After washing bound material with the same buffer, whole-cell extracts from E coli cells expressing His–Nop53p were added to the glutathione–Sepharose beads and incubated at °C for h The glutathione–Sepharose beads were precipitated and washed again with the low-salt buffer, and bound proteins were eluted and resolved on SDS–PAGE, and transferred to poly(vinylidene) difluoride (PVDF) membranes (Bio-Rad Laboratories, Hercules, CA, USA), which were incubated with anti-(poly histidine) serum (GE Healthcare) or antiGST serum (Sigma, St Louis, MO, USA) The immunoblots were developed using the enhanced chemiluminescence system (GE Healthcare) The purification of complexes using TAP–Rrp43p and TAP–Nop58p was performed as described previously [50], with some modifications Yeast cells expressing TAP– Rrp43p or TAP–Nop58p were grown in L of yeast complete medium containing glucose Isolation of the complexes was performed by incubating the total yeast extracts for h at °C with IgG–Sepharose beads (GE Healthcare), followed by extensive washing with TMN buffer [10 mm Tris pH 7.6, 100 mm NaCl, mm MgCl2, 0.1% Nonidet P40 (Sigma-Aldrich), mm dithiothreitol, mm phenylmethanesulfonyl fluoride] The exosome and box C ⁄ D snoRNP complexes were eluted from the beads by incubating the resin with 20 U of tobacco etch virus (TEV) protease for 18 h Pull-down of His–Nop53p using TAP complexes was performed by incubating the TAP–Rrp43p or TAP–Nop58p total yeast extracts with IgG–Sepharose beads as described above The resin was then washed and total extract of E coli cells expressing His–Nop53p was added and incubated for h at °C, followed by extensive washing with low-salt buffer The bound proteins were eluted with 20 U of TEV protease for 18 h Recombinant His–Nop53p, GST–N-Nop53p and GST–C-Nop53p expression and purification Extracts for GST pull-down assays were prepared as follows E coli BL21(DE3) cells harboring plasmids encoding either test proteins or control proteins were incubated in 500 mL LB medium containing 100 lgỈmL)1 ampicillin At an attenuance at 600 nm of approximately 0.8, 0.5 mm isopropyl thio-b-d-galactoside (IPTG) was added and the cultures were transferred to 37 °C for h (pGEX-NNOP53) or h (pGEX-C-NOP53) Cells were harvested by centrifugation at 3700 g for 20 at 4°C, and suspended in Tris ⁄ NaCl buffer (50 mm Tris ⁄ HCl pH 8.0, 150 mm NaCl, mm dithiothreitol, mm phenylmethanesulfonyl fluoride, 0.5% v ⁄ v Nonidet P40) The cell suspension was lysed in French press, and the extracts were cleared by centrifugation at 16 000 g for 60 at °C The supernatant was incubated with 100 lL glutathione–Sepharose beads Nop53p activates the exosome in vitro (GE Healthcare) for h at °C After extensive washing with the binding buffer, proteins were eluted from the glutathione–Sepharose beads using Tris ⁄ NaCl buffer containing 20 mm glutathione E coli BL21(DE3) harboring plasmid pET28-NOP53 was incubated in LB medium containing 100 lgỈmL)1 kanamycin at 37 °C At an attenuance at 600 nm of approximately 0.8, 0.5 mm IPTG was added and the culture was transferred to 30 °C for h Cells were harvested by centrifugation at 3700 g for 20 at °C and suspended in buffer containing 50 mm Tris ⁄ HCl pH 8.0, 50 mm NaCl, mm phenylmethanesulfonyl fluoride Cell extracts were prepared as described above for GST-fused proteins, and soluble material was incubated using Q–Sepharose beads (GE Healthcare) His–Nop53p was further purified by incubating the flow through from the Q–Sepharose with Ni-NTA