at fmr fax report revision id
A Closer Look at Air Pollution in Houston: Identifying Priority Health Risks pptx
... standard if and when it is promulgated Particulate matter is a applicable to the Houston situation and population combination of solid, liquid, and solid-liquid particles suspended in air, and ... individuals as well ride, acetaldehyde, ethylene dichloride, naphthalene, arsenic as contributing to premature death It was also determined that compounds, carbon tetrachloride, ethylene oxide, ... and then divide it by the unit Uncertain category, along with the pollutants in the residual risk estimate This means that the air concentration at each of group without unit risk estimates or reference...
- 58
- 375
- 0
Báo cáo y học: "Clinical review: Drotrecogin alfa (activated) as adjunctive therapy for severe sepsis – practical aspects at the bedside and patient identification Pierre-François Laterre and Xavier Wittebole" pdf
... three patients had an ICH (one patient receiving the placebo and two receiving drotrecogin alfa [activated]) [1] For these latter patients, clinically evident disseminated intravascular coagulation ... increased incidence of natural bleeding events Because most treatment associated bleeding deaths occurred in this Finally, drotrecogin alfa (activated) may influence naturally occurring coagulation ... complication of any drug that has anticoagulant properties There are few pub- lished data on the natural incidence of ICH in severe sepsis Oppenheim-Eden and coworkers [13] reported an incidence...
- 6
- 312
- 0
Strategies for teaching business report writing to language students at thang long university
... such as sales reports, quarterly reports as examples of information reports, annual reports, audit reports as examples of analytical reports, and feasibility reports, problem-solving reports as ... type Reports, in general, are documents that present and organize ideas on a specific topic The ideas in reports are gathered from reading or conducting primary research Business reports are widely ... types of short reports, progress reports, trip reports, investigative reports and trouble reports I.3.3 RHETORICAL ANALYSIS OF BUSINESS REPORTS In her course book to business communication, Northey...
- 90
- 1,187
- 2
FIELD TRIP REPORT AT KOVINA CO., LTD
... Monitoring the situation of materials, managing raw material strictly and economical norm Responsible for the procurement and allocations of materials used within the company to cater for all requirements ... that I learnt at university to satisfy requirements of clients But besides advantages, I also faced with many disadvantageous things I limited by my English skills and I have to face it.That ... Technology Building materials and plans every month,quarter, year, business contracts for procurement of materials prevention, care materials to ensure continuous,balanced and materials for the production...
- 9
- 806
- 6
Identifying common errorss in written english of students of english at the intermediate level
... motivated to acquire proficiency in it What is more, when learners are highly motivated, they will form positive attitudes toward second language learning This shows that motivation and positive attitudes ... what the students attain is unconscious application of rules during the process of composition when their attention is mostly directed to the ideas to be communicated In order to achieve automatic ... supports of the learners overall orientation Motivation can be classified into instrumental motivation and integrative motivation Learners with instrumental motivation is more interested in how second...
- 38
- 478
- 0
Tài liệu Incentive Compensation Practices: A Report on the Horizontal Review of Practices at Large Banking Organizations pdf
... to identify only their equivalent of individual covered employees, often using materiality standards that restrict attention to a relatively small number of individuals 19 sation programs that ... Implementation Standards We have indicated our intent to follow the comple- mentary principles of effective consolidated supervision and national treatment of banking organizations operating in ... consolidated regulator’s expectations and those of the interagency guidance As noted, the interagency guidance is consistent with international regulatory efforts on incentive compensation practices,...
- 34
- 686
- 0
Tài liệu Báo cáo khoa học: Shaped by the environment – adaptation in plants Meeting report based on the presentations at the FEBS Workshop ‘Adaptation Potential in Plants’ 2009 (Vienna, Austria) pdf
... ecological niches, including commensal and pathogenic isolates, has revealed that mutation rates vary between isolates [6,7] and, furthermore, that mutation rates are not constant but can increase ... regulation of phosphate starvation responses in Arabidopsis With plants that either had a phosphate-sufficient or phosphate-deficient shoot, a split root system was used to investigate phosphate ... diseases, such as diabetes or rheumatoid arthritis, based on data generated by the HapMap project [26], genome-wide association studies also provide a powerful means of identifying alleles and loci...
