0

it won t cost more tom assured us but it ll take longer bill objected

Indirect Speech

Indirect Speech

Tiếng anh

... It won t cost more, ” Tom assured us Tom assure us that it wouldn t cost more ● object that : phản đối e.g : It won t cost more, ” Tom assured us But it ll take longer, ” Bill objected Tom assured ... assured us that it wouldn t cost more But Bill objected/ pointed out that it would take longer ● explain (to sb) that : giải thích (với ai) e.g : “The TV is broken,” the repairer said to me The repairer ... câu trần thu t, ta sử dụng công thức: động t t ờng thu t + (that) + mệnh đề t ờng thu t Các động t t ờng thu t thường dùng: say + that + mệnh đề t ờng thu t tell + sb + that +mệnh đề t ờng thuật...
  • 15
  • 654
  • 3
Báo cáo y học:

Báo cáo y học: "Critical illness hyperglycemia: is failure of the beta-cell to meet extreme insulin demand indicative of dysfunctio" pot

Báo cáo khoa học

... glucocorticoid therapy, contributed to the low insulin secretion will be essential in guiding future treatment strategies Competing interests The authors declare that they have no competing interests ... argument), or whether the higher exogenous insulin required to bring these patients to target is indicative of higher resistance Discerning whether beta-cell exhaustion, or events secondary to the ... Critical Care Vol 13 No Steil and Agus Figure Blood glucose (BG) and C-peptide (CPEP) levels in children with (+) or without (-) critical illness hyperglycemia (CIH), with or without respiratory...
  • 2
  • 167
  • 0
The Rough Guide to Men’s Health doc

The Rough Guide to Men’s Health doc

Sức khỏe giới tính

... important to vary the fruit and veg you eat Too many people just eat the stuff they like day in day out and think that will It s better than nothing, but it won t give you the range of nutrients ... fully thawed before you start cooking If it isn t this could interfere with the time it takes to cook and it may not get done all the way through Don t put hot food in the fridge It will cause ... qualified State Registered Dietitian, Accredited Sports Dietitian and Registered Public Health Nutritionist Sarah works parttime as a nutrition scientist for the British Nutrition Foundation and...
  • 386
  • 612
  • 0
The Concise Guide to Mergers, Acquisitions and Divestitures Business, Legal, Finance,Accounting, Tax and Process Aspects pdf

The Concise Guide to Mergers, Acquisitions and Divestitures Business, Legal, Finance,Accounting, Tax and Process Aspects pdf

Kế toán - Kiểm toán

... greater than its liabilities This two-part test traces its history back to the dual structure of equity and law that existed in English courts at one time In equity courts, insolvency was tested ... states also adopted constituency statutes that permit directors to consider the interests of target’s constituencies other than shareholders Directors are not required to so, however.35 Constituencies ... consideration to target, not its shareholders This accomplishes two things It means target continues It also means that acquirer can argue target had sufficient assets It was the distribution of the...
  • 240
  • 452
  • 0
managing the development of lecturer staff of the vocational colleges to meet the demands of training human resources of mekong delta

managing the development of lecturer staff of the vocational colleges to meet the demands of training human resources of mekong delta

Tiến sĩ

... - It is oblidated to check the lecturer staff well and develop the lecturer staff exactly - It is oblidated to recruit the right vocational teacher with the standard, suitable skills, position ... to take the information widely - To prior recruite graduated students with good rate and excellent rate from Education University of technology, to be interested in recruiting the teachers, technicians ... competition rules in the labor market show who have the most suitable ability to meet the requirements of Labor using people for more job opportunities Foreign educational units must comply with the...
  • 27
  • 328
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Could pharmacogenetic data explain part of the interindividual sensitivity to methadone-induced respiratory depressio" pps

Báo cáo khoa học

... differential binding of methadone to its variants [9], it is presently not possible to determine whether and to what extent this could influence sensitivity to respiratory depression In summary, studies ... needed to elucidate the interindividual variability in sensitivity to respiratory depression among opioid-dependant patients receiving methadone maintenance treatment In this regard, genetic polymorphism ... PGP and the µ-opioid receptor would be interesting factors to consider in future investigations Competing interests The authors declare that they have no competing interests References At the pharmacodynamic...
  • 2
  • 194
  • 0
Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt

Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt

Báo cáo khoa học

... supernatant used for immunoprecipitation as previously described [14] For GPVI affinity precipitation, · 108 platelet-protein extract or 500 lg protein extract from the cell lines was incubated with ... (bottom right) Initial magnification · 20 Bottom panels show a magnification of cells transfected with GPVI–GFP and incubated with convulxin (right) Arrows indicate spots of colocalization between ... between the FcR c-chain and wild-type GPVI, but not with the other two mutants of GPVI (Fig 8A) This shows that the transmembrane arginine and the cytoplasmic tail of GPVI are essential for its...
  • 10
  • 506
  • 0
Báo cáo khoa học: The autophagic response to nutrient deprivation in the hl-1 cardiac myocyte is modulated by Bcl-2 and sarco⁄endoplasmic reticulum calcium stores ppt

Báo cáo khoa học: The autophagic response to nutrient deprivation in the hl-1 cardiac myocyte is modulated by Bcl-2 and sarco⁄endoplasmic reticulum calcium stores ppt

Báo cáo khoa học

... cell (Fig 2A, right) 3186 16 Fig Inhibition of lysosomal activity with the inhibitor cocktail (A) Inhibition of cathepsin B activity by lysosomal inhibitors Activity and intracellular distribution ... in relation to this study clearly illustrate the need to revisit studies in which the steady-state abundance of autophagosomes was used to infer the extent of autophagic activity Experimental procedures ... cells with numerous autophagosomes, which they interpreted as increased autophagic activity Our studies are consistent with their steady-state observations, but our flux measurements allow us to conclude...
  • 14
  • 444
  • 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Báo cáo khoa học

... between pig, human and rat CPT1B is the substitution of glutamate by aspartate at position 17 To show that this substitution might act as a negative determinant for the low malonyl-CoA sensitivity ... construct PMCPT1STOP–pBSSK+ as a template for a reaction with 216 the QuickChange Site-Directed Mutagenesis Kit (Stratagene) The primers used were DH801 (5¢-TTCTTCCGCCA AACCCTTAAGCTGCTGCTTTCCTAC-3¢) ... CPT1B with low sensitivity, as well as N-terminal switching experiments with the human (highly sensitive) CPT1B enzyme We show in this article that malonyl-CoA sensitivity is determined by the...
  • 9
  • 550
  • 0
Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt

Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt

Báo cáo khoa học

... ATCGATTACAAGGATGACGATGACAAGCTCATG-3¢ (sense), and 5¢- GTACAGCTTGTCATCGTCATCCTTG TAATCGATGTCATGATCTTTATAATCACCGTCATGG TCTTTGTAGTC-3¢ (antisense), and ligated into a blunted SphI site in MPP3 (introduced ... full-length MPP3 protein, the other a protein truncated after the SH3 domain (MPP3DGuK) The latter transcript was more abundant, but we did not detect MPP3DGuK protein in the retina The mRNA or the ... immunoprecipitation of Mpp3 with CPH8 antibody from mouse retinal lysates We detected efficient coimmunoprecipitation of Mpp5 (Fig 5B) Crb1 was below detection level in the Mpp3 immunoprecipitate The latter...
  • 14
  • 449
  • 0
Báo cáo khoa học: The antibody to GD3 ganglioside, R24, is rapidly endocytosed and recycled to the plasma membrane via the endocytic recycling compartment ppt

Báo cáo khoa học: The antibody to GD3 ganglioside, R24, is rapidly endocytosed and recycled to the plasma membrane via the endocytic recycling compartment ppt

Báo cáo khoa học

... suggesting that the GD3– R24 complex could not be disrupted in acidic organelles Taking all these antecedents together, it is plausible that the itinerary of the R24 antibody reflects the intracellular ... therapeutic use as it could not be linked to pathways of complement-dependent and cellular-dependent anticancer activity It would be possible to exploit the internalization feature for selective ... colocalized to a minor extent with the acidotropic probe in small acidic organelles, which probably represents endosomes These results suggest that little R24 antibody enters lysosomes or that the epitope...
  • 15
  • 329
  • 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Báo cáo khoa học

... localization and aggregation with consequent alteration of cell morphology We tested in vitro the possibility that substitution of C-terminal tyrosine of a-tubulin by 3nitrotyrosine alters the ability ... immunoblot) was very low (data not shown), indicating that almost all C-terminal tyrosine was substituted by 3-nitrotyrosine The possibility that the disappearance of nitrotyrosinated tubulin that occurred ... were similar to those of control cells (not treated with nitrotyrosine) (Fig 3B) The distribution of nitrotyrosinated tubulin, compared with total tubulin, in cytoskeletons was determined by double...
  • 9
  • 518
  • 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Báo cáo khoa học

