wouldn t cost more but bill objected pointed out that it would take longer
Indirect Speech
... longer, ” Bill objected Tom assured us that it wouldn t cost more But Bill objected/ pointed out that it would take longer ● explain (to sb) that : giải thích (với ai) e.g : “The TV is broken,” the ... sb that : bảo đảm với e.g : It won t cost more, ” Tom assured us Tom assure us that it wouldn t cost more ● object that : phản đối e.g : It won t cost more, ” Tom assured us But it ll take longer, ” ... it again.” He said that the trip was too hard that he wouldn t ever take it again He remarked that the trip was too hard, and added that he wouldn t ever take it again He remarked that the trip...
- 15
- 654
- 3
Báo cáo y học: "Critical illness hyperglycemia: is failure of the beta-cell to meet extreme insulin demand indicative of dysfunctio" pot
... glucocorticoid therapy, contributed to the low insulin secretion will be essential in guiding future treatment strategies Competing interests The authors declare that they have no competing interests ... Critical Care Vol 13 No Steil and Agus Figure Blood glucose (BG) and C-peptide (CPEP) levels in children with (+) or without (-) critical illness hyperglycemia (CIH), with or without respiratory ... argument), or whether the higher exogenous insulin required to bring these patients to target is indicative of higher resistance Discerning whether beta-cell exhaustion, or events secondary to the...
- 2
- 167
- 0
The Rough Guide to Men’s Health doc
... Public Health Nutritionist Sarah works parttime as a nutrition scientist for the British Nutrition Foundation and as a consultant sports dietitian for Delia Smith and Norwich City Football Club ... to vary the fruit and veg you eat Too many people just eat the stuff they like day in day out and think that will It s better than nothing, but it won t give you the range of nutrients you need.” ... fully thawed before you start cooking If it isn t this could interfere with the time it takes to cook and it may not get done all the way through Don t put hot food in the fridge It will cause the...
- 386
- 612
- 0
The Concise Guide to Mergers, Acquisitions and Divestitures Business, Legal, Finance,Accounting, Tax and Process Aspects pdf
... greater than its liabilities This two-part test traces its history back to the dual structure of equity and law that existed in English courts at one time In equity courts, insolvency was tested ... should sit down with them and get their thoughts It will make them feel like a part of the team and that their input is important It also makes them more involved and thus more committed to buyer’s ... consideration to target, not its shareholders This accomplishes two things It means target continues It also means that acquirer can argue target had sufficient assets It was the distribution of the...
- 240
- 452
- 0
managing the development of lecturer staff of the vocational colleges to meet the demands of training human resources of mekong delta
... certain activities and the conditions for implementing activities that results in In other words, the competence is the sum of the unique attributes of personality suited to the requirements of a ... - It is oblidated to check the lecturer staff well and develop the lecturer staff exactly - It is oblidated to recruit the right vocational teacher with the standard, suitable skills, position ... to take the information widely - To prior recruite graduated students with good rate and excellent rate from Education University of technology, to be interested in recruiting the teachers, technicians...
- 27
- 328
- 0
Báo cáo khoa học: "Could pharmacogenetic data explain part of the interindividual sensitivity to methadone-induced respiratory depressio" pps
... differential binding of methadone to its variants [9], it is presently not possible to determine whether and to what extent this could influence sensitivity to respiratory depression In summary, studies ... PGP and the µ-opioid receptor would be interesting factors to consider in future investigations Competing interests The authors declare that they have no competing interests References At the pharmacodynamic ... needed to elucidate the interindividual variability in sensitivity to respiratory depression among opioid-dependant patients receiving methadone maintenance treatment In this regard, genetic polymorphism...
- 2
- 194
- 0
Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt
... stimulated with convulxin at the concentrations and times indicated Protein lysates were immunoprecipitated using an anti-Syk IgG and subjected to SDS/PAGE, then blotted to detect phosphorylated ... A third possibility is that the interaction of collagen with GPVI generates a signal that falls below the detection limits of the assays used in this system Collagen is a far weaker stimulus than ... of that required to activate platelets, whereas collagen is inactive [25] They also correspond to those of the present study in that collagen was inactive with GPVI-transfected K562 and Jurkat...
- 10
- 506
- 0
Báo cáo khoa học: The autophagic response to nutrient deprivation in the hl-1 cardiac myocyte is modulated by Bcl-2 and sarco⁄endoplasmic reticulum calcium stores ppt
... right) 3186 16 Fig Inhibition of lysosomal activity with the inhibitor cocktail (A) Inhibition of cathepsin B activity by lysosomal inhibitors Activity and intracellular distribution of cathepsin ... [39] It is interesting to note that the physiological implications of S ⁄ ER-targeted Bcl-2 in the cardiac myocyte are unclear Conditions that trigger preferential recruitment of Bcl-2 to the ... 1DBcl2BD would compete with Beclin for interaction with Vps34, and in the case of overexpression, would act as a competitive inhibitor Pattingre et al [14] showed that autophagosome content was negatively...
- 14
- 444
- 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx
... between pig, human and rat CPT1B is the substitution of glutamate by aspartate at position 17 To show that this substitution might act as a negative determinant for the low malonyl-CoA sensitivity ... construct PMCPT1STOP–pBSSK+ as a template for a reaction with 216 the QuickChange Site-Directed Mutagenesis Kit (Stratagene) The primers used were DH801 (5¢-TTCTTCCGCCA AACCCTTAAGCTGCTGCTTTCCTAC-3¢) ... sensitivity was attributable to the C-terminal fragment of the enzyme Therefore, we demonstrate here that the N-terminal fragment of CPT1B plays a specific role in malonyl-CoA sensitivity As the...
