a the contemporary role and scope of power and litigationalfairness theories
Báo cáo y học: "The contemporary role of blood products and components used in trauma resuscitation" pdf
... in association with injury The presence of predictors of coagulopathy has been suggested by historical data from the United States and the Dries Scandinavian Journal of Trauma, Resuscitation and ... initiates coagulation as endothelial injury at the site of trauma leads to exposure of subendothelial collagen and Tissue Factor which bind von Willebrand factor, platelets and activated Factor VII ... thawed plasma or administering Type AB or Type A plasma in emergencies These resources may only be available in major trauma centers A more readily available and concentrated coagulation factor...
- 17
- 429
- 0
Báo cáo khoa học: The metabolic role and evolution of L-arabinitol 4-dehydrogenase of Hypocrea jecorina potx
... regulation of other genes On the other hand, the lack of growth of the wildtype strain on D-allitol and L-iditol may either be due to a lack of uptake of these hexitols, or due to a lack of lad1 ... contrast to the role of Lad1 in the alternative D-galactose degrading pathway in H jecorina shown in this paper, and may explain the transient accumulation of up to 400 mM galactitol during its action ... monosaccharides available in their environment (e.g L-arabinose, D-xylose) A comparison of the substrate specificity of Lad1 with that of mammalian SDHs shows that Lad1 has a much higher catalytic...
- 9
- 422
- 0
The dynamic role and performance of baitul maal wat tamwil islamic community based microfinance in central java
... ATM automatic teller machine BAPPEDA BadanPerencanaan Pembangunan Daerah (Local Development Planning Agency) BASN BadanArtitraseSyariahNasional (Islamic Arbitrate Council) BAZNAS BadanAmil Zakat ... uniqueness of Yogyakarta as a special province in the era of autonomy and the role of the Sri Sultan Hamengkubuwono X as a governor and also a descendent of the Mataram ruling family Second, to analyse ... (BMT Association) ADB Asian Development Bank AGM annual general meeting APBN AnggaranPenerimaandanBelanja Negara (National Budget) API ArsitekturPerbankan Indonesia (Indonesian Banking Architecture)...
- 326
- 314
- 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx
... accgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctg ctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A, 5¢-ggacaa ctttgaatgggcggagggttatattgag-3¢ The incorporation of mutations was verified by DNA ... E19 0A, 5¢-caacgagcctagagcgatttgctttgagg-3¢; mutation E190Q, 5¢-caa cgagcctagacagatttgctttgagg-3¢; mutation E19 4A, 5¢-gagagattt gctttgcgggttatggatctgc-3¢; mutation K20 1A, 5¢-gttatggatctgct accgcggctccgatcctaaacg-3¢; ... Journal compilation ª 2008 FEBS L M F Mendonca and S R Marana ¸ Following the characterization of the binding of different types of aglycone, a comparative analysis of the mutational effect on their...
- 12
- 731
- 0
Tài liệu Báo cáo khoa học: A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio Role of the seventh histidine and accessibility to the active site docx
... tyrosinase from Rastonia solanacearum environmental pH, may also affect the expression of the most appropriate enzyme Apart from the physiological roles and environmental advantages of having several ... structure data 266 ´ D Hernandez-Romero et al The only data so far available are for sweet potato (Ipomoea batata) catechol oxidase [26] The catalytic copper center is accommodated in a central four-helix ... extracts as starting material The purified peaks of the two PPOs showed purities greater than 90%, as judged by SDS ⁄ PAGE, and apparent molecular masses of the active enzymes of 35 and 50 kDa...
- 14
- 849
- 0
Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc
... higher rates than usual radical rearrangements [98,312] On the other hand, the timing of radical rearrangement (radical clocks) may depend critically on the tightness of the radical cage and the ... Corina, D & Akhtar, M (1996) The mechanism of the acyl-carbon bond cleavage reaction catalyzed by recombinant sterol 1 4a- demethylase of Candida albicans (other names are: lanosterol 1 4a- demethylase, ... permit the unmasking of radical intermediates that rearrange at a rate faster than that of the recombination step [16,93] Despite the apparent predominance of the hydrogen transfer mechanism as the...
