Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf

IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain Gopal P Patel and Jnanankur Bag Department of Molecular and Cellular Biology, University of Guelph, Ontario, Canada Keywords autoregulation; IMP1; PABP; poly(A)-binding protein; translational control Correspondence J Bag, Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario, N1G 2W1, Canada Fax: +1 519 837 2075 Tel: +1 519 824 4120 Ext 53390 E-mail: jbag@uoguelph.ca (Received 12 June 2006, revised October 2006, accepted 25 October 2006) doi:10.1111/j.1742-4658.2006.05556.x Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5¢ untranslated region of the PABPmRNA In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nm and 5.9 nm, respectively Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3¢ end of the ARS Results of our analysis suggest that both proteinỈprotein and proteinỈRNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA Regulation of gene expression is fundamental to almost all biological activities Multiple layers of regulatory mechanisms control essentially every step of gene expression in eukaryotes It was thought that regulation of transcription is the master switch of gene expression in eukaryotes [1]; however, it is becoming increasingly evident that the majority of regulatory mechanisms are employed at the post-transcriptional and translational levels [2,3] In order to be functional, cellular mRNA associates with a wide array of RNAbinding proteins to form a messenger ribonucleoprotein particle (mRNP) The constituent of the mRNP dictates the fate of mRNA [4] It is therefore not surprising that functionally related eukaryotic genes may represent ‘post-transcriptional operons’ because they are regulated coordinately at post-transcriptional levels by unique combinations of mRNA-binding proteins that recognize common cis-elements among the mRNAs [5] The poly(A)-tail is one of the most common cisacting sequence elements found in the 3¢ UTR of eukaryotic mRNAs, which predominantly binds to poly(A)-binding protein (PABP) The 3¢ poly(A)-tail and PABP, together, influence almost every aspect of mRNA metabolism including maturation, transportation, localization, translation and stability [6–8] Given the significant function of PABP in mRNA biology, its cellular level is tightly regulated at the translational level Abbreviations ARC, autoregulatory ribonucleoprotein complex; ARS, autoregulatory sequence; IMP1, insulin-like growth factor II mRNA binding protein1KH, K-homology; mRNP, messenger ribonucleoprotein particle; PABP, poly(A)-binding protein; RBD, RNA-binding domain; REMSA, RNA electrophoretic mobility shift assay; RRM, RNA-recognition motif; TOP, terminal oligopyrimidine tract; UNR, unr gene encoded polypeptide 5678 FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ª 2006 FEBS G P Patel and J Bag by two repressible cis-acting sequence elements, the terminal oligopyrimidine tract (TOP) [9] and an adeninerich autoregulatory sequence (ARS) [10] The TOP element encompasses the first 31 nucleotides, whereas the ARS spans nucleotides 71–131 in the 5¢ UTR of the PABP mRNA The TOP element regulates PABP translation in growth-dependent and tissue-specific manners [11,12], whereas the ARS functions constitutively in all types of cells [9,10] It has been generally accepted that at elevated cellular levels, PABP binds to the ARS region of its own mRNA and represses translation by stalling the movement of the 40S ribosomal subunit along the 5¢ UTR [13,14] Recent studies in our laboratory have shown that, besides PABP, the ARS binds to insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to form a heterotrimeric autoregulatory ribonucleoprotein complex (ARC) [15] Mutational analyses of the ARS have shown a strong correlation between the formation of the heterotrimeric complex and repression of a reporter gene expression UNR showed lesser affinity for the ARS, and its presence in the ARC required association with PABP However, IMP1 is capable of binding to the ARS with high affinity independently, and can also interact with PABP [15] There are several functional similarities between PABP and IMP1 Both polypeptides have been implicated in mRNA localization, turnover, and translational control No enzymatic activity has been associated with either PABP or IMP1, and it seems that their functions are attributed to their ability to bind to specific RNA sequences and to act as a scaffold for protein–protein interactions PABP contains four RNA-binding domains (RBD I to IV) arranged in tandem at its N-terminus and a protein-binding auxiliary domain at its C-terminus Concurrently, PABP exhibits preferential affinity for poly(A) stretches and also interacts with several cytosolic polypeptides such as Paip1 [16,17], Paip2 [18,19], eIF4B [20], poly(C)binding proteins [21], UNR [22], eIF4G [23], Rna15 [24], eRF3 [25], and TcUBP-1 [26] IMP1 belongs to the conserved valine-isoleucinecystine-lysine-glutamine containing (VICKZ) family of mRNA-binding proteins consisting of two RNA-recognition motifs (RRM I and II) at its N-terminus and four K-homology (KH) domains arranged in tandem at its C-terminus [27] Interestingly, associations of IMP1 with both RNAs and proteins are primarily mediated by the KH-domains [28] The full repertoire of RNA-sequence targets and polypeptide partners of IMP1 has not yet been defined The RNA targets of IMP1 include Igf-II [27], c-myc [29], tau [30], FMR1 [31], and PABP [15] mRNAs; whereas its known Binding of IMP1 to PABP and PABP-mRNA polypeptide partners consist of G3 BP, HuD [30], FMRP [31], and PABP [15] In the present study, we have further characterized the interaction between PABP and IMP1 on the ARS RNA for a better understanding of their role in translational regulation of PABP expression The results of our studies show that both PABP and IMP1 bind strongly to nucleotides between 110 and 131 of the ARS RNA Binding of PABP to the ARS requires a minimum of three RBDs (RBD I to III or RBD II to IV), whereas binding of IMP1 