fill each the blank in the summary of the letter with a suitable group of words below
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
... Ala reverse GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC ... TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC ... b-DG(654–750), and Asat and A0 are the absorbances at saturation and in the absence of ligand, respectively Data were normalized according to the equation (Ai ) A0 ) ⁄ (Asat ) A0 ) and reported as fractional...
- 15
- 337
- 0
Báo cáo y học: "Reconstruction of the urethra with a Surgisis onlay patch in urethral reconstructive surgery: two case reports" pdf
... drafting the manuscript and in the review of the literature and in performing the clinical follow-up HG was involved in drafting the manuscript and in the review of the literature SH participated ... the final draft Do you have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach ... participated in the surgery and was involved in the clinical follow-up JR participated in the surgery, was involved in the clinical follow-up and supervised this report All authors read and approved the...
- 4
- 292
- 0
Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams pot
... Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Abigail Adams During the Revolution, by John Adams and Abigail Adams and Charles Francis Adams ... danger, and distress Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam 23 Deacon Sayward said at table this week in my hearing that there was ... Paine, a sister of Robert Treat Paine, and for many years an intimate friend of the writer.] 19 JOHN ADAMS Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles...
- 269
- 350
- 0
Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams potx
... Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Abigail Adams During the Revolution, by John Adams and Abigail Adams and Charles Francis Adams ... danger, and distress Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam 23 Deacon Sayward said at table this week in my hearing that there was ... Paine, a sister of Robert Treat Paine, and for many years an intimate friend of the writer.] 19 JOHN ADAMS Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles...
- 269
- 481
- 0
Báo cáo sinh học: "Comparison between 68Ga-bombesin (68Ga-BZH3) and the cRGD tetramer 68Ga-RGD4 studies in an experimental nude rat model with a neuroendocrine pancreatic tumor cell line" ppt
... monitoring by qualitative analysis of SUV and quantitative evaluation based on the compartmental analysis of kinetic parameters [2] However, not all tumors are 18F-FDG avid, and in particular treated tumorous ... evaluated visually A volume of interest consists of several regions of interest over the target area Irregular regions of interest were drawn manually A detailed quantitative evaluation of tracer ... diagnosis of metastatic NETs The 68 Ga-DOTATOC uptake was also used as a parameter for a radionuclide therapy with 90 Y-DOTATOC Patients with lesions demonstrating an enhanced 68Ga-DOTATOC uptake (>5.0...
- 23
- 350
- 0
Báo cáo khoa học: "Highly malignant soft tissue sarcoma of the extremity with a delayed diagnosis" ppsx
... one case of synovial sarcoma (Figure 1) and one case of alveolar soft part sarcoma showed calcification on plain radiographs In all three cases of alveolar soft part Figure A plain radiograph ... histiocytoma, two cases each of myxofibrosarcoma and high-grade leiomyosarcoma, and one case of clear cell sarcoma were diagnosed Four of the seven cases of synovial sarcoma, two of the three cases of alveolar ... and ankle joint (three cases), the forearm (four cases), and the popliteal area (one case) Pulmonary metastasis was detected at diagnosis in all alveolar soft part sarcoma cases and in one clear...
- 5
- 286
- 0
báo cáo khoa học: "Primary malignant mixed Müllerian tumor arising from the mesorectum with a synchronous ovarian cancer: a case report and review of the literature" ppsx
... ovarian cancer, PPC tends to spread along the surface of the pelvis and abdomen Symptoms of patients with PPC are similar to those with ovarian cancer, including abdominal pain or bloating, nausea, ... analyzed and interpreted the patient data WTH photographed and interpreted the pathologic findings TFC took part in the critical revision and JYW took part in the surgical approach and final approval ... surgical treatment and the treatment choice of MMMT is similar to that of genital MMMT There are several reports regarding platinum-based chemotherapy activity against MMMT of the ovary Simon et al...
- 5
- 475
- 0
Báo cáo y học: " Penetrating injury of the hand with a door handle: a case report" ppt
... declare that they have no competing interests Authors' contributions KS was involved with the initial writing of the manuscript including the literature search MK was involved with the initial management ... from the patient for publication of this case report and accompanying images A copy of the written consent is available for review by the Editor -in- Chief of this journal Competing interests The authors ... Antero-posterior radiograph of hand Sinha M: An unusual foreign body in the hand J Hand Surg Eur Vol 2007, 32(2):231-232 Chaudhry IA, Al-Sharif AM, Shamsi FA, Elzaridi E, Al-Rashed W: Severe ocular injuries...
- 3
- 266
- 0
The World with a Thousand Moons pdf
... wall, and the horde of Vestan-dominated animals outside it The wall suddenly died! And as the electric barrier vanished, into the clearing came rushing the swarm of asteroidal animals "The wall's ... Captain Walls, himself an old-time space-man, was first of the group to appreciate the significance of the statement The captain gasped "A preventative for gravitation-paralysis? Kenniston, are ... important official in the Loring Radium company From the chaffing the others gave Murdock, it was evident that the young business man had joined the party only because he was in love with Gloria There...
