4 4 một số chỉ tiêu về thân lá của các tổ hợp lai
Báo cáo y học: "Challenging the spliceosome machine" pot
... 32-63 (8,695) 64- 127 (6,911) 128-255 (2,072) 256-511 (1,883) 512-1,023 (1, 545 ) 1,0 24- 2, 047 (1,1 64) 2, 048 -4, 095 (9 64) 4, 096-8,191 (613) 8,192-16,383 (367) 1.8 1.6 1 .4 1.2 1.8 1.6 1 .4 1.2 1 0.8 0.8 ... 1.6 1 .4 1.2 1 0.8 0.8 0.6 0.6 0 .4 0 .4 0.2 32-63 (8,695) 64- 127 (6,911) 128-255 (2,072) 256-511 (1,883) 512-1,023 (1, 545 ) 1,0 24- 2, 047 (11 64) 2, 048 -4, 095 (9 64) 4, 096-8,191 (613) 8,192-16,383 (367) ... 1.8 1.6 1 .4 1.8 1.6 1 .4 1.2 1.2 1 0.8 0.8 0.6 0.6 0 .4 0 .4 0.2 32-63 (509) 64- 127 (3,123) 128-255 (7,122) 256-511 (5,989) 512-1,023 (4, 8 64) 1,0 24- 2, 047 (2,309) 2, 048 -4, 095 (43 2) 0.2 0 -2 -1 A 10...
- 15
- 164
- 0
Báo cáo y học: " A suboptimal 5'''' splice site downstream of HIV-1 splice site A1 is required for unspliced viral mRNA accumulation and efficient virus replication" pptx
... (1.2.5.7, 1.2.3.5.7, 1.2.3.4b/a.7, & 1.2 .4. 7) was observed in NLD2UP-transfected cells when compared to NL4-3-transfected cells (Fig 1C, compare lanes and 4) Similarly, within the 4. 0 kb incompletely ... 2001, 29(2) :46 4 -47 8 Tange TO, Damgaard CK, Guth S, Valcarcel J, Kjems J: The hnRNP A1 protein regulates HIV-1 tat splicing via a novel intron silencer element Embo J 2001, 20(20):5 748 -5758 Madsen ... NL4-3, and cells transfected with NLD2UP utilized 3'ss A2 approximately two-fold more efficiently than NL4-3-transfected cells (Fig 1I and 1K) Only small differences in splicing at HIV1 3'ss A4a,...
- 10
- 283
- 0
Báo cáo y học: " The strength of the HIV-1 3'''' splice sites affects Rev function" doc
... #931 #932 #936 #939 # 940 # 941 # 942 # 943 # 945 # 946 # 947 # 948 #985 #986 #1065 #1088 #1089 #1091 #1183 #12 24 #1225 #1388 #1389 # 148 1 # 148 2 # 148 3 # 148 4 # 148 6 # 149 2 #1 542 #1 544 #1586 #1587 #1590 #1591 ... A [5][4ab] [4c] [4ab] [4c] [4ab] 4c [5] [5] [5]4a [5] 4b TGTACCAATTGCTATTGTAAAAAGTGTTGCTTTCATTGCCAAGTTTGTTTCATGACAAAAGCCTTAG A A T A A A A A A A4cab [5] [4ab] [5] [5] [4ab]4c [5]4a [5]4b A5 AAAAAGTGTTGCTTTCATTGCCAAGTTTGTTTCATGACAAAAGCCTTAGGCATCTCCTATGGCAG ... citation purposes) Retrovirology 2006, 3:89 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 for the Rev dependence of env mRNA J Virol 19 94, 68:2986-2993 Fischer U, Meyer S, Teufel...