to the ARS is predominantly mediated by the KH III–IV domains In addition, protein interaction analyses confirmed that PABP-C and KH III–IV domains are essential and sufficient for both homo- and hetrodimerization between PABP and IMP1 Taken together, these results indicate that IMP1 and PABP may form a platform for the formation of a large ARC on the ARS through further protein–protein interactions Results The minimal RBD requirement for the interaction between PABP and the ARS As the A-rich autoregulatory translational control element of PABP mRNA is not a perfect poly(A) tract, and binds less efficiently to PABP than a comparable size poly(A) tract [15], we set out to examine whether there is a difference in how the ARS and a poly(A) RNA binds PABP We investigated the relative importance of individual RBDs of PABP in binding the ARS, and compared it to that of a poly(A) RNA Various [35S]methionine labeled PABP peptides containing one or more RBDs were synthesized in vitro (Fig 1), and allowed to bind to the ARS RNA coupled agarose beads as described previously [15] Analyses of the eluted bound proteins from these beads were performed by SDS ⁄ PAGE The results (Fig 2) show that PABP peptides containing a single RBD domain failed to bind the ARS RNA (Fig 2A: lanes 1, 5, and 10) Although RBD I-II peptide showed a weak binding to the ARS (Figs 2.A: lane 2), other combinations of two RBDs did not show any detectable binding to the ARS RNA (Fig 2A: lanes and 9) The presence of at least three of the four RBD domains was required in the PABP peptide for efficient binding to the ARS RNA (Fig 2A: lanes and 7) PABP peptides containing either RBDs I-II-III or II-III-IV were almost equally effective as the full length PABP (Fig 2A: lane 12) or a PABP peptide containing all four RBDs (Fig 2A: lane 4) In addition, as expected the PABP-C domain showed no RNA binding activity (Fig 2A: lane 11) FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ª 2006 FEBS 5679 Binding of IMP1 to PABP and PABP-mRNA G P Patel and J Bag Fig Architecture of PABP and IMP1 constructs used in the present study Protein expression constructs containing various portions of IMP1 and PABP open reading frames were created using primers given in Table The constructs prepared using pQE primers were cloned into pQE80L plasmid vector for the expression of 6· His tag fusion protein in E coli The constructs prepared using pDU primers were cloned into pDUAL-GC plasmid vector for the in vitro expression of proteins in the rabbit reticulocytes lysate cell-free system Similar studies were performed to examine how PABP peptides bind to a 50 nucleotide long poly(A) RNA In contrast to the ARS RNA, the poly(A)50 only required the presence of just two of the four RBDs (Fig 2A: lanes 2, 6, 9), or only the RBD II (Fig 2B: lane 5), for efficient binding PABP peptides containing a combination of three (Fig 2B: lanes and 7) or all four RBDs (Fig 2B: lane 4) showed binding similar to the full length PABP (Fig 2B: lane 12) These results are in agreement with a previous report that the RBD II is responsible for most of the poly(A) binding activity of PABP [32] In these studies we used the radiolabelled in vitro translated luciferase as a negative control, which showed no binding to either the ARS or the poly(A) RNA (Fig 2, lane 13) We also used the vector derived unrelated pGEM-RNA as an additional negative control for the binding assays (Fig 2C) In our assays using the RBD I-IV, RBD II-IV, and the full length PABP, a number of lower kDa bands (than the corresponding peptide) were found to bind both ARS and the poly(A) RNAs These peptides are most likely the premature translation termination products from longer mRNAs, which is a common problem with the rabbit reticulocytes lysate cell-free system used in our studies to synthesize the PABP peptides PABP and IMP1 binding region of the ARS We have shown earlier that at least three polypeptides PABP, IMP1, and UNR bind to the ARS element of 5680 PABP mRNA, and among these polypeptides only PABP and IMP1 can bind to the ARS independently [15] Therefore, we wanted to examine whether PABP and IMP1 bind to distinct subregions of the ARS Different ARS RNA fragments were used for RNA electrophoretic mobility shift assay (REMSA) and UV cross-linking studies with purified PABP and IMP1 In addition, we performed RNase footprinting studies to examine the IMP1 binding region of the ARS RNA The result of our REMSA studies show that the presence of the two terminal short stretches of adenines at the 5¢ and the 3¢ ends of the ARS were not essential for binding to IMP1 (Fig 3B: lanes and 3, and the sequence of ARS and DARS-4 in Fig 3A) The 20 nucleotide long region of the 5¢ end of the ARS (DARS-L; Fig 3B: lane 4) and the A and U rich region located at the middle segment of the ARS (DARS-C; Fig 3B: lane 5) were unable to form a stable complex with the IMP1 We found that an A, U and C rich region located at the 3¢ end of ARS (DARS-R; Fig 3B: lane 6) was sufficient for binding to IMP1 Because both DARS-4 and DARS-R binds to IMP1, we tested whether a 14 nucleotide long common sequence 5¢-CCCCAAAAAAAUUU-3¢ between the two constructs, is the minimal IMP1-binding sequence Results of REMSA (Fig 3C) show that the 14 nucleotide long RNA was able to bind both PABP and IMP1, albeit, less efficiently than the 22 nucleotide long DARS-R RNA Therefore, the presence of additional nucleotides either at the 5¢ or the 3¢ (as in the FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ª 2006 FEBS G P Patel and J Bag Binding of IMP1 to PABP and PABP-mRNA A B Fig Binding of the different RBD of PABP with the ARS and poly(A)50 RNA [35S]methionine labelled different RBDdomains of PABP (Fig 1), prepared by in vitro translation in a cell-free rabbit reticulocytes lysate, were incubated with the ARS (A), poly(A)50 (B) or pGEM (C) conjugated agarose beads in the chromatography buffer, washed extensively with the same buffer, and the bound proteins were eluted by boiling the beads in a protein sample loading buffer The samples