12 4 sell securities under the regulation a exemption
Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 4 doc
... personal data from the databases ” The above scenarios are scary enough, but consider additional possibilities like sexual harassment suits and industrial espionage, and the legal risks mount Organizations ... Cybersitter and NetNanny are two programs that are geared largely at the home market, but are used in some smaller organizations These programs are installed on the client computer and they maintain ... Firewall, McAfee Firewall, and ZoneAlarm Firewall Corporate firewalls usually combine hardware and software CheckPoint Firewall, Raptor Firewall, and Gauntlet Firewall are examples of corporate...
- 33
- 534
- 0
Tài liệu MARKETING PLACES- CONCEPTS ABOUT A PLACE UNDER THE PERSPECTIVE OF MARKETING PLACES pdf
... (structure) analysis Establish a position in the industry Create an advantage Act early to take advantage of structural changes Sustain the advantage Global competition Competitive advantage of companies ... Session 14: Sustain the Growth of Places 49 A What main challenges the places are facing? Places are threatened more and more by the increasing pace of changes in the economic, political and technological ... historical and national elements − A central city and surrounding residential areas − A market with identifiable attributes − A base for local industry, and an agglomorate of quasi industrial trades...
- 32
- 513
- 0
Tài liệu Controlling Fine Particulate Matter Under the Clean Air Act: A Menu of Options pdf
... Fine Particulate Matter Under the Clean Air Act: A Menu of Options About STAPPA and ALAPCO The State and Territorial Air Pollution Program Administrators (STAPPA) and the Association of Local Air ... 202-6 24- 78 64; fax: 202-6 24- 7863; email 4cleanair@4cleanair.org) or visit our associations’ web site at www.4cleanair.org About STAPPA and ALAPCO v Introduction The State and Territorial Air Pollution ... Officials (ALAPCO) are the two national associations of air quality officials in the states, territories and major metropolitan areas throughout the country The members of STAPPA and ALAPCO have...
- 291
- 385
- 0
Tài liệu Báo cáo khoa học: A role of miR-27 in the regulation of adipogenesis ppt
... were treated as described in (A) Total RNA was prepared at the indicated times and subjected to quantitative real-time PCR analysis The data shown are mean value ± standard errors of the mean from ... EBPa (NM_007678), forward primer 5¢-CGCAA GAGCC GAGATA AAGC-3¢, and reverse primer 5¢-CGGTC ATTGT CACTG GTCAA CT-3¢; for C ⁄ EBPb (NM_009883), forward primer 5¢-AA GCT GAGCG ACGAG TACAA GA-3¢, and ... primary antibodies: polyclonal rabbit anti-PPARc, anti-C ⁄ EBPa, anti-C ⁄ EBPb (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and anti-PPARa (Zymed Laboratories, South San Francisco, CA, USA),...
- 11
- 848
- 0
Báo cáo khoa học: The catalysis of the SARS 3C-like protease is under extensive regulation by its extra domain doc
... activity had a small apparent molecular mass (32.6 kDa), indicating that Asn214Ala had a dominant tendency to form a monomer Therefore, at least four regions of the SARS 3CLp might be significantly associated ... super-active mutant had an SARS 3C-like protease regulation by its extra domain Fig The apparent molecular mass (m) of the wild-type and mutated SARS 3C-like protease (SARS 3CLp) The apparent ... revealed that the mutants in the first group plus Asn214Ala had spectra with sharper resonance peaks than the wild-type protease, consistent with the observation that these mutants had significantly...
- 11
- 265
- 0
Hygeia, a City of Health, by Benjamin Ward Richardson This eBook give it away or re-use it under the terms of the Project Gutenb doc
... The Black Death, though its name is gone, lingers in malignant typhus The great plague of Athens is the modern great plague of England, scarlet fever The dancing mania of the Middle Ages and the ... specially provide against it; that the development of disease may occur with original virulence and fatality, and may at any moment be made active under accidental or systematic ignorance A CITY ... generations, has attained a vitality not perfectly natural, but approaching to that standard In an artistic sense it would have been better to have chosen a small town or large village than a city...
- 116
- 376
- 0
Air pollution and Climate Change - Report from a workshop under the Swedish EU Presidency doc
... h.apsimon@imperial.ac.uk Jenny Arnell jenny.arnell@ivl.se Katja Jusen Kristin Mohammad Christian Asmussen Asuka Aunan Aurangojeb Azar Richard Ballaman Andreas Lars Mark Jean-Guy Ellen Barkman Barregård Barrett ... Bartaire Baum kaasm@mst.dk asuka@cneas.tohoku.ac.jp kristin.aunan@cicero.uio.no aurangot@yahoo.com christian.azar@chalmers.se richard.ballaman@bafu.admi n.ch andreas.barkman@eea.europa eu lars.barregard@amm.su.se ... ApSimon may.ajero@cai-asia.org cecilia.akselsson@nateko.lu.s e nadine.allemand@citepa.org amann@iiasa.ac.at kjell.andersson@naturvardsve rket.se ulf.andersson@gu.se camilla.andersson@smhi.se h.apsimon@imperial.ac.uk...
- 51
- 534
- 0
The Eugenic Marriage, Vol 2 (of 4), by W. Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Pro pptx
... when a miscarriage is threatened— Treatment of threatened miscarriage— Treatment of inevitable miscarriage— After treatment of miscarriage The tendency to miscarriage Page 187 The Baby CHAPTER ... temporary incidents, but that they may be regarded as practically incurable in the vast majority, because of antagonistic social conditions and ignorance, and that they are highly infectious, we may ... the long ago, may state, "Oh, yes, I had a chancre twenty-five years ago, but it was a very small affair and soon healed up and was cured." Yet that same little chancre, that made only a mild impression...
