4 determining the compression type of a segment
Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc
... such as prostate, mucosal glands of the tracheobronchial tree, nasal mucosa and sweat glands [25] Human tear lipocalin has significant sequence homology with the human forms of OBP and, at least ... of the absorbance at 223 nm The number of HNE covalent adducts ⁄ equivalent of OBP was finally calculated by subtracting the values determined in the ultrafiltrates from the initial amounts of ... HNE was bound entirely within the barrel of OBP The immediate and quantitative displacement of HNE by undecanal indicates that, as expected in the case of binding equilibria, the formation of reversible...
- 12
- 386
- 0
Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx
... 3 .47 3 .47 3. 64 3.65 3.87 4. 24 4.32 4. 07 4. 10 4. 33 4. 52 4. 21 4. 12 4. 35 4. 47 3.35 3 .40 3.61 3.67 3 .49 3.60 3 .42 3 .44 4. 09 4. 09 4. 14 3.65 3.78 3.68 3.75 3.63 3.67 4. 32 4. 28 3. 94 4.05 4. 23 4. 25 3 .48 ... as well as a trace amount of terminal Rha These data could be accounted for by the attachment of KdoIII in OSNaOH-II to the same position of one of the Glc residues as Rha in OSNaOH-I, whereas ... at d 41 .0, three nitrogen-bearing carbons (C2 of Ala, GalN and GlcN) at d 50.3, 51.0 and 56.8, carbonyl groups of the acyl groups and a carboxyl group (C1) of KdoI at d 172–176 and an O-carbamoyl...
- 10
- 325
- 0
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx
... studies revealed that a small amount of 4- kDa peptide is localized around the plasma membranes and cell walls [9] The subcellular localization of 4- kDa peptide is similar to that of the 43 -kDa protein, ... TGCATGT-3¢; the 4- kDa peptide C-terminal primer: 5¢-AAGAATTCTTATTATCCAGTTGGATGTATGCA GAA-3¢ The amplified sequence was cloned into the plasmid pKF18 via the EcoRI and SalI restriction sites in the ... which are similar to the animal systems Yamauchi, F., Sato, K & Yamagishi, T (19 84) Isolation and partial characterization of a salt-extractable globulin from soybean seeds Agric Biol Chem 48 , 645 –650...
- 8
- 386
- 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
... to the American Association for Accreditation of Laboratory Animal Care guidelines The Wyeth Institutional Animal Arai et al Journal of Translational Medicine 2010, 8:51 http://www.translational-medicine.com/content/8/1/51 ... were among the "inventoried" assays available from ABI, and are described in Table cDNA synthesis, preparation of samples for TLDA assay and measurements of RNA concentration were performed as ... developed a human blood biomarker assay that detects the blocking activity of Ab-01, an antibody to IL21R In parallel we have developed an adaptation of this assay and used it to demonstrate that the...
- 13
- 528
- 0
Báo cáo hóa học: " The Cramer-Rao Bound and DMT Signal Optimisation for the Identification of a Wiener-Type Model" pptx
... diagram of the application of a nonlinear canceler of the hybrid echo for an ADSL transceiver system tones in the input signal and of a finite number of samples for the estimation of the model parameters ... variance σu = 0. 64 The figure reveals that there is a high covariance between the linear parameters and the third-order parameters That corresponds to the known fact that even in the case of a ... averaged over all parameters are given in Table The following remarks can be made (1) One observes that the variance gain in Table is larger than the gain in Table obtained by the exact method of...
- 14
- 294
- 0
Báo cáo toán học: "The number of elements in the mutation class of a quiver of type Dn Aslak Bakke Buan" pps
... explicit formula for the number of equivalence classes in the mutation class of any quiver of type An was given in [T] The Catalan number C(i) can be defined as the number of triangulations of an i+2-gon ... that all quivers obtained in this way are quivers of cluster-tilted algebras of type An This means that we can define a function γn from the mutation class of An to the set of all triangulations ... to a triangulation • The Auslander-Reiten translation of a diagonal from a to b is given by clockwise rotation of the diagonal if a = b If a = b the AR-translation is given by clockwise rotation...