- 10
- 666
- 0
Tài liệu Báo cáo khoa học: It is all about resolution Meeting report based upon presentations at the 10th International Global BioMillennium 2006 symposium on molecular cell biology (Tbilisi, Georgia) docx
... features The symmetry relates the RNA backbone to nucleotide orientation, but shows no sequence homology This demonstrates the superiority of function over sequence conservation, suggesting that ... Post-translational regulation was discussed by Aaron Ciechanover (Haifa, Israel), who argued that the ubiquitin proteolytic system covers the pathway for elucidating the basic mechanisms that are ... localization DAP-kinases (DAPk), Ca2+ ⁄ calmodulin-regulated and Ser ⁄ Thr kinases, activate signaling pathways that lead to cell death through membrane blebbing and autophagic cell death Two...
- 4
- 510
- 0
Summary Report of Issues Identified in the Commission Staff’s Examinations of Select Credit Rating Agencies potx
... arrive at the rating and identify the factors that led to the ultimate rating There was also a lack of documentation of committee actions and decisions At one rating agency, the vote tallies of rating ... credit rating that indicate: (1) the identity of any credit analyst(s) that participated in determining the credit rating; (2) the identity of the person(s) that approved the credit rating before ... formally review/validate derivatives models prior to posting for general use The rating agency did not provide documentation demonstrating management follow-up Current Regulatory Requirements:...
- 39
- 448
- 0
2009 Utah Sentinel Events Data Report: Identifying Opportunities for Improvement doc
... report The purpose of this report is to provide information on the sentinel event data collected from January-December 2009 by the Utah Department of Health Facilities participating in the data ... events can be devastating experiences to patients, their families, and their healthcare providers Identification of these events across hospitals and ambulatory surgical centers provides opportunity ... experiences and data Additionally, in late 2008, the reporting process changed from a faxed document and manual data entry done by the UDOH Patient Safety Director to a secure, web-based reporting portal...
- 9
- 363
- 0
Womenís Health Surveillance Report: A Multi-dimensional Look at the Health of Canadian Women potx
... PROBLEMS Data Gaps and Recommendations The authors identified the following data gaps and made the following recommendations: • Data on prevalence, and morbidity and mortality rates relating to ... following data gaps and made the following recommendations: • The overall lower rate of hospital morbidity among women indicates that their morbidity may be less acute and that they may make greater ... health indicators that can be routinely collected and analyzed in population-based surveys For example, data that adequately capture the complexity of issues that women face in terms of occupation...
- 102
- 1,660
- 0
Demographic and clinical characteristics of tuberculosis: A report of 2404 cases at a referral hospital pot
... marital status, 731 (30.4%) patients were single, separated or widowed With regard to the level of education, 520 (21.6%) had an incomplete elementary school education or were illiterate, 1277 ... (that is, resistance to at least isoniazid and rifampin) was 3.9% Drug-induced hepatotoxicity was identified in 41 (1.7%) of the patients DISCUSSION To gain a better understanding of the epidemiology ... association between tuberculosis and poverty (Creswell et al., 2011) The data regarding level of education, occupation and employment status characterize the social situation of the population...
- 5
- 548
- 0
Maternal and Child Health Services Title V Block Grant State Narrative for Idaho Application for 2013 Annual Report for 2011 pot
... population center Approximately 66% of Idaho's population reside within one of the seven population centers This tendency for the state's population to radiate from these urban concentrations ... for 2011 IDT records usually reflect deaths at the scene of an accident and therefore will be lower than subsequent death certificate data 2011 population data by age not available at time of ... - 2010 Data source is 2009 Idaho PRATS survey Data for 2010 not available at time of submission PRATS is a representative sample of resident women aged 18+ who gave birth in Idaho Numeration and...