- 26
- 746
- 0
The Making of a European Constitution Judges and Law Beyond Constitutive Power docx
... Seeing into the mind of European law ‘Seeing into the mind of law and lawyers’ is not an easy task In particular, and as a part of its integral vocation to remain ‘apart’ from the society that it serves, ... interventionism and integration, which is beholden to extra-legal aims and values and which has measurable impacts within a real-world of societal organisation Law exists at the very heart of a contradiction ... safeguarded by a professionally irreproachable and apolitical cadre of European lawyers The independence and, above all, the professionalism of Europe’s lawyers is also a factor within the following...
- 257
- 364
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... PP2500 and ANKHD1 variant In this study we focus on the biochemical and functional characterization of the novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...
- 12
- 561
- 0
The Role and Responsibilities of Accounting Officers: A Memorandum for Accounting Officers pdf
... records and the safeguarding of the assets owned or controlled by them 13 1.13 C&AG Audits of Departmental Accounts other than the Appropriation Accounts and the Finance Accounts Apart from the Appropriation ... of preparing the Appropriation Accounts The 1866 Act remains the statutory basis for the preparation of the Appropriation Accounts and for the appointment of Accounting Officers (although the term ... Comptroller and Auditor General to control on behalf of the State all disbursements and to audit all accounts of moneys administered by or under the authority of the Oireachtas” and that the C&AG “shall...
- 43
- 480
- 0
Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc
... Plant VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO GMC GMC GMC Succinate dehydrogenase Succinate dehydrogenase DAAO DAAO DAAO DAAO ? ? VAO AMO AMO DAAO DAAO ... Plant Plant Bacteria Plant Plant Fungus Bacteria Bacteria Bacteria Plant Bacteria Animal Fungus Yeast Yeast Bacteria Bacteria Plant Bacteria Fungus Fungus All Bacteria Animal Animal Bacteria Bacteria ... Bacteria Bacteria Fungus Bacteria Animal Animal Fungus Bacteria Animal Bacteria Plant Bacteria Bacteria Plant allergens BG6 0a [55] and Phl P 4a [165] Tetrahydrofuran monooxygenase reductase component...
- 23
- 564
- 0
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB ... properties The kinetic parameters of the PA-catalysed hydrolysis of the studied phenylacetyl arylamides are compared in Table The substrates are arranged in a decreasing order of the ratio of their ... reasonable explanation of the PA activity with substrates like PhAc-pAB, PhAc-mAB, PhAc-oAB vs phenylacetyl 4-nitroanilide (PhAc-pNA), NIPAB and iso-NIPAB, but it suggests an explanation of the...
- 8
- 438
- 0
Báo cáo Y học: Conformationally constrained human calcitonin (hCt) analogues reveal a critical role of sequence 17–21 for the oligomerization state and bioactivity of hCt ppt
... binding a nities, and the hypocalcemic potencies in vivo of hCt, sCt, analogues 1–6 and/ or the partial sequence analogues 1a, 1b, 2a, and 3a The CD data of the partial sequence analogues 1a, 1b, 2a, ... that the overall secondary structure of was very similar to the ones of 1, 3, and In contrast, the CD studies of the partial sequence analogues showed that the Asp17,Lys21-lactam bridge and the ... technical assistance with the cell culture and the receptor binding assay We thank N Greenfield for the CD programs We thank S Stoeva and and her group for the the MALDI-MS and H Bartholoma and R...
- 12
- 448
- 0
báo cáo sinh học:" The role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and Zambia" pdf
... proposal, discussions, data analysis and review of the article SH, ETAES and HM were involved in data collection, discussion and review of article All authors have read and approved the final manuscript ... proposal, designed the questionnaires and initiated and participated in discussions, data analysis and writing of the article LB participated in the conceptualization of the project, design of the ... proportion of the health workforce globally In most countries, they are the first, and often the only, point of contact for patients, and in many rural areas they often provide as much as 80% of required...
