determining the main idea of a passage
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
... to the American Association for Accreditation of Laboratory Animal Care guidelines The Wyeth Institutional Animal Arai et al Journal of Translational Medicine 2010, 8:51 http://www.translational-medicine.com/content/8/1/51 ... 10.1186/1479-5876-8-51 Cite this article as: Arai et al., Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R ... developed a human blood biomarker assay that detects the blocking activity of Ab-01, an antibody to IL21R In parallel we have developed an adaptation of this assay and used it to demonstrate that the...
- 13
- 528
- 0
a study on the main features of short jokes and implications for teaching speaking to students of grade 12 at ngoc tao upper secondary school
... two main categories on the basis of Attardo‟s and Oaks; classifications: lexical and syntactic ambiguity The latter was further divided into class ambiguity and a miscellaneous class of ambiguities, ... A lot of women don’t care who wear the pants in the family, as long as there is money in the pockets Have a look at another example: (15) The friendly gardener had a lot of thyme for the woman ... Pharaoh‟s Court 81 Q What‟s black and white and read all over? A A newspaper 82 A friend in need is a friend to avoid 83 A lot of women don‟t care who wear the pants in the family, as long as there...
- 57
- 672
- 0
The Marketing Strategy of a multinational join stock company.doc
... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... about a multinational join stock company’s product quality or the quality of the maintenance work that its staff have done, but has complained about the late reply and maintenance service of the ... companies including a multinational join stock company Secondly, a multinational join stock company size and market share have been small The shortage of capital is main cause of the company’s...
- 25
- 623
- 8
Computer illiteracy as one of the main problem of business student
... first alternative of solving the problem, what can we suggest? We have another alternative, which is called “Simplification of access to computer classes.” We mean the organization of computer classes ... for them, instead of learning how to it themselves The third cause is lack of access to computer The fourth cause is dissatisfactory school base The fifth cause is insufficient allocation of application ... The problem of computer illiteracy as a one of main problems of business students Symptoms The main symptom of the computer illiteracy is an inability in computer working For example,...
- 4
- 351
- 0
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...
- 6
- 428
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... active site of the enzyme by reducing the occupied internal volume, allowing the introduction of an extra water molecule [29] Replacement of the same residue by Ala similarly maintains the same...
- 12
- 740
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...
- 6
- 387
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a...
- 9
- 533
- 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...
- 8
- 551
- 0
Báo cáo " DETERMINING THE ISOMERIC RATIO OF NUCLEAR REACTION 46 Ti (γ, pn)44 Sc BY EXPERIMENT" pdf
... bremsstrahlung irradiated in to the sample, Nm and Ng are the number of nuclei in the metastable and the ground state Figure Production and decay of the metastable and the ground state In gamma spectra, ... and λg are the decay constants of these states, Pm,g is the branching ratio for the decay of metastable to ground state, N0 is the number of target nuclei, φ(t) is the flux of beam per 1cm2 of bremsstrahlung ... Figure Gamma spectrum of 44 Sc measured by Gammavision Spectrometry 3.2 Calculation of typical peak area In the gamma spectrum of 44 Sc, there are two spectral peaks with energies of 271keV created...
- 6
- 300
- 0
Báo cáo " DETERMINING THE ISOMERIC RATIO OF NUCLEAR REACTION 46 Ti (γ, pn)44 Sc BY EXPERIMENT " docx
... bremsstrahlung irradiated in to the sample, Nm and Ng are the number of nuclei in the metastable and the ground state Figure Production and decay of the metastable and the ground state In gamma spectra, ... and λg are the decay constants of these states, Pm,g is the branching ratio for the decay of metastable to ground state, N0 is the number of target nuclei, φ(t) is the flux of beam per 1cm2 of bremsstrahlung ... Figure Gamma spectrum of 44 Sc measured by Gammavision Spectrometry 3.2 Calculation of typical peak area In the gamma spectrum of 44 Sc, there are two spectral peaks with energies of 271keV created...
- 6
- 214
- 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
... studying the influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are ... Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation of laser parameters influences clearly on the transformation ... reveals that the increase of one mode photon density caused in the decrease of the other one Fig 1a Gain coefficient α1 varies Fig 1b Gain coefficient α2 varies D.V Hoang, M.H Hanh / VNU Journal...
- 4
- 343
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... notion can be extended to arbitrary domains on the sphere C; it suffices to replace the Euclidean area with the spherical area in the growth condition (2.7) David proved that the analogue of the measurable ... neighborhood of U {x(U )}, where x(U ) is the root of U The boundary of each puzzle piece P consists of a rectifiable arc in A( ∞) and a rectifiable arc in J(F ) The latter arc starts at an iterated preimage...
- 53
- 383
- 0
Đề tài " The diameter of the isomorphism class of a Banach space " pdf
... Tzafriri, Classical Banach Spaces I Sequence Spaces, -index of a Banach space, Israel J Springer-Verlag New York (1977) [Mc] R A McGuigan, Jr., Near isometry of Banach spaces and the Banach-Mazur ... lemma follows from Lemma and the the classical fact that every separable Banach space 1-embeds into C[0, 1] Lemma is false for some nonseparable spaces Partington [P] and Talagrand [T] proved that ... paper is a solution to Sch¨ffer’s problem for a separable Banach spaces: Main Theorem If X is a separable infinite dimensional Banach space, then D(X) = ∞ Part of the work for proving the Main Theorem...
- 16
- 376
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of ... represents the first example of the effects of an antimicrobial peptide from frog skin on the proteome of bacteria, and demonstrates that the bacterial membranes are the major targets of its mechanism of...
- 18
- 494
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25