were analyzed by 13% SDS ⁄ PAGE, the gel was impregnated in M sodium salicylate, vacuum dried and visualized by autofluorography C DARS-4) ends of the minimal RNA sequence has a significant stimulatory effect on the binding of PABP and IMP1 Experiments using UV cross-linking between radiolabelled RNA and purified IMP1 (Fig 3D) yielded results similar to those observed by REMSA (Fig 3B) Interestingly, both IMP1 and PABP showed similar preference for the 3¢ end of the ARS (Fig 3D: lane 6; and Fig 3E: lane 6) Furthermore, to examine whether the same region of the ARS is involved in binding IMP1 when it is present in the sequence context of the entire ARS, we performed RNase footprinting analyses using the ARS RNA and purified 6· His-IMP1 (Fig 3F) The results show protection of the sequence at the 3¢ end of the ARS in presence of IMP1 (Fig 3F: compare lanes and 5) Comparison of this region (Fig 3F: lane 4) with the RNA ladder (Fig 3F: lane 1) suggest that the IMP1 binding site of the ARS falls within the nucleotide sequence shown in the DARS-R We further investigated the ability of both PABP and IMP1 to bind to the DARS-R RNA simultaneously using REMSA The results (Fig 4) show that both PABP and IMP1 formed similar size complexes with the ARS when used separately in binding assays Presence of equimolar concentration of both PABP and IMP1 in the binding reaction produced a significant level of a slower migrating complex, which indicates the formation of a heterodimeric complex with the ARS Comparison of binding affinity of the ARS to PABP and IMP1 In the previous UV cross-linking assays, PABP showed a slightly higher binding ability to the ARS than what was observed for the IMP1 (Fig 3D,E) Therefore, we compared the binding affinities of IMP1 and PABP for the ARS in detail (Fig 5) We measured the percentage of bound RNA at various protein concentrations by REMSA [33] The results show that PABP binds to the ARS approximately two times more efficiently than the IMP1 (Fig 5C) The calculated FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ª 2006 FEBS 5681 Binding of IMP1 to PABP and PABP-mRNA G P Patel and J Bag A B D E F C Fig PABP and IMP1 binding region of the ARS (A) Different regions of the ARS RNA used in the gel-shift and UV cross-linking assays (B) RNA gel-shift analyses of the binding of IMP1 with the different regions of the ARS RNA REMSA was performed using ng purified 6· His-IMP1 and  0.1 ng (10 000 c.p.m.) RNA Lane 1, radioactive DARS-R RNA only; lanes 2–6, purified 6· His-IMP1 was incubated with radiolabelled ARS, DARS-4, DARS-L, DARS-C, and DARS-R RNAs, respectively Samples were analyzed on a 5% polyacrylimide gel under nondenaturing conditions, vacuum dried, and visualized by autoradiography (C) RNA gel-shift analyses of the binding of IMP1 to DARS-R and DARS-S RNA was performed as described in (B) Lane 1, radioactive DARS-R RNA only; lanes and 4, purified 6· His-PABP was incubated with DARS-R and DARS-S RNA, respectively; lanes and 5, purified 6· His-IMP1 was incubated with DARS-R and DARS-S RNA (D) and (E) RNA-protein UV cross-linking studies Purified, ng 6· His-IMP1 (D) and ng 6· His-PABP (E) were used for these studies One sample in both panels containing protein and ARS RNA was analyzed without UV treatment (lane 1) Lanes 2–6, 6· His-IMP1 (D) and 6· His-PABP (E) were incubated with  ng radiolabelled (100 000 c.p.m.) ARS, DARS-4, DARS-L, DARS-C, and DARS-R RNAs After the UV treatment, the samples were treated with RNase A ⁄ RNase T1, fractionated on a 13% SDS ⁄ PAGE and visualized by autoradiography (F) RNase footprinting analysis IMP1 interacting domain of the ARS RNA was analyzed by RNase footprinting as described in the Experimental procedures Lane 1, RNA ladder was prepared by partially hydrolyzing the 5¢ end radiolabelled ARS RNA with 0.1 M NaOH Lane and 3, 5¢ end radiolabelled ARS RNA with or without purified 6· His-IMP1, respectively Lanes and 5, 5¢ end radiolabelled ARS RNA with or without purified 6· His-IMP1 was partially digested with RNase One (Promega) The samples were analyzed by 13% PAGE in presence of 8% urea as a denaturing agent and the bands were visualized by autoradiography 5682 FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ª 2006 FEBS G P Patel and J Bag Binding of IMP1 to PABP and PABP-mRNA A B C Fig Simultaneous binding of PABP and IMP1 with the DARS-R RNA Approximately 0.1 ng (10 000 c.p.m.) uniformly radiolabelled DARS-R RNA was incubated with purified 6· His-PABP and 6· HisIMP1, either individually or simultaneously, for at room temperature The samples were analyzed by 5% PAGE Lane 1, RNA only; lane 2, RNA + ng 6· His-PABP; lane 3, RNA + ng 6· HisPABP and 4.5 ng 6· His-IMP1; lane 4, RNA + 4.5 ng 6· His-IMP1 dissociation constants for PABP–ARS and IMP1–ARS interactions were found to be approximately 2.3 nm and 5.9 nm, respectively The IMP1 domain responsible for binding to the ARS IMP1 is a modular protein with two RRM type and four KH RNA binding domains To examine which of the six RNA binding domains are necessary for the ability of IMP1 to bind ARS, we expressed various portions of IMP1 as His-tagged peptides, and purified by affinity chromatography These peptides were analyzed for complex formation with the radiolabelled ARS RNA by UV cross-linking assay The results show that the RRM I-II domain binds to the ARS very inefficiently (Fig 6, compare lanes and 3), whereas the KH I-II peptide did not show any detectable binding to the ARS (Fig 6, lane 4) The ability to bind ARS was present within the KH III-IV region of Fig Binding affinity of the ARS RNA to PABP and IMP1 (A) and (B) Gel-shift assays of binding of PABP and IMP1 to the ARS RNA Uniformly radiolabelled ARS RNA was incubated with an increasing amount of purified PABP or IMP1 for at room temperature as described in the legend of Fig The samples were fractionated on a 5% PAGE under nondenaturing conditions, and visualized by autoradiography Lane 1, samples without protein; lanes 2–9, samples with an increasing amount of protein (0.9 ng increment) (C) The