match each half sentence in column a with a suitable one in column b

Báo cáo khoa học: "Improving Grammaticality in Statistical Sentence Generation: Introducing a Dependency Spanning Tree Algorithm with an Argument Satisfaction Model" pptx

... Philadelphia, July Hal Daum´ III and Daniel Marcu 2004 A phrasee based hmm approach to document/abstract alignment In Proceedings of EMNLP 2004, Barcelona, Spain Dan Shen and Mirella Lapata 2007 ... novel sentences also aim to recycle sentence fragments where possible, as we Work on phrasebased statistical machine translation has been applied to paraphrase generation (Bannard and Callison-Burch, ... was also obtained from the PTB training data, referred to as PTB-LM Additionally, a 4-gram language model was obtained from a subsection of the BLLIP’99 Corpus (LDC number: LDC2000T43) containing...

THE SIMPLE SENTENCE IN TRADITIONAL GRAMMAR AND THE CLAUSE SIMPLEX IN SYSTEMIC FUNCTIONAL GRAMMAR a COMPARATIVE STUDY

Danh mục: Khoa học xã hội

... in general and on language teaching in particular in several parts of the world, including Vietnam For a long time, sentence has been the main content of grammar teaching at schools As a result, ... passive transformation + Adverbial: An adverbial (i) is an adverb, adverb phrase, adverbial clause, noun phrase, or prepositional phrase (ii) is generally mobile, i.e is capable of occurring in more ... 3-4 (b) : Relational processes in Vietnamese Behavioural clauses Behavioural clauses construe (human) behaviour, including mental and verbal behaviour, as an active version of verbal and mental processes...

59
1,140
13

báo cáo hóa học:" Comparison of transverse wires and half pins in Taylor Spatial Frame: A biomechanical study" pdf

Danh mục: Hóa học - Dầu khí

... implanted in ex-vivo bone[23] The cadaveric bones may also have anthropometric variations An attempt to decrease this effect was made by obtaining the bones from same aged cadaveric calf from a single ... Load/displacement data was obtained for each individual ring fixation and the curves were analyzed for slope, axial and angular displacements The slope of the regression line of these average data points is ... be maintained during clinical use There are some studies in literature evaluating the clinical outcome of TSF[20-22], but there are none evaluating the biomechanics of TSF Amongst biomechanical...

báo cáo hóa học:" Research Article Extremal Values of Half-Eigenvalues for p-Laplacian with Weights in L1 Balls" potx

Danh mục: Hóa học - Dầu khí

... of half- eigenvalues in potentials,” to appear in Communication in Contemporary Mathematics W Li and P Yan, “Various half- eigenvalues of scalar p-Laplacian with indeﬁnite integrable weights,” Abstract ... N and r > If γ ∈ 1, ∞ , any extremal γ value involved in 1.9 can be attained by some weight, and each minimizer is contained in S r If γ 1, none of these extremal values can be attained by any ... a, b and λm a, b are determined, we ﬁnd that Θ a, b and Θ a, b are not m diﬀerentiable Finally, we have to resort to the comparison result on Θ ϑ, a, b It can be proved that a0 , b0 ≥ a1 , b1 ...

Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx

Danh mục: Báo cáo khoa học

... 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3' siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' ... 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3' siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA-3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA-3' ... siRNAs Sense Antisense siRNA1 5'-AAGGACAGGATCCACTTGACCTATAGTGAGTCGTATTA-3' 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3'...

Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx

Danh mục: Báo cáo khoa học

... Schabes 1997 Tree-Adjoining Grammars In G Rozenberg and A Salomaa, editors, Handbook of Formal Languages, chapter 2, pages 69– 123 Springer-Verlag, Berlin H Kautz and B Selman 1998 Blackbox: A ... presupposes that Y is in Z In a scenario that involves multiple rabbits, multiple hats, and multiple individuals that are inside other individuals, but only one pair of a rabbit r inside a hat h, the ... If a node carries a null adjunction constraint (indicated by no-adjoin), no adjunction is allowed at this node; if it carries an obligatory adjunction constraint (indicated by adjoin!), an auxil337...

Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

Danh mục: Báo cáo khoa học

... and B, a 527-bp fragment was obtained By using the primers A and C, two fragments were obtained: a 669-bp-fragment for SR-BI and a 540-bp-fragment for SR-BII (129 bp shorter than SR-BI) All fragments ... cell association and degradation of 125I-labeled Table Speciﬁc binding of 125I-labeled HDL to choriocarcinoma cell lines at °C Binding constants were calculated by non linear regression analysis ... chamberslides were incubated for 30 with rabbit anti-SR-BI IgG (dilutions of : 1000, NB 400–104, Novus Biologicals, USA) followed by a 30-min incubation with cyanine3-labeled goat anti-rabbit IgG (dilution...

Tài liệu Báo cáo khoa học: "Sentence Disambiguation by a Shift-Reduce Parsing Technique" pot

Danh mục: Báo cáo khoa học

... shift-reduce table at each stage The combination of the stack, input, and state of the parser will be called a configuration and will be notated as, for example, Right Association Native speakers of ... have demonstrated that a parser using simple general rules for disambiguating sentences can yield appropriate behavior for a large class of performance phenomena right a- ~soeiation, minimal attachment, ... summarize, preterminal delaying, as an intrinsic part of the algorithm, does not actually change the basic properties of the algorithm in any observable way Note, however, that preterminal assignments,...

Each display screen must have a video display adapter

Danh mục: Tin học

...

Báo cáo khoa học: "Last but Definitely not Least: On the Role of the Last Sentence in Automatic Polarity-Classification" pdf

Danh mục: Báo cáo khoa học

... and Bad Structure in Simple Paragraphs: Effects on Apparent Theme, Reading Time, and Recall Journal of Verbal Learning and Verbal Behavior 17:13-28 Kieras, David E 1980 Initial Mention as a Cue ... ratings and readers’ rating for whole reviews and the correlation between authors’ rating and readers’ rating upon reading the last sentence are similar, while the correlation between authors’ rating ... evaluation at all Such an addition would have necessitated locating the extrachoice radio button at a separated remote place from the 5-star scale radio buttons, since conceptually it cannot be located...

Báo cáo khoa học: "Evaluating a Trainable Sentence Planner for a Spoken Dialogue System" doc

Danh mục: Báo cáo khoa học

... remaining approaches differ In the ﬁrst approach, SP OT, we learn constraints from training material; in the second approach, rule-based, we construct constraints by hand 3.3 SPoT: A Trainable Sentence ... top-ranked output to input to the surface realizer The SPR is automatically trained by applying RankBoost (Freund et al., 1998) to learn ranking rules from training data The training data was assembled ... human subjects to read dialogs of real interactions with AMELIA At 20 points over the dialogs, AMELIA’s actual utterance (TEMPLATE) is augmented with a set of variants; each set of variants included...

Báo cáo khoa học: "Regression for Sentence-Level MT Evaluation with Pseudo References" pdf

Danh mục: Báo cáo khoa học

... citeseer.nj.nec.com/al-onaizan99statistical.html Joshua S Albrecht and Rebecca Hwa 2007 A re-examination of machine learning approaches for sentence- level MT evaluation In Proceedings of the 45th Annual Meeting ... tree and compared aspects of it against a large target-language dependency treebank In addition to adapting the idea of Head Word Chains (Liu and Gildea, 2005), we also compared the input sentence s ... features: We consider both string-level features such as computing n-gram precision against a target-language corpus as well as several syntaxbased features We parse each input sentence into a...

Question Answer and each contains 100 question for a total 10000 Spagers Quizzes Volume one

Danh mục: Chứng chỉ A, B, C

... animal Zebra What was Fonzies favourite magazine Hot Rod In what American state most people walk to work Alaska What was Bugs Bunnies original name Happy Rabbit Who was Ben Casey's boss Dr Zorba ... What is the literal Greek translation of Sarcophagus French artist Aquabouse paints cows in what material An Arab/Israeli band Abu Hafla - record called Humping meaning First ad on Radio Luxemburg ... music with her breakfast 46 Baile Atha Cliath - Official name what capitol city 47 48 49 50 In the wild what animal pollinates banana plants What colour is the Black Box carried in aircraft Taidje...