beads (Qiagen, Valencia, CA, USA) for h at °C, followed by chromatography on a heparin–Sepharose column (GE Healthcare), using the same buffer as above for binding and a KCl gradient (50 mm to m) for elution Subcellular localization of Nop53p The subcellular localization of Nop53p truncation mutants was analyzed by monitoring the fluorescence signal produced by a GFP fusion to the N- and C-terminal portions of Nop53p The subcellular localization of Nop1p was analyzed by monitoring fluorescence of RFP fused to the N-terminus of Nop1p GFP–N-Nop53p, GFP–C-Nop53p and RFP–Nop1p proteins were expressed in strain NOP53, transformed with plasmid vector pGFP-C-FUS [45] containing the respective genes, and pRFP-NOP1, as previously described [31] Cells were mounted on polylysinecoated slides and observed using a laser scanning confocal microscope (LSM510; Zeiss, Jena, Germany) The fluorescent images were obtained by confocal laser scanning using argon (458, 488 and 514 nm), helium–neon (543 nm) and helium–neon (633 nm) lasers connected to an inverted fluorescence microscope (Zeiss Axiovert 100M) The profile module of the LSM510 software was used to analyze the green and red fluorescence co-localization Co-immunoprecipitation of RNAs Whole-cell extracts of yeast strains W303 ⁄ YCp33-GAL::A, DNOP53 ⁄ YCp33-GAL::A-NOP53, NOP53 ⁄ YCp33-GAL:: A-NOP53-N, NOP53 ⁄ YCp33-GAL::A-NOP53-C were prepared as described above, and protein A-tagged Nop53p (A–Nop53p) was isolated by incubation with IgG–Sepharose beads (GE Healthcare) for h at °C [26] Following extensive washing with buffer A, RNA was isolated from bound fractions by directly extracting the bead suspension with phenol Subsequently, the RNA was precipitated, suspended in diethylpyrocarbonate-treated water and analyzed by electrophoresis in 1.5% agarose gels and by FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS 4175 Nop53p activates the exosome in vitro D C Granato et al Table Oligonucleotides used for Northern blot hybridization or PCR Oligo Sequence Reference P2 P4 P5 CATGGCTTAATCTTTGAGAC CGTATCGCATTTCGCTGCGTTC CTCACTACCAAACAGAATGTTT GAGAAGG GCCGCTTCACTCGCCGTTACTA AGGC GTTTGACCTCAAATCAGGTAGG CTCTTCGAAGGCACTTTACA TATCTGGTTGATCCTGCCAG AATTCAGGGAGGTAGTGACA CCGATTGGCAAAAAC TGTTGGAGCACAAGCAAG GCTGCAGAAGATGAAACAA GCATCAGACACTAATTGC GGAAATGCGTAGGGAAGACCA ATTTCATGACG GATGCCTCTTTAGAACAAGGTT ACAAATCCTG CTTTCAACAACGGATCTCTTGG GGTCACCCACTACACTACTCGG TCTAGCCGCGAGGAAGGA GTTCGCCTAGACGCTCTCTTC CCTTCTCAAACATTCTGTTTGG [51] [52] [16] P7 25SFor3252 25SRev3501 18SFor701 18SRevPE SnR37For SnR37Rev SnR74For SnR74Rev Cr.V interg For Cr.V interg Rev 5.8SFor2865 5S scR1Rev UC1 ITS2 For 3020 [26] This This This [26] This This This This This study study study study study study study study This study [31] [31] [53] [52] This study Northern blot as described previously [26,31], using probes specific to pre-rRNA and rRNAs For comparison, 1% of RNA recovered from total extract was loaded on gels, and normalized for loading to endogenous scR1 RNA RNA extraction and analysis Exponentially growing cultures of yeast strains NOP53, DNOP53 ⁄ GAL-A-NOP53, DNOP53 ⁄ GAL-A-NOP53 ⁄ ADNOP53, DNOP53 ⁄ GAL-A-NOP53 ⁄ AD-C-NOP53 and DNOP53 ⁄ GAL-A-NOP53 ⁄ C2 strains were transferred from YNB-Gal to YNB-Glu medium Cells were collected at the time of the shift (t0) and after 24 h of incubation in glucose medium RNA extraction was performed using a modified hot phenol method [31] Oligo probes used in the Northern hybridization analyses are listed in