radioactive bands corresponding to the bound and free ARS RNA in (A) and (B) were excised by superimposing the radiograph, and the level of radioactivity was measured by scintillation counter The average ratio of the RNP complex ⁄ free RNA in each lane from three separate experiments was plotted against the amount of the protein The binding constant was calculated by determining the protein molar concentration at 50% binding efficiency [33] IMP1 The ability of the KH III-IV domain containing peptide to bind ARS was similar to what was observed for both the full length IMP1 and KH I-IV peptide Interaction between PABP and IMP1 In a previous study, we reported that IMP1 is a novel PABP partner [15] Therefore, we further investigated how these two polypeptides interact with each other Different PABP and IMP1 domains were synthesized in vitro as [35S]methionine labeled peptides, and their ability to bind matrix bound IMP1 or PABP was FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ª 2006 FEBS 5683 Binding of IMP1 to PABP and PABP-mRNA G P Patel and J Bag A B C D Fig The IMP1 domain responsible for binding to the ARS Truncated IMP1 polypeptides were expressed and purified from E coli for UV cross-linking analysis with the radiolabelled ARS RNA Full length IMP1 (lane 2), RNA recognition motifs RRM I-II (lane 3), KH domains KH I-II (lane 4), KH III-IV (lane 5), and KH I-IV (lane 6) were used for these studies One sample containing IMP1 (lane 1) was analyzed without UV treatment Samples were incubated at room temperature for After the UV treatment, the samples were treated with RNase A ⁄ RNase T1, fractionated on a 13% SDS ⁄ PAGE and visualized by autoradiography examined The results of our studies show that the PABP-C domain (Fig 7A: lane 5) alone was capable of interacting with IMP1 as efficiently as the full length PABP (Fig 7A: lane 1) None of the RBDs of PABP showed any binding to IMP1 (Fig 7A: lanes 2–4) Similar studies using IMP1 peptides showed that the ability of IMP1 to dimerize resides within the KH III-IV domains (Fig 7A: lanes 6, and 10), and other domains of IMP1 did not contribute towards its homodimerization (Fig 7A: lanes and 8) When we used the full length PABP-matrix as the bait, only the PABP-C domain showed ability to homodimerize PABP (Fig 7B: lanes and 5) In addition, our results show that the ability of IMP1 to bind PABP resides within its KH III-IV domains (Fig 7B: lane 9) The IMP1 peptide containing the KH III-IV 5684 Fig Interaction between PABP and IMP1 [35S]methionine labelled full length or truncated version of PABP and IMP polypeptides were incubated with IMP1 (A), PABP (B), b-Gal (C), PABP-C (D: lanes 1–5), and KH III-IV (D: lanes 6–10) conjugated agarose beads in the chromatography buffer, washed extensively with the same buffer, and the bound proteins were eluted by boiling the beads in the chromatography buffer containing 300 mM imidizole The samples were analyzed by 13% SDS ⁄ PAGE, the gel was impregnated in M sodium salicylate, vacuum dried and visualized by autofluorography domains was able to bind PABP as efficiently as the peptide containing all four KH domains or the full length IMP1 (Fig 7B: lanes and 10) We also performed binding assays using matrix-bound PABP-C and IMP1 KH III-IV peptides (Fig 7D,E) to examine whether the short peptides could pull down the interacting peptide partners We show here that PABP-C alone can pull down the full length PABP and IMP1 (Fig 7D: lanes and 3), and also the protein interacting domains of PABP and IMP1 (Fig 7D: lanes 2, 4, and 5) In similar studies using IMP1 KH III-IV peptide as bait, we found that it can pull down both the FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ª 2006 FEBS G P Patel and J Bag full length PABP and the PABP-C peptide (Fig 7D: lanes and 7) Furthermore, the IMP1 KH III-IV peptide was also able to pull down the full length IMP1, and IMP1 peptides containing the KH III-IV domains (Fig 7D: lanes 3–5) These results confirmed that the interaction between PABP and IMP1 is mediated by the PABP-C and KH III-IV domains of these polypeptides, respectively Discussion We have shown in these studies that the ARS, an A-rich translational control element in the 5¢ UTR of PABP mRNA, interacts with PABP differently than a comparable size RNA consisting exclusively of the adenine base [poly(A)50] While RBD II is the main poly(A) interacting domain [32], at least three RBDs of PABP are required for efficient binding to the ARS The combinations of either the RBDs I-II-III or RBDs II-III-IV have similar affinities for the ARS It is known that RBDs I and II have specific affinity towards the poly(A), and RBDs III and IV bind to the nonpoly(A) sequences [32] As such, it is not unexpected that the presence of at least one nonspecific RBD is necessary to bind to the ARS, which consists of stretches of A, C and U bases We have shown earlier that in addition to PABP, the ARS binds to IMP1 In these studies we have compared the binding of IMP1 and PABP, and surprisingly we have found that both polypeptides bind strongly to a 22 nucleotide long CCCAAAAAAA UUUACAAAAAA sequence located at the 3¢ end of the ARS Furthermore, CCCAAAAAAAUUU was found to be the minimal sequence required for binding to both PABP and IMP1 However, this short RNA did not bind either protein as strongly as RNAs with additional adenine nucleotides either at the 5¢ or 3¢ ends It is possible that the flanking sequences provide a suitable landing place for PABP and IMP1 on the RNA In vitro RNprotein binding studies showed that other regions of the ARS not posses a strong affinity for either PABP or the IMP1 It is possible that the other short regions of the ARS on their own could form a different secondary structure, than when they are present as a part of the entire ARS Therefore, these short RNAs on their own may not interact with PABP and ⁄ or IMP1 We however, consider this possibility unlikely because the RNase footprinting analyses using the full length ARS also showed binding of IMP1 to the 3¢ end of the ARS Whether the 