... 5¢-TGTTAAGTTTGACCCGGAAATTATC 5¢-CCGGTCAGCCAGCTGCTG 5¢-TGATGGTGGGCATGGGTCAG 5¢-TACATGGTGGTGCCGCCAGA a-actin (Perkin-Elmer PCR system 9700) After competitive RT-PCR, a 10 -lL aliquot was electrophoresed ... performed using LA Taq (Takara, Japan) in a total volume of 50 lL containing 55 pg of competitor At this concentration, the band intensity of the amplified product from the competitor was same as that ... denote the MRE core sequence): MREa mut, 5¢-GGGCGCCaatGCCCCCGTTCC-3¢; MREe mut, 5¢-GGCCATTGGCTGGCCTTaatGCACAGCGGATCG ATTTTC-3¢; MREc mut, 5¢-CCAGTACAGTGTCGG AGCattCCAGCGCGAGGTGGCCG-3¢; MREd mut,...
  • 11
  • 628
  • 0
hack proofing coldfusion - the only way to stop a hacker is to think like one

hack proofing coldfusion - the only way to stop a hacker is to think like one

An ninh - Bảo mật

... com/v1/Handlers/index.cfm?ID=14165&Method=Full) for more details Functionality with Custom Tags and CFMODULE A little-used feature of the Custom Tag framework in ColdFusion is the ability to pass all attributes to the AttributeCollection ... where the ITS operating system came into play ITS went on to become the time-sharing system in longest continuous use ITS was written in Assembler, but many ITS projects were written in the language ... Chapter 10 Database Security Introduction Database Authentication and Authorization Authentication Authentication Settings Authorization Limiting SQL Statements in the ColdFusion Administrator...
  • 545
  • 734
  • 0
hack proofing xml - the only way to stop a hacker is to think like one

hack proofing xml - the only way to stop a hacker is to think like one

An ninh - Bảo mật

... element must have a start-tag and end-tag ■ The elements must be properly nested ■ The first letter of an attribute’s name must begin with a letter or with an underscore ■ A particular attribute ... doesn t protect against all weather conditions, either, but it does mitigate the harm that weather can cause a house I realized they had a point, and that idea became the overall goal of this ... the abstract Not to belittle coders, but this book isn t simply about code I’ve tried to be more inclusive in the ground that it covers.Tech writing often focuses on techniques to the exclusion...
  • 402
  • 413
  • 0
hack proofing your network, 2nd ed. - the only way to stop a hacker is to think like one

hack proofing your network, 2nd ed. - the only way to stop a hacker is to think like one

An ninh - Bảo mật

... the doors to the houses, the solution is to put more cops on the beat As the generation that will either turn security into an enabling technology, or allow it to persist as the obstacle that ... acceptable effort All that this dealt with was reconstitution and did not attempt to address the problems at hand Perhaps this would suffice in a small static environment with few users, but the ... understand what they will need to protect? What is the clue to what the next attack will be if it does not yet exist? Often it is an easy take if one takes an offensive research stance Look for the...
  • 826
  • 600
  • 0
“The hardest thing to see is what is in front of your eyes.” potx

“The hardest thing to see is what is in front of your eyes.” potx

Cao đẳng - Đại học

... bio-availability they will add to the collective knowledge that can Potential toxic effects (bio-toxicity) serve our world Every action, even the smallest Positive effects on the immune system in fighting ... sub-continent throughout the tropical and sub-tropical world, it has adapted itself to local conditions, resulting in many variations Thus, localized studies are needed to test the leaves’ nutritional ... Foundation, promoting sustainable development at the village level, for distribution in India They express with me their gratitude for this great opportunity to serve Balbir Mathur President Thank you...
  • 20
  • 476
  • 0
bankruptcy, is it the right solution to your debt problems 2nd (2004)

bankruptcy, is it the right solution to your debt problems 2nd (2004)

Quản lý nhà nước

... bankruptcy, something called the “automatic stay” goes into effect The automatic stay prohibits virtually all creditors from taking any action directed at collecting the debts you owe them unless the ... Bankruptcy: Is It the Right Solution to Your Debt Problems? OVERSIGHT BY THE U.S TRUSTEE’S OFFICE The U.S Trustee’s Office is a part of the United States Department of Justice It manages the bankruptcy ... particular creditor if that creditor convinces the court that the stay isn t serving its intended purpose: to freeze your assets and debts so that the court can deal with them This is also called...
  • 283
  • 523
  • 0

Xem thêm