Table For poly-A RNA purification, total RNA (400 lg) from NOP53 and DNOP53 ⁄ GAL-A-NOP53 strains grown for 12 h in glucose medium was purified using 50 lL of oligo(dT)–Sepharose (Gibco, Grand Island, NY, USA), following the manufacturer’s protocol RNA binding and degradation assays RNA fragments corresponding to the rRNA regions 5.8S+29, 25S, 5¢ ETS and ITS2 were transcribed in vitro using linearized vectors pGEM-5.8S, pGEM-25S, pGEM5¢ETS and pGEM-ITS2 as templates in the presence of 4176 10 lCi of a-32P-UTP, as described previously [31] One pmol of radiolabeled RNA was incubated with 10 pmol of purified His–Nop53p, GST–N-Nop53p, GST–C-Nop53p or GST in buffer A for 20 at 25 °C For the band-shift analysis, the RNA–protein complexes were analyzed in 6% polyacrylamide gel For RNA degradation assays, 100 ng of the TAP–Rrp43p- or TAP–Nop58p-purified complexes, or 0.5 pmol of GST–Rrp6p, was incubated with 0.5 pmol of radioactively labeled oligo RNA, in the presence of 10, 20 or 30 pmol of His–Nop53p or BSA Chromatin immunoprecipitation Strain DNOP53 ⁄ GAL::A-NOP53 grown at 30 °C in YP-GAL to an attenuance at 600 nm of 0.2–0.6 was pelleted by centrifugation at 3700 g for 20 at 4°C and processed as described previously [4,54] Chromatin solution was incubated for h with IgG–Sepharose beads pre-washed with lysis buffer (50 mm Hepes-KOH pH 7.5, 150 mm NaCl, mm EDTA, 1% Triton, 0.1% deoxycholate, mm phenylmethanesulfonyl fluoride) The immunoprecipitated material was washed three times with mL low-salt and high-salt buffers for min, and the chromatin obtained, as well as the input, was submitted to reverse crosslinking and analyzed by PCR Several regions of various genes were amplified after ChIP [a-32P] dATP was added to the PCR (0.5 lCi per 25 lL) The results of ChIP were quantified [55] using a phosphorimager (Molecular Dynamics, Sunnyvale, CA, USA), and normalized against the input An intergenic region from chromosome V was used as an internal control The values on the histogram correspond to the mean of three PCR reactions from three immunoprecipitated chromatin preparations For treatment with RNase, RNase mix (RNase A ⁄ RNase T1; Fermentas, Glenburnie, MD, USA) was added to the total cell extract at a final concentration of 10 lgỈlL)1 The total extract was incubated for h at 25 °C and subjected to immunoprecipitation at °C for h Acknowledgements We would like to thank Nilson I T Zanchin (LNLS, Campinas, Brazil) and Sandro R Valentini (UNESP, Araraquara, Brazil) for anti-Nip7p and anti-Rpl5p antisera, respectively We also thank Beatriz A Castilho (UNESP, Sao Paulo, Brazil) and Daniel C Pimenta ˜ (Butantan Institute, Sao Paulo, Brazil) for experimental ˜ help We thank Juliana S Luz for anti-Nop1p and antiMtr3p antisera, and Tereza C Lima Silva (LNLS, Campinas, Brazil) and Zildene G Correa (LNLS, Campinas, Brazil) for DNA sequencing D.C.G was the ` recipient of a Fundacao de Amparo a Pesquisa ¸ ˜ Estado de Sao Paulo (FAPESP) fellowship This work ˜ was supported by FAPESP grants 03 ⁄ 06031-3 and 05 ⁄ 56493-9 to C.C.O FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS D C Granato et al References Babler J, Grandi P, Gadal O, Lessmann T, Petfalski E, Tollervey D, Lechner J & Hurt E (2001) Identification of a 60S preribosomal particle that is closely linked to nuclear export Mol Cell 8, 517–529 Rosado VI, Kressler D & de la Cruz J (2007) Functional analysis of Saccharomyces cerevisiae ribosomal protein Rpl3p in ribosome synthesis Nucleic Acids Res 35, 