22 nucleotide long region of the ARS could repress translation of a reporter mRNA in vivo has not been studied yet Binding of IMP1 to PABP and PABP-mRNA The results of our studies suggest that both IMP1 and PABP bind to the same region of the ARS, which implies that they could compete with each other for binding to the ARS Our results showed that in the presence of both PABP and IMP1, a heterodimeric complex was formed on the DARS-R RNA As PABP binds to the ARS more tightly than what was observed for the IMP1, it is possible that PABP may first bind to the ARS, and interact with IMP1 In future studies it will be interesting to examine whether the PABP peptide lacking the C-terminal IMP1 interacting domain can form a heterodimeric complex with IMP1 on the ARS RNA How IMP1 and PABP will bind to the PABP mRNA in vivo may depend on their relative abundance In HeLa cells, we found that both polypeptides are almost equally abundant (results not shown) Because a large amount of cellular PABP is already bound to the 3¢ poly(A) tract of mRNA, the free IMP1 could be more abundant than the free PABP In addition, PABP and IMP1 interact with each other; as such, it is also possible that binding of either PABP or IMP1 to the ARS could attract the other partner through protein–protein interaction to form a heterodimeric RNprotein complex Another possibility that needs further investigation is whether dimerization between PABP and IMP1 prior to binding the RNA could alter their binding site on the ARS To understand the molecular nature of the interaction of IMP1 with the ARS and PABP, we examined the IMP1 domain involved in binding to the ARS and PABP We have shown here that among the two RNA binding and four KH domains of IMP1 only the KH III-IV domain is necessary to bind both ARS RNA and PABP Because the same domain of IMP1 is involved in binding to its polypeptide partner, and the ARS, it is likely that a dynamic conformational change occurs during the formation of the heterodimeric ARS RNprotein complex Earlier studies have shown that the KH III-IV domain of IMP1 is also involved in binding to the translational control element of insulin like growth factor mRNA [28] to repress its translation Therefore, these two domains of IMP1 have the bonafide translational repressor activity In addition, the earlier studies by Nielsen et al [34] showed that the same IMP1 domains were involved in forming mRNA granules, and localizing the repressed insulin like growth factor mRNA to specific subcytoplasmic domains Whether IMP1 is involved in localizing the repressed PABP mRNA to a distinct subcytoplasmic region has not been studied yet Whether the ARS-bound IMP1 interacts with PABP through the ARS has not been directly tested Never- FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ª 2006 FEBS 5685 Binding of IMP1 to PABP and PABP-mRNA G P Patel and J Bag theless, indirect evidence suggests that IMP1 is capable of binding directly to PABP We have shown here that the RNA-binding domains of PABP cannot bind IMP1, which would be expected should the ARS RNA be involved in the interaction between PABP and IMP1 Therefore, we suggest that both PABP and IMP1 bind to the ARS independently, and then mutually stabilize the RNprotein complex through protein–protein interaction Moreover, it is unlikely that any contaminating ARS-like RNA derived from Escherichia coli in our agarose-PABP beads during its purification from the bacterial cell extract, could have been indirectly involved in binding IMP1, as E coli RNA did not show any competition with the ARS RNA in gel shift assays (results not shown) Additional studies to characterize the IMP1 interacting domain of PABP showed that it resides exclusively within the PABP-C domain Although RBD II of PABP could interact with several polypeptide partners including eIF4G [23], PAIP1 [16,17], and PAIP2 [18,19], the PABP-C is the main protein–protein interacting domain of PABP In a previous study PABP-C domain was shown to be indispensable for the autoregulation of PABP mRNA translation [35] Our results suggest that the main function of the PABP-C domain in translational repression may be to interact with IMP1 to form a heterodimeric RNprotein complex Whether IMP1 can bind to the 3¢ poly(A) track of all mRNA by interacting with the PABP-C domain and plays a role in all mRNA metabolism remains to be examined Both in vitro and in vivo studies in our lab [15] have shown that the ARS forms a heterotrimeric complex with three known RNA-binding proteins, PABP, IMP1, and UNR However, in the studies reported here we have focused on the interaction of ARS with PABP and IMP1, because only the IMP1 and PABP bind to the ARS independently As UNR is a known PABP binding protein, its presence in the heterotrimeric ARS RNprotein complex is probably through its binding to PABP The individual role of the polypeptides of the heterotrimeric complex is not known It is possible that each polypeptide participates at a distinct step of translational control There is more to translational control than simply preventing the ribosome from binding to the mRNA For a foolproof mechanism to prevent unwanted mRNA translation, the decision to repress translation of a specific mRNA may be made by tagging the mRNA while it is in the nucleus IMP1 is a known shuttle protein; therefore, it may bind to the ARS containing mRNA in the nucleus, and tag the mRNA for repression PABP may then bind to the tagged mRNA by binding to both 5686 ARS and IMP1 UNR is a member of the cold-shock domain containing protein family These proteins can act as ‘RNA histone’, and protect the repressed mRNA from degradation [36] Finally, the ARS– IMP1–PABP–UNR complex could form even a larger multisubunit autoregulatory complex through a series of protein–protein interactions This multimeric complex would provide a stronger roadblock to stall the scanning of the mRNA by 40S ribosomal subunits than a monomeric ARS–PABP complex It is conceivable that a multi subunit RNprotein complex needs to be formed with the translational