- 20
- 284
- 0
Báo cáo y học: "Impairment of alternative splice sites defining a novel gammaretroviral exon within gag modifies the oncogenic properties of Akv murine leukemia virus" pdf
... 32619 341 32702311 44 7 345 42 553699 34 5793 346 1 97386196 1322200 04 1 346 99599 138050107 39921672 651790 64 750 746 42 1079663 64 121838 640 141 077075 29717975 40 821 642 40 955151 544 25558 7 244 1620 840 16089 ... 246 41886 3 640 6157 78 743 292 82855932 930 148 94 93022552 12022 647 6 130 341 056 135878316 135882183 1396 045 57 144 940 508 163725782 17 347 63 64 1 743 50588 182219328 11 542 293 13133178 35270 244 44 741 201 46 263959 ... 61 240 727 61 240 729 73 548 838 79567673 79728 346 9 044 5122 2390 646 2 240 49008 240 86635 241 0 147 0 241 52772 241 78252 32 049 420 52388367 66 248 77 11630998 36597927 49 537999 63705275 713898 94 746 140 66 11 242 422 12368360...
- 19
- 178
- 0
Báo cáo y học: " Characterization of a new 5'''' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein" pot
... of 17 (page number not for citation purposes) Retrovirology 2008, 5:22 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 expression of envelope glycoproteins on the cell surface Journal of Cell ... evidence for a B/D-type assembly pathway in a C-type lentivirus replication Virology 2001, 286 :43 4 -44 5 Lairmore MD, Akita GY, Russell HI, DeMartini JC: Replication and cytopathic effects of ovine ... S.5% ES 0DU1 0DU6 Figure junction between SD6 140 and SA85 14 sites occurs in CAEV-infected cells Splicing Splicing junction between SD6 140 and SA85 14 sites occurs in CAEV-infected cells A, Proviral...
- 17
- 422
- 0
Báo cáo y học: " Violating the splicing rules: TG dinucleotides function as alternative 3'''' splice sites in U2-dependent introns" docx
... Genome Biology 2007, 8:R1 54 http://genomebiology.com/2007/8/8/R1 54 13 15 16 18 19 20 22 24 25 27 28 29 31 33 34 40 41 42 43 44 45 46 47 48 49 50 51 52 Genome Biology 2007, 8:R1 54 information 32 39 ... 131 CTG,GAGTTGCAG| 0.62 SMARCA4 29 61 74 TTG,ACCCTGAAG| 0 .41 34 FBXL10 15 177 TTG,GCCTACAAG| 0.21 HNRPR 2839 TTG,GTTTAACAG| 0.13 15 RRAD 2 14 CTG,ATCCCCTAG| 0.06 TGM1 45 4 10 CTG,TCCTGGGCAG| 0.13 ALAS1 ... TNNT2 43 54 TTG,GAG| 0. 04 CACNA1A 2532 TTGTTG,GAG| ?† - 2532 TTG,TTGGAG| 0.17† - GPBP1 1377 CAG|GATG, 0.03 KIAA 049 4 145 9 TTG,AGCAG| 0.09 OSBPL8 36530 CTG,TTGTAG| 0.11 SAP30 1892 CTG,TTTCAG| 0. 04 DRD2...
- 11
- 259
- 0
The Position of Marketing Within High-Tech Companies
... (GFNs), 45 46 Growth phase, 41 48 compatibility, 44 46 defined, 36 global, 47 investment more than competitors, 47 managing, 183 open architecture and, 43 44 production cost minimization, 46 47 sales, ... innovation-driven, 1 34 38 market-driven products, 133, 138 42 methods, 133 42 Nokia case study, 146 47 summary, 152–53 time and, 150–52 Market segments defining, 142 evaluating, 142 45 most significant, 143 potential, ... feedbacks, 248 decision, 242 differentiation and, 257 elasticity of demand, 242 44 limits, determining, 242 49 in marketing strategy, 239 models, 241 by product range, 257–58 smart, 247 summary,...