4203–4213 Ferreira-Cerca S, Poll G, Gleizes PE, Tschochner H & Milkereit P (2005) Roles of eukaryotic ribosomal proteins in maturation and transport of pre-18S rRNA and ribosome function Mol Cell 20, 263–275 Gallagher JE, Dunbar DA, Grannemann S, Mitchell BM, Osheim Y, Beyer AL & Baserga SJ (2004) RNA polymerase I transcription and pre-rRNA processing are linked by specific SSU processome components Genes Dev 18, 2506–2517 Dez C, Dlakic M & Tollervey D (2007) Roles of the HEAT repeat proteins Utp10 and Utp20 in 40S ribosome maturation RNA 13, 1516–1527 Perez-Fernandez J, Roman A, Rivas J, Bustelo XR & Dosil M (2007) The 90S pre-ribosome is a multimodular structure that is assembled through a hierarchical mechanism Mol Cell Biol 27, 5414–5429 Dragon F, Gallagher JE, Compagnone-Post PA, Mitchell BM, Porwancher KA, Wehner KA, Wormsley S, Settlage R, Shabanowitz J, Osheim Y et al (2002) A large nucleolar U3 ribonucleoprotein required for 18S ribosomal RNA biogenesis Nature 417, 967– 970 Grandi P, Rybin V, Bassler J, Petfalski E, Strauss D, Marzioch M, Schafer T, Kuster B, Tschochner H, Tollervey D et al (2002) 90S pre-ribosomes include the 35S pre-rRNA, the U3 snoRNP, and 40S subunit processing factors but predominantly lack 60S synthesis factors Mol Cell 10, 105–115 Krogan NJ, Peng WT, Cagney G, Robinson MD, Haw R, Zhong G, Guo X, Zhang X, Canadien V, Richards DP et al (2004) High-definition macromolecular composition of yeast RNA-processing complexes Mol Cell 13, 225–239 10 Vanrobays E, Gelugne JP, Caizergues-Ferrer M & Lafontaine DL (2004) Dim2p, a KH-domain protein required for small ribosomal subunit synthesis RNA 10, 645–656 11 Nissan TA, Baßler J, Petfalski E, Tollervey D & Hurt E (2002) 60S pre-ribosome formation viewed from assembly in the nucleolus until export to the cytoplasm EMBO J 21, 5539–5547 12 Wehner KA, Gallagher JE & Baserga SJ (2002) Components of an interdependent unit within the SSU processome regulate and mediate its activity Mol Cell Biol 22, 7258–7267 Nop53p activates the exosome in vitro 13 Mitchell P, Petfalski E, Shevchenko A, Mann M & Tollervey D (1997) The exosome: a conserved eukaryotic RNA processing complex containing multiple 3¢ fi 5¢ exoribonucleases Cell 91, 457–466 14 Zanchin NIT & Goldfarb DS (1999) The exosome subunit Rrp43p is required for the efficient maturation of 5.8S, 18S and 25S rRNA Nucleic Acids Res 27, 1283– 1288 15 Allmang C, Mitchell P, Petfalski E & Tollervey D (2000) Degradation of ribosomal RNA precursors by the exosome Nucleic Acids Res 28, 1684–1691 16 Oliveira CC, Gonzales FA & Zanchin NIT (2002) Temperature-sensitive mutants of the exosome subunit Rrp43p show a deficiency in mRNA degradation and no longer interact with the exosome Nucleic Acids Res 30, 4186–4198 17 Allmang C, Kufel J, Chanfreau G, Mitchell P, Petfalski E & Tollervey D (1999) Functions of the exosome in rRNA, snoRNA and snRNA synthesis EMBO J 18, 5399–5410 18 van Hoof A, Staples RR, Baker RE & Parker R (2000) Function of the Ski4p (Csl4p) and Ski7p proteins in 3¢-to-5¢ degradation of mRNA Mol Cell Biol 20, 8230– 8243 19 Houseley J, La Cava J & Tollervey D (2006) RNAquality control by the exosome Nat Rev Mol Cell Biol 7, 529–539 20 Mitchell P, Petfalski E, Houalla R, Podtelejnikov A, Mann M & Tollervey D (2003) Rrp47p is an exosomeassociated protein required for the 3¢ processing of stable RNAs Mol Cell Biol 23, 6982–6992 21 Kadaba S, Krueger A, Trice T, Krecic AM, Hinnebusch AG & Anderson J (2004) Nuclear surveillance and degradation