- 8
- 628
- 0
Báo cáo khoa học: "Hepatic splenosis mimicking HCC in a patient with hepatitis C liver cirrhosis and mildly raised alpha feto protein; the important role of explorative laparoscopy" potx
... demonstrating a solitary cm hypervascuArterial (A) segment venous phase Arterial (A) and portal venous phase (B) of IV Gadlinium enhanced axial MRI images demonstrating a solitary cm hypervascular ... investigation of this lesion, and better assessment of the extent of the disease Diagnostic laparoscopy demonstrated a cm exofitic dark brown splenunculus attached to the diaphragm and indenting the ... scan1 CT scan (A) Axial IV contrast enhanced CT Arterial phase image showing a × 2.7 cm hypervascular, subcapsular nodule in segment VII of the liver (B) Portal venous phase image Page of (page...
- 4
- 451
- 0
báo cáo khoa học:" Endoscopically assisted procedure for removal of a foreign body from the maxillary sinus and contemporary endodontic surgical treatment of the tooth" ppt
... the action of the cilia that continue to clear mucus toward the natural ostium It is possible that the foreign body dislocated near the maxillary natural ostium created an antral inflammation of ... left maxillary sinus Computed tomography scan (coronal plane) showing the foreignof the upper first the supero medial aspect of the maxillary Figure sinus and partial mucosal thickening of the ... view of the foreign body in the supero medial aspect of the maxillary sinus Intraoperative endoscopic view of the foreign body in the supero medial aspect of the maxillary sinus Figure Intraoperative...
- 5
- 420
- 0
Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx
... endotracheal intubation, mechanical ventilation, therapeutic hypothermia, and various intravenous pharmacological infusions [10,11] Therefore, with the rapid use of AEDs by random bystanders, the ... the usual scenario of aggressive ICU care, invasive assessments and a myriad of consultations was pre-empted for a large percentage of those patients who, traditionally, would have required them ... magnitude of the public health impact of AEDs is potentially dramatic, in terms of both life-saving and ICU resources In summary, the use of AEDs by the average person may be considered one of...
- 3
- 280
- 0
a research into the role and the use of first language in general-english classes at hanoi university of industry = nghiên cứu về vai trò và việc sử dụng ngôn ngữ thứ nhất trong các lớp học tiếng anh cơ bản
... their ability to teach Another reason it is impractical is that to enforce the sole use of the TL can often lead to a reduced performance on the part of the teachers, and the alienation of students ... could be the time when the teacher asked students about weather and asked them about the weather that day, as well as the weather in different regions of Vietnam Students also asked teacher for ... supporters of the Monolingual Approach have stated that translating between L1 and L2 can be dangerous as it encourages the belief that there are to equivalents between the languages, which is not always...
- 50
- 956
- 2
A research into the role and the use of first language in General-English classes at Hanoi University of Industry
... reason the researcher focused on vocabulary acquisition is that the acquisition of vocabulary has a central role in learning a second language (Sökmen, 1997), and is of great significance to language ... However, there seems to be an increasing conviction that the first language (L1) has a necessary and facilitating role in the second and foreign language (L2) classroom Many English language professionals ... The study of Ringbom in 1987 clearly indicates that L1 clearly has a very important role to play in the deliberator learning vocabulary (Nation, 2001) Auerbach (1993) claims that the use of the...
- 9
- 554
- 2
A plague o both your houses medicine, power and the great flu of 1918 1919 in britain and singapore
... meant that practitioners slowly acquired and projected the authority to re-shape what disease entailed and what it meant to be sick New germ theories of disease and the advantages of laboratory ... the same time and place; Italians called these outbreaks influenza di catarro or influenza di febbre scarlattina.16 The English and Americans assigned the names the gentle correction’ and the ... Overshadowed by World War One and possessing little of the horrors and stigma of cholera and bubonic plague, the Great Flu provoked a re-examination and refinement of the status quo rather than a...
- 107
- 569
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25