- 23
- 300
- 0
Báo cáo y học: " Genetic characterization of the complete genome of a highly divergent simian T-lymphotropic virus (STLV) type 3 from a wild Cercopithecus mona monkey" ppt
... that the alanine mutation at aa position 94 of the STLV-3d(Cmo8699AB) Rex may also have a similar loss of biologic activity The effects of these changes on the processing of viral transcripts and ... ATC CAG GCG PGPOLR1 GGY RTG IAR CCA RRC IAG KGG CCA 1360 8699GF21 AGA TGT CCT CCA GCA ATG CCA AAG PGPOLR2 GRY RGG IGT ICC TTT IGA GAC CCA 992 Outer 7867GPF2 TCC ACA GAA AAA ACC CAA TCC ACT 8699ETF2R ... CCA ACC CCA TCC CCA AGG PGPOLR1 GGY RTG IAR CCA RRC IAG KGG CCA 2687 P5GF2 AAA GGG CTA GCA ATT CAC CAC TGG P3GR1 GAT AGG GTT ATT GCC TGG TCC TTG ATA 1770 Outer 8699GF20 ACC CCC CCA GTA AGC ATC...
- 17
- 231
- 0
Báo cáo y học: "Mutations in matrix and SP1 repair the packaging specificity of a Human Immunodeficiency Virus Type 1 mutant by reducing the association of Gag with spliced viral RN" ppsx
... RNA in the SL1 deletion virion was replaced by host RNA and that the virion maintained an RNA level similar to that of wild type To characterize the cellular RNA packaged into the wildtype and ... mRNA compared to the wild type; 3- to 5-fold less HIV-1 mRNA was associated with the revertant Figure Characterization of the association between Gag and HIV-1 RNA (A) Measurement of the association ... dimerization state and splicing of viral RNA (A) Dimerization analysis of virion RNA Virion RNAs of different proviral constructs were separated on a native agarose gel and characterized by Northern...
- 12
- 300
- 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 4
... Downstream, 100 mm lateral offset WHM WHM X = 10 m X=0m Figure F4: Wave height monitors in the wave tank at (a) x=-0. 84 m, (b) x=+0. 84 m, (c) x=+9. 24 m for waves only, downstream cylinder placed at ... increment at steady state beating Wave only, T = 0.7 s run Downstream cylinder placed at x = ½ D, y = 373 Appendix H Iso Surface Plots of Numerical Wave Tank Figure H1 Iso surface plots of wave and ... T=0.7s, at time intervals of T’ (At Stable Beating Downstream cylinder spacing at x = ½ D, y = 0) Figure H12 Iso surface plots of wave only run, T = 0.7s, at time intervals of T’ (At Steady State...
- 57
- 228
- 0
ON THE AUTOMORPHISM GROUP OF A CERTAIN INFINITE TYPE DOMAIN IN C 2
... Institute for Advanced Study in Mathematics (VIASM) He would like to thank the VIASM for financial support and hospitality It is a pleasure to thank Tran Vu Khanh and Dang Anh Tuan for stimulating discussions ... a point of infinite type , J Geom Anal DOI 10.1007/s12220-015-9565-y Department of Mathematics, Vietnam National University at Hanoi, 3 34 Nguyen Trai, Thanh Xuan, Hanoi, Vietnam E-mail address: ... domains of infinite type , Tohoku Math J (2) 46 (19 94) , no 3, 43 5 44 2 [22] S Krantz, “ The automorphism group of a domain with an exponentially flat boundary point”, J Math Anal Appl 385 (2012),...
- 18
- 322
- 0
The Marketing Strategy of a multinational join stock company.doc
... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...
- 25
- 623
- 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
... default None Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn ... 12 .4: Rule ENUMERATION MEMBERS CONSTANT DESCRIPTION Cascade Indicates that the delete or update to the DataRow objects in the parent DataTable are also made in the child DataTable This is the ... Indicates that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable...