repressor ciselement to prevent the large molecular machine such as the 40S ribosomal subunit to read-through the translational control element Experimental procedures Plasmid construction Double stranded oligodeoxynucleotides encoding either poly(A)50 or various regions of the ARS (nucleotides 71– 131 of the human PABP cDNA, GeneBank ID: Y00345) were generated by annealing complementary synthetic oligonucleotide sets (Table 1; only sense sequences are given) The annealed products were digested with respective restriction enzymes (MBI Fermentas; Amherst, NY, USA), purified from a 2.5% agarose gel using the QIAquick gel extraction kit (Qiagen; Mississauga, ON, Canada), and cloned into pEGFP-N3 (Clontech-BD Biosciences; Burlington, ON, Canada) plasmid vectors Protein expression constructs containing various portions of IMP1 (GenBank ID: NM_006546) and PABP (GeneBank ID: Y00345) open reading frames were generated by using appropriate primers (Table and Fig 1) The PCR products were digested with appropriate restriction enzymes (MBI Fermentas), purified from a 1% agarose gel by QIAquick gel extraction kit (Qiagen), and cloned into pDUAL-GC (Stratagene, La Jolla, CA, USA) or pQE80L (Qiagen) expression vectors All plasmids were Table Primers used to create various ARS constructs Primer Sense sequence ARS EcoRI-T7-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaatttacaaaaaa-BamHI EcoRI-T7-tccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaattt-BamHI EcoRI-T7-aaaaaatccaaaaaaaatct-BamHI EcoRI-T7-tctaaaaaaatcttttaaaaaacccc-BamHI EcoRI-T7-ccccaaaaaaatttacaaaaaatc-BamHI EcoRI-T7-ccccaaaaaaattt-BamHI EcoRI-T7-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaa-BamHI ă AARS-4 ă AARS-L ă AARS-C ă AARS-R ă AARS-S Poly(A)50 FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ª 2006 FEBS G P Patel and J Bag Binding of IMP1 to PABP and PABP-mRNA Table Primers used to create truncated PABP and IMP1 protein expression vectors Expression and purification of 6· His-tag fusion protein Number Primer Sequence 10 11 12 13 14 15 16 17 18 19 20 21 pQE-PABP(s) pQE-PABPC(s) pQE-IMP1(s) pQE-KH1(s) pQE-KH3(s) pDU-PABP(s) pDU-RBDII(s) pDU-RBDIII(s) pDU-RBDIV(s) pDU-PABPC(s) pDU-IMP1(s) pDU-KH1(s) pDU-KH3(s) PABP(as) RBDI(as) RBDII(as) RBDIII(as) RBDIV(as) IMP1(as) RRM2(as) KH2(as) BamHI-aaccccagtgccccc BamHI-gagcgccaggctcac BamHI-aacaagctttacatcggc BamHI-gtggacatcccccttcgg BamHI-gctgctccctatagctcc EarI-catgaaccccagtgcc EarI-catggatgttataaagggc EarI-catgggacgatttaagtct EarI-catggaacagatgaaacaa EarI-catggagcgccaggctcac EarI-catgaacaagctttacatcg EarI-catggtggacatcccccttcgg EarI-catggctgctccctatagctcc KpnI-ttaaacagttggaacaccgg KpnI-ttagcctactccacttttgcg KpnI-ttaagcttctcgttctttacg KpnI-ttagcgcttaagttccgtct KpnI-ttactggttagtgaggagagc KpnI-ttacttcctccgtgcctg KpnI-ttactgctgcttggctgg KpnI-ttagctggatgaagctgg Escherichia coli DH5a transformed with pQE80L expression vector (Qiagen) containing various portions of IMP1 or PABP open reading frames (Fig 1) were grown to an early log phase and induced for h with isopropyl thio-b-d-galactoside The bacterial cells were harvested and lysed with mgỈmL)1 of lysozyme in a lysis buffer (50 mm NaH2PO4, 500 mm NaCl, 30 mm imidizole, 13 mm 2-mercaptoethanol, mm MgCl2, mm phenylmethanesulfonyl fluoride, 0.5% IgepalCA-630, and 5% glycerol [pH 8.0]) at °C for 30 The lysate was cleared by centrifugation at 12 000 g for and the supernatant was mixed with Ni-NTA agarose beads (Qiagen) After shaking at °C for 30 min, the beads were washed extensively with a washing buffer (50 mm NaH2PO4, 500 mm NaCl, 50 mm imidizole, 13 mm 2-mercaptoethanol, mm MgCl2, mm phenylmethanesulfonyl fluoride, 0.5% IgepalCA-630, and 5% glycerol [pH 8.0]) and the bound proteins were eluted in the elution buffer (50 mm NaH2PO4, 500 mm NaCl, 300 mm imidizole, 13 mm 2-mercaptoethanol, mm MgCl2, mm phenylmethanesulfonyl fluoride, 0.5% IgepalCA-630, and 5% glycerol [pH 8.0]) The protein concentration of the eluted fraction was determined by a protein assay kit (Bio-Rad, Burlington, ON, Canada), and equilibrated with a storage buffer (10 mm Hepes-KOH [pH 7.5], mm MgCl2, 140 mm KCl, 5% glycerol, mm dithiothreitol, 0.02% Igepal CA-630, 0.5 mm phenylmethanesulfonyl fluoride, 10 lgỈmL)1 leupeptin, and lgỈmL)1 aprotinin) using the Microcon YM-30 concentration column (Millipore, Etobicoke, ON, Canada) and stored at )80 °C in small aliquots The integrity and purity of the affinity purified polypeptide was examined by SDS ⁄ PAGE The desired polypeptide band was quantified by scanning the stained gel Preparations containing more than 80% undegraded IMP1 and PABP were used for further studies In vitro synthesis of radiolabelled protein pDUAL-GC vector (Stratagene) containing various portions of IMP1 or PABP open reading frames (Fig 1) was linearized with KpnI and transcribed using T7 RNA polymerase system as described The contaminating nucleotides were removed by centrifugation using the Microcon YM-30 concentration column (Millipore) Approximately 0.1 lg of RNA was translated using rabbit reticulocytes lysate (Promega) containing 0.02 mm amino acids mixture and 30 lCi [35S]methionine in a total reaction volume of 100 lL (70% retic lysate) for 90 at 30 °C The specific radioactivity was determined using trichloroacetic acid precipitation and the quality of translated product was analyzed on 13% SDS ⁄ PAGE followed by autoradiography propagated in E coli DH5a (Invitrogen, Carlsbad, CA, USA), isolated using GenElute plasmid maxi-prep kit (Sigma, Oakville, ON, Canada) and confirmed to be correct by DNA sequencing In vitro synthesis and radiolabelling of RNA pEGFP-N3 plasmids containing either oligo(A)50 or various ARS region under the control of the T7 RNA polymerase promoter were linearized with BamHI, and pGEM-T vector (Promega, Madison, WI, USA) was linearized with SalI restriction enzyme for in vitro run-off transcription Transcription reactions were usually performed at 37 °C for h in a final volume of 100 lL containing 10 lg of a DNA template, 2.5 mm of each NTP, and 100 units of T7 RNA polymerase (Promega) Uniformly