of hypomodified initiator tRNAMet in S cerevisiae Genes Dev 18, 1227–1240 22 LaCava J, Houseley J, Saveanu C, Petfalsky E, Thompson E, Jacquier A & Tollervey D (2005) RNA degradation by the exosome is promoted by a nuclear polyadenylation complex Cell 121, 713–724 23 Wyers F, Rougemaille M, Badis G, Rousselle JC, Dufour ME, Boulay J, Regnault B, Devaux F, Namane A, Seraphin B et al (2005) Cryptic pol II transcripts are degraded by a nuclear quality control pathway involving a new poly(A) polymerase Cell 121, 725–737 24 Vanacova S, Wolf J, Martin G, Blank D, Dettwiller S, Friedlein A, Langen H, Keith G & Keller W (2005) A new yeast poly(A) polymerase complex involved in RNA quality control PLoS Biol 3(6), e189 25 Zanchin NIT & Goldfarb DS (1999) Nip7p interacts with Nop8p, an essential nucleolar protein required for 60S ribosome biogenesis, and the exosome subunit Rrp43p Mol Cell Biol 19, 1518–1525 26 Gonzales FA, Zanchin NIT, Luz JS & Oliveira CC (2005) Characterization of Saccharomyces cerevisiae Nop17p, a novel Nop58p-interacting protein that is FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS 4177 Nop53p activates the exosome in vitro 27 28 29 30 31 32 33 34 35 36 37 38 39 40 D C Granato et al involved in pre-rRNA processing J Mol Biol 346, 437– 455 Kufel J, Allmang C, Verdone L, Beggs J & Tollervey D (2003) A complex pathway for 3¢ processing of the yeast U3 snoRNA Nucleic Acids Res 31, 6788–6797 van Hoof A, Lennertz P & Parker R (2000) Three conserved members of the RNase D family have unique and overlapping functions in the processing of 5S, 5.8S, U4, U5, RNase MRP and RNase P RNAs in yeast EMBO J 15, 1357–1365 Araki Y, Takahashi S, Kobayashi T, Kajiho H, Hoshino S & Katada T (2001) Ski7p G protein interacts with the exosome and the Ski complex for 3¢-to-5¢ mRNA decay in yeast EMBO J 20, 4684–4693 Wang L, Lewis MS & Johnson AW (2005) Domain interactions within the Ski2 ⁄ ⁄ complex and between the Ski complex and Ski7p RNA 11, 1291–1302 Granato DC, Gonzales FA, Luz JS, Cassiola F, Machado-Santelli GM & Oliveira CC (2005) Nop53p, an essential nucleolar protein that interacts with Nop17p and Nip7p, is required for pre-rRNA processing in Saccharomyces cerevisiae FEBS J 272, 4450–4463 Thomson E & Tollervey D (2005) Nop53p is required for late 60S ribosome subunit maturation and nuclear export in yeast RNA 11, 1215–1224 Sydorskyy Y, Dilworth DJ, Halloran B, Yi EC, Makhnevych T, Wozniak R & Aitchison JD (2005) Nop53p is a novel nucleolar 60S ribosomal subunit biogenesis protein Biochem J 388, 819–826 Claypool JA, French SL, Johzuka K, Eliason K, Vu L, Dodd JA, Beyer AL & Nomura M (2004) Tor pathway regulates Rrn3p-dependent recruitment of yeast RNA polymerase I to the promoter but does not participate in alteration of the number of active genes Mol Biol Cell 15, 946–956 Kuai L, Fang F, Butler JS & Sherman F (2004) Polyadenylation of rRNA in Saccharomyces cerevisiae Proc Natl Acad Sci USA 101, 8581–8586 Carneiro T, Carvalho C, Braga J, Rino J, Milligan L, Tollervey D & Carmo-Fonseca M (2007) Depletion of the yeast nuclear exosome subunit Rrp6 results in accumulation of polyadenylated RNAs in a discrete domain within the nucleolus Mol Cell Biol 27, 4157–4165 Rudra D, Mallick J, Zhao Y & Warner JR (2007) Potential interface between ribosomal protein production and pre-rRNA processing Mol Cell Biol 27, 4815–4824 Venema J & Tollerevey D (1999) Ribosome synthesis in Saccharomyces cerevisiae Annu Rev Genet 33, 261–311 Schilders G, van Dijk E & Pruijn