- 44
- 439
- 0
Tài liệu Module 3: Building Sample Sites pptx
... introduce the lab Lead-in In this lab, you will create a Web Site for an art institute Objectives Explain the lab objectives To create a data-driven Web site for an art institute After completing this ... To introduce the lab Lead-in In this lab, you will create a Web Site for a publishing house Explain the lab objectives To create a data-driven Web site for a publishing house Objectives After...
- 12
- 438
- 0
Tài liệu E-business Part 1 of 3 ppt
... Portals that offer more specific information within a single area of interest • WebMD 44 22 Vertical portals 45 “Knowledge Portal” Internet Portal Employees as Customers Customers Served Industry ... Portals that offer more specific information within a single area of interest • WebMD 42 21 Horizontal portals 43 Portal Model • Portal sites • Give visitors the chance to find almost everything ... Reserved.) 40 20 Auction Model (cont.) Placing a bid on eBay (These materials have been reproduced by Prentice Hall with the permission of eBay, Inc COPYRIGHT © EBAY, INC All Rights Reserved.) 41 Portal...
- 27
- 350
- 0
Tài liệu E-Business Part 2 of 3:Internet Marketing ppt
... brand recognition Marketing 4Ps ?Product ?Price ?Place ?Promotion Marketing Ws + H ?Who ?What’s ?Where ?When ?Why ?How Internet Marketing Research • Marketing mix includes (4Ps): • • • • Product or ... visitors • Space can be more expensive during high traffic • Exchanging banners with another site 14 Banner Advertising (cont.) 15 Buying and Selling Banner Advertising • Buy advertising space on ... ranks the site according to that visit’s findings 22 11 META Tags (cont.) 23 META Tags (cont.) 24 12 Search-Engine Registration • Submit keywords and a description of business • Search engine...
- 15
- 379
- 0
Tài liệu E-business Part 3 of 3: Online industries pptx
... Examples: • • • • • UPS FedEX DHL Direct Trucking.net Getloaded.com 13 Transportation and Shipping 14 Online Automotive Sites • Consumers access automobile information empowering them to make an informed ... Online Real Estate Apartments.com can help you find an apartment (Courtesy of Apartments.com.) 24 12 Online Legal Services • Libraries of data available to people with a few mouse clicks • Arbitration ... the Web • Examples: • Whitehouse.gov 27 Government Online(cont.) The white house home page.) 28 14 Government Online(cont.) 29 Insurance Online • Insurance is complicated, the Web offers instruction...
- 19
- 343
- 0
Tài liệu Build Your Own ASP.NET 3.5 Web Site Using C# & VB, 3rd Edition docx
... Web Site Using C# & VB (www.sitepoint.com) 2 24 2 24 228 2 34 235 236 238 240 241 245 xiii Validation Groups 248 Updating Dorknozzle ... 343 10 Displaying Content Using Data Lists 41 3 11 Managing Content Using Grid View and Details View 44 1 12 Advanced Data Access 48 3 13 Security and User Authentication 545 ... 342 Chapter ADO.NET 343 Introducing ADO.NET 344 Importing the SqlClient Namespace 346 Build...
- 219
- 1,369
- 0
Tài liệu Critical Miscellanies (Vol. 3 of 3) Essay 10: Auguste Comte ppt
... MACMILLAN COMPANY 19 04 CONTENTS AUGUSTE COMTE PAGE Introduction 337 Influence of Saint Simon 340 Marriage 343 Serious illness 345 Official work 347 Completion of Positive Philosophy 349 J S Mill 350 ... 371 Decisive importance of intellectual development 373 Historical elucidations 3 74 Their value and popularity 3 74 Social dynamics in the Positive Polity 375 The Positivist system 376 The key to ... Mill persuaded Grote, Molesworth, and Raikes Currie to advance the sum of £ 240 At the end of the year (that is in 1 845 ) Comte had taken no steps to enable himself to dispense with the aid of the...