radiolabelled RNA was synthesized under similar conditions in a final reaction volume of 25 lL containing 150 lCi [32P]ATP[aP] (MP Biomedicals, Irvine,CA, USA) and the final concentration of cold ATP reduced to 25 lmol The 5¢ end radiolabelled RNA was prepared by first dephosphorylating cold RNA using calf intestine phosphatase, followed by phosphorylation using T4 polynucleotide kinase (T4-PNK) in presence of [32P]ATP[cP] The contaminating nucleotides, incompletely transcribed products and the DNA template were removed by fractionating transcription reaction mixtures on 13% polyacrylamide gels under denaturing conditions [37] The amount of RNA and its specific radioactivity were determined using a spectrophotometer and scintillation counter, respectively RNA electrophoretic mobility shift assay For REMSA, 1–10 ng of purified protein was incubated with  0.1 ng (1 · 104 c.p.m.) of radiolabelled RNA for FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ª 2006 FEBS 5687 Binding of IMP1 to PABP and PABP-mRNA G P Patel and J Bag 10 at 22 °C in a total reaction volume of 18 lL in the binding buffer (10 mm Hepes-KOH [pH 7.5], mm MgCl2, 140 mm KCl, 5% glycerol, mm dithioreitol, 0.02% Igepal CA-630, 10 lg of E coli tRNA and 0.02% bromophenol blue) Subsequently, the sample was analyzed by 5% nondenaturing PAGE in 0.5· TBE buffer (45 mm Tris-borate, mm EDTA [pH 8.0]), 100 V, at °C The gel was then vacuum dried and autoradiographed UV cross-linking assay For UV-induced cross-linking assays, approximately ng of purified protein was incubated with  ng (1 · 105 c.p.m.) of radiolabelled RNA at 22 °C for 10 in a total reaction volume of 27 lL in the binding buffer The sample was irradiated by UV-light (254 nm, 4000 lwỈcm)2) at °C for min, and treated with RNase T1 (25 units) and RNase A (1 lg) at 37 °C for Finally, the sample was boiled in a protein sample loading buffer (6% glycerol, 2% SDS, 100 mm dithioreitol, and 0.02% bromophenol blue in 60 mm Tris ⁄ HCl [pH 6.6]) for and analyzed by 13% SDS ⁄ PAGE  50 ng of purified protein for 10 on ice in a total reaction volume of 18 lL in the binding buffer The reaction was then treated with unit (as defined by the supplier) of RNase One (Promega) at 22 °C for The RNase was inactivated by incubation at 75 °C in RNA loading buffer (50% formamide, 2% SDS final concentration) and analyzed by 13% PAGE in the presence of 8% urea as a denaturing agent Finally, the gel was fixed (5% methanol, 5% acetic acid), dried under vacuum, and subjected to autoradiography Acknowledgements This work was supported by a grant from The Canadian Institutes of Health Research (CIHR) and The National Science and Engineering Research Council (NSERC) We are thankful to Dr J Christiansen for providing the IMP1 clone We also thank Mrs S Ma for her help in the preparation of the revised manuscript References Protein pull-down assay To analyze RNA–protein interactions, in vitro synthesized and gel purified RNA was oxidized by sodium periodate treatment and covalently linked to adipic acid hydrazide agarose (Sigma) as described previously [38] The unbound RNA was removed by washing the beads twice with m NaCl followed by equilibrating the beads with the chromatography buffer (10 mm Hepes-KOH [pH 7.5], mm MgCl2, 140 mm NaCl, 5% glycerol, mm dithioreitol, 0.01% Triton X-100) The RNA conjugated beads were incubated with in vitro synthesized [35S]methionine labeled protein at °C for 15 The beads were washed extensively with the chromatography buffer The RNA-bound protein was eluted by boiling in protein sample loading buffer and analyzed by 13% SDS ⁄ PAGE followed by an autoradiography To analyze protein–protein interactions, Ni-NTA agarose beads were conjugated with 6· His-tag fusion protein expressed in E coli as described The beads were equilibrated with the chromatography buffer and incubated with in vitro synthesized [35S]methionine labeled protein at °C for 15 The beads were washed extensively with the chromatography buffer and the affinity-bound protein was eluted in the chromatography buffer supplemented with 300 mm imidizole The sample was analyzed by 13% SDS ⁄ PAGE and visualized by an autoradiography RNase protection assay To identify protein binding sites in the RNA, the 5¢ end radiolabelled RNA (1 · 104 c.p.m.) was first incubated with 5688 Mendez R & Richter JD (2001) Translational control by CPEB: a mean to the end Nat Rev Mol Cell Biol 2, 521–529 Gygi SP, Rochon Y, Franza BR & Aebersold R (1999) Correlation between protein and mRNA abundance in yeast Mol Cell Biol 19, 1720–1730 Ideker T, Thorsson V, Ranish JA, Christmas R, Buhler J, Eng JK, Bumgarner R, Goodlett DR, Aebersold R & Hood L (2001) Integrated genomic and proteomic analyses of a systematically perturbed metabolic network Science 292, 929–934 Moore MJ (2005) From birth to death: the complex lives of eukaryotic mRNAs Science 309, 1514–1518 Keene JD & Tenenbaum SA (2002) Eukaryotic mRNPs may represent posttranscriptional operons Mol Cell 9, 1161–1167 Mangus DA, Evans MC & Jacobson A (2003) Poly(A)binding protein: multifunctional scaffolds for the posttranscriptional control of gene expression Genome Biol 4, 223–238 Gorgoni B & Gray NK (2004) The roles of cytoplasmic poly(A)-binding proteins in regulating gene expression: a developmental perspective Brief Funct Genomic Proteomic 3, 125–141 Kuhn U & Wahle E (2004) Structure and function of poly(A) binding protein Biochim Biophys Acta 1678, 67–84 Hornstein E, Git A, Nraunstein I, Avni D & Meyuhas O (1999) The expression of poly(A)-binding protein gene is translationally regulated in a growth-dependent FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ª 2006 FEBS G P Patel and J Bag 10 11 12 13 14 15 16 17 18 19 20 21 22 fashion through a 5¢-terminal oligopyrimidine tract motif J Biol Chem 274, 1708–1714 Wu J & Bag J (1998) Negative control of the poly(A) binding protein mRNA translation is mediated by the adenine-rich region of its 5¢ UTR J Biol Chem 273, 34535–34542 Avni D, Shama S, Loreni F & Meyuhas O (1994) Vertebrate mRNAs with a 5¢-terminal