GJ (2007) C1D and hMtr4p associate with the human exosome subunit PM ⁄ Scl-100 and are involved in pre-rRNA processing Nucleic Acids Res 35, 2564–2572 van Beekvelt CA, Graaff-Vincent M, Faber AW, van’t ´ Riet J, Venema J & Raue HA (2001) All three functional domains of the large ribosomal subunit protein 4178 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 L25 are required for both early and late pre-rRNA processing steps in Saccharomyces cerevisiae Nucleic Acids Res 29, 5001–5008 Thomson E, Rappsilber J & Tollervey D (2007) Nop9 is an RNA binding protein present in pre-40S ribosomes and required for 18S rRNA synthesis in yeast RNA 13, 2165–2174 Krogan NJ, Cagney G, Yu H, Zhong G, Guo X, Ignatchenko A, Li J, Pu S, Datta N, Tikuisis AP et al (2006) Global landscape of protein complexes in the yeast Saccharomyces cerevisiae Nature 440, 637–643 Vasiljeva L & Buratowski S (2006) Nrd1 interacts with the nuclear exosome for 3¢ processing of RNA polymerase II transcripts Mol Cell 21, 239–248 James P, Halladay J & Craig EA (1996) Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast Genetics 144, 1425–1436 Niedenthal RK, Riles L, Johnston M, Hegemann JH (1996) Green fluorescent protein as a marker for gene expression and subcellular localization in budding yeast Yeast 12, 773–786 Luz JS, Tavares JR, Gonzales FA, Santos MC & Oliveira CC (2007) Analysis of the Saccharomyces cerevisiae exosome architecture and of the RNA binding activity of Rrp40p Biochimie 89, 686–691 Sambrook J, Maniatis T & Fritsch EF (1989) Molecular Cloning: A Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Hanahan D (1983) Studies on transformation of Escherichia coli with plasmids J Mol Biol 166, 557–580 Sherman F, Fink GR & Hicks JB (1986) Laboratory Course Manual for Methods in Yeast Genetics Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Mitchell P (2001) Purification of yeast exosome Methods Enzymol 342, 356–364 Fatica A, Dlakic A & Tollervey D (2002) Naf1p is a box H ⁄ ACA snoRNP assembly factor RNA 8, 1502–1514 Zanchin NIT, Roberts P, DeSilva A, Sherman F & Goldfarb DS (1997) Saccharomyces cerevisiae Nip7p is required for efficient 60S ribosome subunit biogenesis Mol Cell Biol 17, 5001–5015 Baker KE & Parker R (2006) Conventional 3¢ end formation is not required for NMD substrate recognition in Saccharomyces cerevisiae RNA 12, 1441–1445 Keogh MC & Buratowski S (2004) Using chromatin immunoprecipitation to map co-transcriptional mRNA processing in Saccharomyces cerevisiae Methods Mol Biol 257, 1–16 Nedea E, He X, Kim M, Pootoolal J, Zhong G, Canadien V, Hughes T, Buratowski Moore CL & Greenblatt J (2003) Organization and function of APT, a sub-complex of the yeast cleavage and polyadenylation factor involved in the formation of mRNA and snoRNA 3¢ ends J Biol Chem 278, 33000–33010 FEBS Journal 275 (2008) 4164–4178 ª 2008 The Authors Journal compilation ª 2008 FEBS ... directing the exosome to 7S pre -rRNA, thereby regulating the function of the complex In the absence of Nop53p, the exosome is not efficiently directed to the 7S pre -rRNA for processing, leading to the. .. degraded by the exosome in the absence of Nop53p In order to determine whether the effect of Nop53p depletion on 5.8S processing by the exosome was indirect, or whether it involved direct exosome. .. with the exosome subunit Rrp6p and activates the RNase activity of the complex in vitro, Nop53p may be involved in recruitment of the exosome to the 7S pre -rRNA for processing and formation of the