- 52
- 408
- 0
the hero with a thousand faces commemorative edition vol 17 joseph campbell
... the smell of a landscape, the taste of a cup of tea, or the glance of an eye may touch a magic spring, and then dangerous messengers begin to appear in the brain These are dangerous because they ... Begouen.) VIII The Universal Father, Viracocha, Weeping (Argen-tina) Plaque found at Andalgala, Catamarca, in northwest Argentina, tentatively identified as the pre-Incan deity Viracocha The head is surmounted ... Geza Roheim's translation of an Australian Aranda term, altjiranga mitjina, which refers to the mythical ancestors who wandered on the earth in the time called altjiranga nakala, "ancestor was."...
- 297
- 613
- 0
annual report 2001 the bank with a human face ANZ
... banking industry awards including: – Australian Savings Institution of the Year (Personal Investor Magazine) – On-line Bank of the Year (Personal Investor Magazine) – Best investment/financial ... or auditor of the Company or of a related body corporate During the financial year, and again since the end of the financial year, the Company has paid a premium for an insurance policy for the ... incentive plan State of Affairs In the directors’ opinion, there have been no significant changes in the state of affairs of the Group during the financial year, other than: > Net loans and advances...
- 35
- 339
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 1) ppt
... lesions If the examiner focuses on linear erosions overlying an area of erythema and scaling, he or she may incorrectly assume that the erosion is the primary lesion and the redness and scale are secondary, ... formulate a differential diagnosis (Table 52-4) For instance, the finding of scaling papules (present in patients with psoriasis or atopic dermatitis) places the patient in a different diagnostic ... from a macule only in size Papule: A small, solid lesion,
- 5
- 413
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 2) potx
... and are caused by scratching Atrophy: An acquired loss of substance In the skin, this may appear as a depression with intact epidermis (i.e., loss of dermal or subcutaneous tissue) or as sites of ... of epidermis without an associated loss of dermis Ulcer: Loss of epidermis and at least a portion of the underlying dermis Excoriation: Linear, angular erosions that may be covered by crust and ... depending on their age or character Sites on hair-bearing areas may be characterized by destruction of hair follicles Table 52-3 Common Dermatologic Terms Alopecia: Hair loss; it may be partial or complete...
- 5
- 334
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 4) doc
... primary and secondary lesions, the shape of individual lesions, and the arrangement of the lesions An ideal skin examination includes evaluation of the skin, hair, and nails as well as the mucous ... be integrated with relevant historic data Four basic features of a skin lesion must be noted and considered during a physical examination: the distribution of the eruption, the types of primary ... examining the skin it is usually advisable to assess the patient before taking an extensive history This way, the entire cutaneous surface is sure to be evaluated, and objective findings can...
- 5
- 414
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 5) pptx
... A D The distribution of some common dermatologic diseases and lesions Figure 52-7 Psoriasis This papulosquamous skin disease is characterized by small and large erythematous papules and plaques ... skin disease is characterized by small and large erythematous papules and plaques with overlying adherent silvery scale Figure 52-8 ...
- 5
- 321
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 6) pdf
... contact (Fig 52-10) or primary irritant dermatitis In contrast, lesions with a generalized arrangement are common and suggest a systemic etiology Figure 52-9 Erythema multiforme This ... eruption is characterized by multiple erythematous plaques with a target or iris morphology It usually represents a hypersensitivity reaction to drugs (e.g., sulfonylamides) or infections (e.g., ... reaction to drugs (e.g., sulfonylamides) or infections (e.g., HSV) (Courtesy of the Yale Resident's Slide Collection; with permission.) Figure 52-10 ...
- 5
- 319
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 7) ppt
... superficial anatomic structures in selected areas of the body In this procedure, a small area of skin is anesthetized with 1% lidocaine with or without epinephrine The skin lesion in question can be ... simple diagnostic procedures can yield valuable information In most instances, they can be performed at the bedside with a minimum of equipment Skin Biopsy A skin biopsy is a straightforward minor ... or saucerized with a scalpel or removed by punch biopsy In the latter technique, a punch is pressed against the surface of the skin and rotated with downward pressure until it penetrates to the...
- 5
- 398
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 8) pptx
... a Wood's lamp, and previously unsuspected areas of involvement often become apparent A Wood's lamp may also aid in the demonstration of tinea versicolor and in recognition of ash leaf spots in ... noting the amount of blanching that occurs Granulomas often have an opaque to transparent, brown-pink "apple jelly" appearance on diascopy Figure 52-11 Urticaria Discrete and confluent, edematous, ... erythematous papules and plaques are characteristic of this whealing eruption Wood's Light A Wood's lamp generates 360-nm ultraviolet (or "black") light that can be used to aid the evaluation of...
- 5
- 367
- 0
Báo cáo y học: " SIVdrl detection in captive mandrills: are mandrills infected with a third strain of simian immunodeficiency virus?" potx
... CATCCAATGAAAGGGAGGTTC GGACATAGGGGATGCCTATT CTGTCCATTTCTTTGGGTGC GGACTTTAGAAAGTACACTGC CATCCACTCAAAGGGAGGTTC GGATGTAGGTGATGCCTATT CTGTCCACTTCTTTGGATGC = SIVmnd2C CATCCATTCATAAGGAGGATTG 5' first ... being present in the southern part of the mandrill range, and SIVmnd2 in the northern part Drill monkeys are found in Nigeria and Cameroon separated from the mandrill territory by the Sanaga ... female drills and mandrills are less obvious than those between males and are mainly noticeable in the colouration of the muzzle and the size of the animal A single hybrid M sphinx × M leucophaeus...
- 5
- 161
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25