– ANSWERS – Set 26 (Page 66) 390. a. Since one-half of the four children are girls, two must potx

Danh mục: Kỹ năng nói tiếng Anh

... ﬁve miles away, and closer than Samantha, who is seven miles away 412 a Baxter should be assigned to study with Carter Baxter cannot be assigned with Adam, because they have already been together ... Zinnia plants tomatoes each year, so choice e is incorrect Each year, she plants either carrots or cabbage, but not both She will plant cabbage in the second year, so she will plant carrots in ... that major public health campaigns that increase awareness and propose lifestyle changes are important in our ﬁght against obesity Choice b can be ruled out because although the paragraph states...

báo cáo hóa học: " A comparison of general and ambulance specific stressors: predictors of job satisfaction and health problems in a nationwide one-year follow-up study of Norwegian ambulance personnel" doc

Danh mục: Hóa học - Dầu khí

... http://www.occup-med.com/content/6/1/10 Page of Table Means, standard deviations and comparison between the sample available at T1 only and the sample available at both T1 and T2 Sample T-test (T1 and T2) sample vs sample (n ... among ambulance personnel are mainly related to ambulance specific stressors • Health complaints and low job satisfaction among ambulance personnel are mainly related to general job-related stressors ... Table Bivariate Pearson’s correlations between independent variables measured at T1 and job satisfaction, emotional exhaustion, psychological distress and musculoskeletal pain measured at T1 and...

Báo cáo hóa học: " Research Article A New One-Step Iterative Process for Common Fixed Points in Banach Spaces" ppt

Danh mục: Hóa học - Dầu khí

... in C Remark 4.5 Non-self-asymptotically nonexpansive mappings case can also be dealt with similarly using above iterative process even with error terms 10 Journal of Inequalities and Applications ... asymptotically quasi-nonexpansive mappings in Banach spaces,” Panamerican Mathematical Journal, vol 14, no 1, pp 45–54, 2004 J K Kim, K S Kim, and Y M Nam, “Convergence and stability of iterative ... 7, pp 2306–2315, 2007 B Xu and M A Noor, “Fixed-point iterations for asymptotically nonexpansive mappings in Banach spaces,” Journal of Mathematical Analysis and Applications, vol 267, no 2,...

Báo cáo y học: " Short RNA half-lives in the slow-growing marine cyanobacterium Prochlorococcus" pot

Danh mục: Báo cáo khoa học

... eubacteria let alone across all three kingdoms of life Rather, half- lives in the minutes range for eubacteria and archaea suggest an intrinsic chemical response that is similar for both bacteria and archaea ... genes (assumed to be particularly stable); and no subsequent scaling Remarkably, the robust multi-array analysis processed microarray data with no subsequent scaling achieved the highest concordance ... RNA stability and its role in control of gene expression in bacteria and phages Annu Rev Genet 1999, 33:193-227 Vytvytska O, Jakobsen JS, Balcunaite G, Andersen JS, Baccarini M, von Gabain A: ...

báo cáo khoa học:" Sinus lifting before Le Fort I maxillary osteotomy: a suitable method for oral rehabilitation of edentulous patients with skelettal class-III conditions: review of the literature and report of a case" doc

Danh mục: Báo cáo khoa học

... The main basic criteria for restauration of the edentulous maxilla and mandible are adequate bone mass and ortholalveolar form [6] This can be achieved by augmentation of the available substrate ... guides a total of 12 endosseous Camlog® implants were accurately positioned in the mandible and the maxilla according to the predefined planning that was made up of DVT scan and a wax up Again bone ... augmentation around the dental implants was performed using filter collected bone and a bioresorbable collagen membrane (BioMend Extend®, Zimmer Dental, Carlsbad, CA, USA) In March 2004 extraction...

Báo cáo sinh học: " Genes inﬂuencing milk production traits predominantly aﬀect one of four biological pathways" pps

Danh mục: Báo cáo khoa học

... direction, but without a change in protein or fat yield Protein synthesis would remain constant causing a change in the percentage of protein in the milk and also a small change in ASI QTL that a ect both ... have an eﬀect on ASI or P% and also have a small eﬀect on the other trait However, QTL with a large a ect on ASI and P%, resulting from an increase or decrease in protein synthesis, are rare In ... decreased fat synthesis within the mammary gland, again while the volume of milk remains relatively constant The two trait analysis using p < 0.1 revealed that the QTL appear to only a ect one...

Xem thêm

Bạn có muốn tìm thêm với từ khóa:

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008