- 6
- 428
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Linguistics 144 Rada Mihalcea 2005 Unsupervised large-vocabulary word sense disambiguation with graph-based algorithms for sequence data labeling In Proceedings of the Joint Conference on Human Language...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A 141 Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q 146 A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... Hiraoka, B.Y., Yamakura, F., Sugio, S & Nakayama, K (2000) A change of the metal-specific activity of a cambialistic superoxide dismutase from Porphyromonas gingivalis by a double mutation of ... Beauchamp and Fridovich [42 ] Protein concentration Estimation of the concentration of purified protein or in the lysates was by the method of Bradford using BSA as standard [43 ] Protection against...
- 12
- 740
- 0
Đề tài " The homotopy type of the matroid grassmannian " ppt
... him that I received the bulk of my mathematical education Also, THE HOMOTOPY TYPE OF THE MATROID GRASSMANNIAN 951 Bob MacPherson was a great source of advice and inspiration Lastly, I am deeply ... matroid of rank k, and the basic philosophy of the subject is that these oriented matroids alone carry a great deal of information about the smooth structure of the manifold So far, of course, we have ... Because it will always be clear from the context what k and n are, the use of the symbol π to denote each of these maps should cause no confusion THE HOMOTOPY TYPE OF THE MATROID GRASSMANNIAN...
- 25
- 404
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... adjustments D 140 N D 142 N, Asn 142 ÔupÕc D215N Q 144 E Q 144 E, no substrate Q 144 E, Asp 142 ÔdownÕ Q 144 E, no substrate, Asp 142 ÔdownÕ Q 144 E, D 140 N Q 144 E, D 142 N Q 144 E, D215N Mutation compared to wildtype ... that in the presence of the substrate, rotation of Asp 142 towards Glu 144 lowers the pKa of the latter by 0.8 pH units The calculated effects of the D 140 N and D215N mutations varied drastically ... experimentally accessible pH range, regardless of the position of Asp 142 (pKa values are < 0.0 and 15.2 to > 20.0; Table 3, rows 1, 5–8) The pKa of Asp 140 is much lower than that of Asp 142 and Glu 144 ...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... first is a selection of data from CoNLL20 04 and contains 8936 sentences The second dataset is part of the Lancaster Treebank corpus and contains 147 3 sentences Each sentence contains hand-labeled ... Creation of a parse tree involves describing language grammar in a tree representation, where each path of the tree represents a grammar rule Consider a sentence from the Lancaster Treebank4 :...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Grassl, M (1981) Action pattern of human pancreatic alpha-amylase on maltoheptaose, a substrate for determining alpha-amylase in serum J Chromatogr 223, 69– 84 ´ ´ Farkas, E., Janossy, L., Harangi, ... were calculated according to the data of Table The arrow indicates the location of hydrolysis The reducing end of maltooligomers situated at the right hand of the subsite map Negative energy values...
- 6
- 387
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [ 34] The final model has a final R-factor of 0.222 with a ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... free radicals at the surface of the epidermis Biochem Biophys Res Commun 136, 630–637 16 Nakamura, H., Matsuda, M., Furuke, K., Kitaoka, Y., Iwata, S., Toda, K., Inamoto, T., Yamaoka, Y., Ozawa,...
- 9
- 533
- 0
- issues involved when updating the primary key of a parent row
- the benefits of a hierarchy
- the five parts of a letter
- finding the main idea of a passage
- finding the main idea of a paragraph
- view the html source of a web page
- the unsupervised acquisition of a lexicon from continuous speech
- the basic structure of a sentence in spanish would be which one of the following
- explain the legal requirements of a contract of employment
- type the five parts of a thank you letter
- determining the main idea of a passage
- the following factors may be relevant to determining the appropriate level of financial penalty to be imposed on a person under the act
- 4 viewing the nested members of a group
- 8 changing the scope or type of a group
- 4 the id type is a generic pointer type
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