- 84
- 344
- 0
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf
... glutamate 324 as the catalytic carboxylate of propionate CoA-transferase As the sequence analysis did not allow an unequivocal identi®cation of the catalytic glutamate of propionate CoAtransferase, ... propionate CoA-transferase from C propionicum was generated using CLUSTALW The most likely candidate for the catalytic glutamate of propionate CoAtransferase based on these data was glutamate 324 ... dehydration of (R)-phenyllactate to (E)-cinnamate by Clostridium sporogenes Eur J Biochem 267, 3874±3884 10 Rochet, J.C & Bridger, W.A (1994) Identi®cation of glutamate 344 as the catalytic residue...
- 9
- 498
- 0
The digital company 2013 Freedom to collaborate - A report from the Economist Intelligence Unit Sponsored by: AT&T, Nokia, PricewaterhouseCoopers, SAP pptx
... provide individual employees with greater control over the information they can access This means that control of information will be taken out of the hands of managers Wider access to information ... the organisation and the outside world are diminishing CIOs will ignore what is happening outside the organisation at their peril, says Mr Kreiken of KLM He argues that the corporate infrastructure ... exactly what information they want and how they plan to use it Mr Watson of Virgin Media says that data from different sources can be usefully combined to provide valuable new information: “One...
- 35
- 421
- 0
Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc
... CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG ... CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGTATTCTGCTGCCCACACCAG 2B4F33Y 2B7Y33 L 2B7Y33F ... UGT2B7, in combination with a marked difference in substrate specificity, especially towards steroid substrates, was favorable for attempting to pinpoint the amino acid residues that are critical...
- 9
- 343
- 0
Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt
... reaction The ATP-dependent phosphorylation of 3-phosphoglycerate was catalyzed by phosphoglycerate kinase and the 1,3-bisphosphoglycerate formed was reduced by NADH to GraP by Gra3P DH; the oxidation ... residue at the active center of various enzymes, and also our findings that TNBS inactivates EAC cell Gra3P DH, prompted us to use PP also for the identification of the essential amino acid at ... residue(s) essential for activity, the statistical method of Tsou [23] was used to calculate the number of essential lysine residues for inactivation If we assume that all the n modifiable residues...
- 8
- 283
- 0
CEEH Scientific Report No 3: Assessment of HealthCost Externalities of Air Pollution at the National Level using the EVA Model System docx
... an estimated 1.4% of premature deaths, or 0.5% of disability-adjusted-life-years lost (Ezzati et al., 2002) In particular, studies indicate that PM causes approximately 3% of deaths attributable ... health and related external costs Estimates of delta-concentrations are combined with address-level population data for Denmark and gridded population data for the rest of Europe, to calculate the ... database was extracted for the year 2000, chosen as the base year for the EVA system, see figure Address data was interpolated to the DEHM grid to obtain gridded population data For each grid...
- 98
- 634
- 0
The University of North Carolina at Chapel Hill Climate Change Committee Report 2009 pptx
... observational data are represented by “climate normals” (1971-2000) tabulated by the National Climatic Data Center Climate normals are average temperatures over a 30-year period Monthly temperature ... coastal state such as North Carolina The evidence is both physical and statistical The physical evidence demonstrates that hurricanes in our current climate originate when sea surface temperatures ... natural dynamics of the climate, but not at times that correspond to real El Niños A similar phenomenon is the Atlantic Multidecadal Oscillation, or AMO This is a cyclic fluctuation in the Atlantic...
- 197
- 216
- 0
Báo cáo khoa học: From functional genomics to systems biology Meeting report based on the presentations at the 3rd EMBL Biennial Symposium 2006 (Heidelberg, Germany) Sergii Ivakhno pot
... also provides a natural method for integration of different biological data Transcription regulatory networks I begin by describing talks that addressed analysis of transcription regulatory networks ... Walhout described an alternative ‘gene-centred’ approach for elucidating transcription regulatory networks, which uses a high-throughput gateway-compatible yeast one-hybrid (Y1H) system [18] Y1H ... to analyze information flow in Drosophila signal-transduction pathways One of the key considerations in such screens is the choice of appropriate read-out assays that can accurately assess the...
- 10
- 478
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008