- 23
- 367
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... Fe[A 141 Q] Fe[Q69G/A 141 Q] 1100 (100) 86 (7.8) 122 (11) 363 (33) 3 048 (100) 241 (8) 366 (12) 801 (26) 2605 227 45 7 965 (100) (8) (17) (37) 3500 1620 5285 49 29 41 53 8257 (100) ( 84) (0) (167) a Manganese ... Biochem 44 , 276–287 43 Bradford, M.M (1976) A rapid and sensitive method for quantitation of microgram quantities of protein utilising the principle of protein binding Anal Biochem 72, 248 –2 54 44 Amann, ... Biol 246 , 531– 544 13 Parker, M.W & Blake, C.F (1988) Crystal structure of manganese superoxide dismutase from Bacillus stearothermophilus at 2 .4 ˚ A resolution J Mol Biol 199, 649 –661 14 Ludwig,...
- 12
- 740
- 0
Tài liệu Báo cáo Y học: Prediction of protein–protein interaction sites in heterocomplexes with neural networks ppt
... structure of the nucleotide exchange 31 32 33 34 35 36 37 38 39 40 41 factor GrpE bound to the ATPase domain of the molecular chaperone DnaK Science 276, 43 1 43 5 Bukau, B & Horwich, A.L (1998) The Hsp70 ... crystalline state Proteins 41 , 47 –57 16 Valdar, W.S.J & Thornton, J.M (2001) Protein–protein interfaces: analysis of amino acid conservation in homodimers Proteins 42 , 108–1 24 Ó FEBS 2002 Predicting ... Number of Proteins Contact 70 Noncontact Q2 C P(c) Q(c) P(nc) Q(nc) 0.73 0 .43 0.72 0.560 0.73 0.85 50 40 30 20 10 0.35 0 .4 0 .45 0.5 0.55 0.6 0.65 0.7 0.75 0.8 0.85 0.9 0.95 Accuracy (Q2) sequence...
- 6
- 454
- 0
Tài liệu Báo cáo Y học: Study of substrate specificity of human aromatase by site directed mutagenesis pdf
... 100 ± 23 8 24 100 ± 27 71 50 113 ± 43 76 ± 30 605a 657 56 ± 19 87 ± 21 51a 84 7a 47 20a 287 109 34 91 89 67 3 041 ± NC1 NC1 NC1 NC1 NC2 1727 ± 2671 ± NC1 3 240 ± 48 64 ± 40 64 ± 149 6 ± 247 3 ± 2127 ... K119T K119Y K119V K119E C124Y K130N F320C H475N H475R H475A H475E I125M S470N I471M I474T A Km.app (nM) 1 64 ± NC1 NC1 NC1 NC1 NC2 186 ± 125 ± NC1 47 2 ± 179 ± 57 ± 151 ± 147 ± 111 ± NC2 NC2 68 ± ... value with 4OHA, used as control, was 0 .45 ± 0.35 lM with the wild-type protein IC50 (lM) Protein MR208 14 MR2 049 2 MR2 049 4 Wild-type K119Y K119V K119E C124Y K130N F320C I474T H475A D476N D476E 10.83...
- 13
- 506
- 0
Hinduism And Buddhism, Volume II. (of 3) An Historical Sketch docx
... CHAPTER XVII 16 ring.] [Footnote 41 : Translated into Chinese 270 A.D.] [Footnote 42 : Chaps XI and XIII.] [Footnote 43 : A special work Maủjusrợvikrợdita (Nanjio, 1 84, 185) translated into Chinese ... translated into Chinese between 147 and 186 A.D., the lesser work of the same name translated in 40 2 A.D and the Sỷtra of meditation on Amitõyus[83] translated in 42 4 The first of these works purports ... to No 399 and Julien, _Mộthode_, 1007 and Vasilief, p 175.] [Footnote 144 : See Sikshõs, ed Bendall, pp 8,91 and _Hoernle, Manuscript remains_, I pp 125 ff.] [Footnote 145 : Mahõyõna-sỷtrõlankõra,...