pyrimidine tract are candidates for translational repression in quiescent cells: characterization of the translational cis-regulatory element Mol Cell Biol 14, 3822–3833 Shama S & Meyuhas O (1996) The translational cisregulatory element of mammalian ribosomal protein mRNAs is recognized by the plant translational apparatus Eur J Biochem 236, 383–388 Bag J (2001) Feedback inhibition of poly(A)-binding protein mRNA translation A possible mechanism of translation arrest by stalled 40S ribosomal subunits J Biol Chem 276, 47352–47360 de Melo Neto OP, Standart N & Martins de SaC (1995) Autoregulation of poly(A)-binding protein synthesis in vitro Nucleic Acids Res 23, 2198–2205 Patel GP, Ma S & Bag J (2005) The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex Nucleic Acids Res 33, 7074–7089 Gray NK, Coller JM, Dickson KS & Wickens M (2000) Multiple portions of poly (A) -binding protein stimulate translation in vivo EMBO J 19, 4723–4733 Craig AWB, Haghighat A, Yu ATK & Sonenberg N (1998) Interaction of polyadenylate-binding protein with the eIF4G homologue PAIP enhances translation Nature 392, 520–523 Khaleghpour K, Kahvejian A, de Crescenzo G, Roy G, Svitkin YV, Imataka H, O’Connor-McCourt M & Sonenberg N (2001) Dual interaction of the translational repressor Paip2 with poly (A)-binding protein Mol Cell Biol 21, 5200–5213 Khaleghpour K, Svitkin YV, Craig AW, DeMaria CT, Deo RC, Burley SK & Sonenberg N (2001) Translational repression by a novel partner of human poly(A)binding protein, Paip2 Mol Cell 7, 205–216 Le H, Tanguay RL, Balasta ML, Wei CC, Browning KS, Metz AM, Gross DJ & Gallie DR (1997) Translation initiation factors eIF-iso4G and eIF4B interact with the poly(A)-binding protein and increase its RNA binding activity J Biol Chem 272, 16247–16255 Wang Z, Panayiota T & Kiledjian M (1999) An mRNA stability complex functions with poly(A)-binding protein to stabilize mRNA in vitro Mol Cell Biol 19, 4552– 4560 Cheng TC, Yamashita A, Chen CYA, Yamashita Y, Zhu W, Durdan S, Kahvejian A, Sonenberg N & Shyu AB (2004) UNR, a new partner of poly(A)-binding protein, plays a key role in translationally coupled mRNA Binding of IMP1 to PABP and PABP-mRNA 23 24 25 26 27 28 29 30 31 32 33 34 35 turnover mediated by the c-fos major coding-region determinant Genes Dev 18, 2010–2023 Tarun SJ Jr & Sachs AB (1996) Association of the yeast poly (A) tail binding protein with translation initiation factor eIF-4G EMBO J 15, 7168–7177 Amrani N, Minet M, Le Gouar M, Lacroute F & Wyers F (1997) Yeast Pab1 interacts with Rna15 and participates in the control of the poly(a) tail length in vitro Mol Cell Biol 17, 3694–3701 Cosson B, Berkova N, Couturier A, Chabelskaya S, Philippe M & Zhouravleva G (2002) Poly(A)-binding protein and eRF3 are associated in vivo in human and Xenopus cells Biol Cell 94, 205–216 D’Orso I & Frasch AC (2002) TcUBP-1, an mRNA destabilizing factor from Trypanosomes, homodimerizes and interacts with novel AU-rich element and poly(A)binding proteins forming a ribonucleoprotein complex J Biol Chem 277, 50520–50528 Nielsen J, Christiansen J, Lykke-Andersen J, Johnsen AH, Wewer UM & Nielsen FC (1999) A family of insulin-like growth factor II mRNA-binding proteins represses translation in late development Mol Cell Biol 19, 1262–1270 Nielsen J, Kristensen MA, Willemoes M, Nielsen FC & Christiansen J (2004) Sequential dimerization of human zipcode-binding protein IMP1 on RNA: a cooperative mechanism providing RNP stability Nucleic Acids Res 32, 4368–4376 Bernstein PL, Herrick DJ, Prokipcak RD & Ross J (1992) Control of c-myc mRNA half-life in vitro by a protein capable of binding to a coding region stability determinant Genes Dev 6, 642–654 Atlas R, Behar L, Elliott E & Ginzburg I (2004) The insulin-like growth factor mRNA binding-protein IMP-1 and the Ras-regulatory protein G3 BP associate with tau mRNA and HuD protein in differenciated P19 neuronal cells J Neurochem 89, 613–626 Rackham O & Brown CM (2004) Visualization of RNA–protein interactions in living cells: FMRP and IMP1 interact on mRNAs EMBO J 23, 3346–3355 Burd CG, Matunis EL & Dreyfuss G (1991) The multiple RNA-binding domains of the mRNA poly(A)binding protein have different RNA-binding activities Mol Cell Biol 11, 3419–3424 Wieland G, Hemmerich P, Koch M, Stoyan T, Hegemann J & Diekmann S (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae Nucleic Acids Res 29, 1054–1060 Nielson FC, Nielson J, Kristensen M, Koch G & Christiansen J (2002) Cytoplasmic trafficking of IGF-II mRNA-binding protein by conserved KH domains J Cell Sci 115, 2087–2097 Melo EO, de Dhalia RSaMC, Standart N & de Melo Neto OP (2003) Identification of a C-terminal FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ª 2006 FEBS 5689 Binding of IMP1 to PABP and PABP-mRNA G P Patel and J Bag poly(A)-binding protein (PABP) –PABP interaction domain J Biol Chem 278, 46357–46368 36 Coles LS, Bartley MA, Bert A, Hunter J, Polyak S, Diamond P, Vadas MA & Goodall GJ (2004) A multiprotein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Eur J Biochem 271, 648–660 5690 37 Wildeman AG & Nazar RN (1981) Studies on the secondary structure of 5.8S rRNA from a thermophile, Thermomyces lanuginosus J Biol Chem 256, 5675–5682 38 Caputi M & Zahler AM (2001) Determination of the RNA binding specificity of the heterogeneous nuclear ribonucleoprotein (hnRNP) H ⁄ H ⁄ F ⁄ 2H9 family J Biol Chem 276, 43850–43859 FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ª 2006 FEBS ... lane 4) The ability to bind ARS was present within the KH III-IV region of Fig Binding affinity of the ARS RNA to PABP and IMP1 (A) and (B) Gel-shift assays of binding of PABP and IMP1 to the ARS... to examine the IMP1 binding region of the ARS RNA The result of our REMSA studies show that the presence of the two terminal short stretches of adenines at the 5¢ and the 3¢ ends of the ARS were... that the ability of IMP1 to dimerize resides within the KH III-IV domains (Fig 7A: lanes 6, and 10), and other domains of IMP1 did not contribute towards its homodimerization (Fig 7A: lanes and