- 9
- 550
- 0
Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt
... ACAAAGACCATGACGGTGATTATAAAGATCATGAC ATCGATTACAAGGATGACGATGACAAGCTCATG-3¢ (sense), and 5¢- GTACAGCTTGTCATCGTCATCCTTG TAATCGATGTCATGATCTTTATAATCACCGTCATGG TCTTTGTAGTC-3¢ (antisense), and ligated into a blunted ... (lane 1), indicating specific association Note that the input signal was not detectable at this exposure (C) Mpp3 was coimmunoprecipitated with Dlg1 (lane 2), but not with control normal mouse ... immunoprecipitation of Mpp3 with CPH8 antibody from mouse retinal lysates We detected efficient coimmunoprecipitation of Mpp5 (Fig 5B) Crb1 was below detection level in the Mpp3 immunoprecipitate The latter...
- 14
- 449
- 0
Báo cáo khoa học: The antibody to GD3 ganglioside, R24, is rapidly endocytosed and recycled to the plasma membrane via the endocytic recycling compartment ppt
... represents endosomes These results suggest that little R24 antibody enters lysosomes or that the epitope for the R24 antibody is rapidly lost on transport into lysosomes To evaluate further whether the ... 2B, the inhibitors could not prevent cellular depletion of R24 antibody Taken together, these results indicate that most of the R24 antibody is not targeted to and degraded in lysosomes after its ... acidification is a prerequisite for the actual formation of the carrier structures that move the TGN proteins (TGN38 or furin) from the endosome back to the TGN [25] In an attempt to learn more about...
- 15
- 329
- 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... immunoblot) was very low (data not shown), indicating that almost all C-terminal tyrosine was substituted by 3-nitrotyrosine The possibility that the disappearance of nitrotyrosinated tubulin that occurred ... position and shape with authentic 3-nitrotyrosine (data not shown) These results, cumulatively, indicate that nitrotyrosine is incorporated as such into the C-terminus of the a-tubulin subunit, ... density of each band stained with antibodies to Glu- and nitrotyrosinated tubulin by that of an identical sample stained with DM1A antibody Capabilities of nitrotyrosinated and Tyr-tubulin to...
- 9
- 518
- 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... suggest that transcriptional activator proteins that regulate expression of the WD gene may bind to MREa Identification of proteins that interact specifically with MREa We next performed EMSAs to determine ... promoter activity Further investigation is needed to elucidate the exact reason why the most distal MREa from transcription start site is important for activity, especially in a TATA-less promoter ... construct pGL indicates the luciferase activity in cells that had been transfected with the pGL as a negative control NC, Negative control transfected with the same amount of pBluescript SK instead...
- 11
- 628
- 0
hack proofing coldfusion - the only way to stop a hacker is to think like one
... com/v1/Handlers/index.cfm?ID=14165&Method=Full) for more details Functionality with Custom Tags and CFMODULE A little-used feature of the Custom Tag framework in ColdFusion is the ability to pass all attributes to the AttributeCollection ... Chapter 10 Database Security Introduction Database Authentication and Authorization Authentication Authentication Settings Authorization Limiting SQL Statements in the ColdFusion Administrator ... where the ITS operating system came into play ITS went on to become the time-sharing system in longest continuous use ITS was written in Assembler, but many ITS projects were written in the language...
- 545
- 734
- 0
hack proofing xml - the only way to stop a hacker is to think like one
... may not be possible to be totally black or white It would be as hard for a black hat to nothing but evil as it would for a white hat to stay totally pristine (Some of the more strict white hats ... was an intellectual pursuit In fact, at the time, several companies existed that sold software that would defeat copy protection, but they did not distribute other people’s software.They would produce ... element must have a start-tag and end-tag ■ The elements must be properly nested ■ The first letter of an attribute’s name must begin with a letter or with an underscore ■ A particular attribute...
- 402
- 413
- 0
hack proofing your network, 2nd ed. - the only way to stop a hacker is to think like one
... the doors to the houses, the solution is to put more cops on the beat As the generation that will either turn security into an enabling technology, or allow it to persist as the obstacle that ... and monitoring systems, not to mention unlimited copies of the software What if the software detects that it has been modified? Remove the portion that detects modification.What if the software ... acceptable effort All that this dealt with was reconstitution and did not attempt to address the problems at hand Perhaps this would suffice in a small static environment with few users, but the...
- 826
- 600
- 0
“The hardest thing to see is what is in front of your eyes.” potx
... powerful tool to combat global malnutrition It would be a tool provided by nature at practically no cost and at the very doorsteps of the people who need it most For this to happen, additional scientific ... bio-availability they will add to the collective knowledge that can Potential toxic effects (bio-toxicity) serve our world Every action, even the smallest Positive effects on the immune system in fighting ... nutrition, these leaves could prevent the scourge of malnutrition and related diseases To top it off, Moringa is a fast-growing, drought-resistant tree that grows even in marginal soils and with...
- 20
- 476
- 0
bankruptcy, is it the right solution to your debt problems 2nd (2004)
... important on a credit application, the creditor may claim that you committed fraud and that you should therefore not be allowed to discharge your debt to that creditor When the trustee and creditors ... for a particular creditor if that creditor convinces the court that the stay isn t serving its intended purpose: to freeze your assets and debts so that the court can deal with them This is also ... necessities 2/8 Bankruptcy: Is It the Right Solution to Your Debt Problems? On the flip side, if you aren t realistic about what it costs to live that is, you’ve understated your expenses so that...
- 283
- 523
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25