- 191
- 422
- 0
Hinduism and Buddhism, Vol I. (of 3) An Historical Sketch doc
... doctrines but an intellectual, hereditary aristocracy who claim to direct the thought of India whatever forms it may take All who admit this claim and accord a nominal recognition to the authority ... Padma Sambhava from India in 747 marks the real foundation of the Lamaist church It was reformed by the Hindu Atisa in 1038 and again by the Tibetan Tsong-kha-pa about 140 0 The Grand Lama is the ... practical rulers of Tibet for seventy years (1270-1 340 ) Another period of disintegration followed but after 1630 the Grand Lamas of Lhasa were able to claim and maintain a similar position Mongolian...
- 243
- 409
- 0
Báo cáo khoa học: Characterization of HbpR binding by site-directed mutagenesis of its DNA-binding site and by deletion of the effector domain pot
... C J Bacteriol 175, 42 67 42 73 Buck M, Gallegos MT, Studholme DJ, Guo Y & Gralla JD (2000) The bacterial enhancer-dependent r 54 (rN) transcription factor J Bacteriol 182, 41 29 41 36 10 Kustu S, North ... wild-type hbpR gene cloned in vector pACYC1 84 (pHYBP1 24) [5], cotransformed either with pHB1 64 or with pHB172 As a control we used the same E coli DH5a (pHYBP1 24) cotransformed with pHYBP103, which ... acid, 5.1 gÆL)1 of Mops sodium salt, 0.5 gÆL)1 of NaCl, gÆL)1 of NH4Cl, 0.06 gÆL)1 of Na2HPO4Æ2H2O, 0.05 gÆL)1 of KH2PO4, mm MgSO4, 0.1 mm CaCl2, 0.2% (w ⁄ v) glucose, pH 7] Purification of HbpR...
- 11
- 468
- 0
- đánh giá một số chỉ tiêu vệ sinh thú y trên thịt heo và sản phẩm chế biến từ thịt heo tại thành phố kon tum tỉnh kon tum
- một số chỉ tiêu về chi phí sản xuất kinh doanh của doanh nghiệp
- giá thành sản phẩm và một số chỉ tiêu về giá thành của doanh nghiệp
- một số chỉ tiêu về tính giá thành sản phẩm
- biểu 5 một số chỉ tiêu về vốn kinh doanh
- một số chỉ tiêu về công ty tranco
- tổng hợp một số chỉ tiêu về công ty
- nhiên để có thể đánh giá chính xác hơn chúng ta hãy xem xét một số chỉ tiêu về chất
- bảng3 6 một só chỉ tiêu về tài chính
- nghiên cứu ảnh hưởng của chế phẩm em boklash đến hệ vi sinh vật đường tiêu hóa chất thải và một số chỉ tiêu vệ sinh môi trường chăn nuôi gà
- kết quả nghiên cứu một số chỉ tiêu về khả năng sản xuất của ngan pháp r71 nuôi tại trung tâm nghiên cứu vịt đại xuyên
- nghiên cứu một số chỉ tiêu về sinh trưởng và cấu tạo thể hình của đàn bê cái hậu bị và đàn bò tơ hướng sữa nuôi tại huyện đông triều tỉnh quảng ninh 41
- dõi một số chỉ tiêu về sinh trưởng của bê và đàn bò sữa của huyện đông triều tỉnh quảng ninh ở các lứa tuổi từ sơ sinh đến 36 tháng tuổi gồm các chỉ tiêu 42
- nghiên cứu một số chỉ tiêu về sinh trưởng và cấu tạo thể hình của đàn bê cái hậu bị và đàn bò tơ hướng sữa nuôi tại huyện đông triều tỉnh quảng
- 4 4 một số chỉ tiêu lâm sàng của lợn nái mắc bênh viêm tử cung
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25