- 634
- 1,044
- 0
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
... identical patterns and it was therefore concluded that the same polysaccharide was present A hydrolysate of the upper phase, analyzed as alditol acetates, revealed as D-glucose, D-galactose, D-galactosamine, ... repeating unit of the polysaccharide thus contains a terminal NeuAc, and the above mentioned residues A comparison to the methylation analysis data on the O-polysaccharide, indicates that the ... an upper phase, the latter containing most of the material SDS/PAGE of the two materials Fig SDS/PAGE of the upper phase (1) and the pellet (2) obtained on ultracentrifugation of the Hafnia alvei...
- 7
- 463
- 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG ... CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG ... primer mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R TGGCACTGATTTTGGCTCCT...
- 16
- 462
- 0
a history of rome under the emperors
... Notes Others appear suo loco only Standard abbreviations are used for classical authors and texts: the reader may consult e.g the Oxford Classical Dictionary for these AA: Auctores Antiquissımi AE: ... the Caesarian-Augustan period, which the Republican age leads into (and it has already been stressed that treatment of the latter would need to be substantially curtailed), and second on the age ... Berlin, Ahornallee 40 ’ They contain the history of Rome from Caesar’s war in Africa, regarded by Mommsen as the ‘beginning of the monarchy and the end of the Republic’ [MH.I, 1] up to the Batavian...
- 660
- 237
- 0
assessment of the stress and strain levels at geometrical discontinuities under elastoplastic conditions a case study
... 350 375 40 0 42 5 45 0 47 0 53 106 159 212 2 64, 98 317,52 365,75 40 0,28 42 1,65 43 6,03 44 6,73 45 5,29 46 2 ,44 46 8,61 47 4,06 47 8,95 48 3 ,4 487 ,49 49 0, 54 0,0007 0,0015 0,0022 0,0030 0,0037 0,0 045 0,0053 0,0063 ... fringe value at the specimen border On the notch root a isochromatic fringe value of magnitude 2 .46 was obtained As the nominal stress is known from the section area and the applied loads, a theoretical ... T 745 1 As expected, these graphs show, for both materials, the strains under plane stress state are higher than under plane strain The plane stress state also give strain levels higher than what...
- 9
- 410
- 0
báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc
... profiling allows an individualized DNA-base approach to cancer therapy The therapeutic potential of the DTA-H19 vector was tested in a rat animal tumor model for colorectal liver metastases showing ... of DNAbased therapy for human ovarian cancer related ascites The successful development of anti-tumor gene therapy depends on the use of a combinatorial approach aimed at targeted delivery and ... drafted the manuscript AC participated in the study design and coordination TL participated in the analyses of the ovarian ascites fluid SA participated in the in vitro studies JG participated in the...
- 11
- 559
- 0
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx
... software Another healthy mice were used as control The total tumor area of each bladder was determined and the mean of the total areas was calculated for each group The Mean and SD of bladder ... the RNA STAT-60TM Total RNA/mRNA isolation reagent, according to the manufacture’s instructions The RNA was treated by RNAse-free DNAse I to eliminate any contaminating DNA Total cDNA was synthesized ... H19DTA, P4-DTA and H19-DTA-P4-DTA cytotoxic activity was determined by calculating the % of decrease in the cotransfected LucSV40 activity compared to that of LucSV40 transfected alone in the same...
- 18
- 746
- 0
báo cáo hóa học: " 5-aminoimidazole-4-carboxamide-1-beta-4-ribofuranoside (AICAR) attenuates the expression of LPS- and Aβ peptide-induced inflammatory mediators in astroglia" pptx
... 5'GGAGGAATGGGAGTTGCTGTTGAA-3'; IL-1β, forward 5'-GAGAGACAAGCAACGACAAAATCC-3' and reverse 5'TTCCCATCTTCTTCTTTGGGTATTG-3'; TNFα, forward 5'CTTCTGTCTACTGAACTTCGGGGT-3' and reverse 5'TGGAACTGATGAGAGGGAGCC-3'; and iNOS, ... support the idea of antioxidant/ anti-inflammatory functions of AICAR and thereby the potential of AICAR as possible therapy for inflammatory disease processes Details of signal transduction pathways ... LPS- and A -induced activation of Pkb/Akt kinase activity, but activates AMP kinase activity, in astrocyteAICAR inhibits LPS-and A -induced activation of Pkb/Akt kinase activity, but activates AMP...
- 21
- 467
- 0
Báo cáo hóa học: " Research Article A Continuation Method for Weakly Contractive Mappings under the Interior Condition" pot
... O’Regan and R Precup, Theorems of Leray-Schauder Type and Applications, vol of Series in Mathematical Analysis and Applications, Gordon and Breach Science, Amsterdam, The Netherlands, 2001 A Jim´ ... point theory for generalized contractions on spaces with two metrics,” Journal of Mathematical Analysis and Applications, vol 248 , no 2, pp 40 2 41 4, 2000 12 J Dugundji and A Granas, “Weakly contractive ... contractive mappings,” Transactions of the American Mathematical Society, vol 226, pp 257–290, 1977 14 G E Hardy and T D Rogers, A generalization of a fixed point theorem of Reich,” Canadian Mathematical...
- 8
- 304
- 0
To sell is human the surprising truth a daniel h pink
... sports a valiant attempt at a beard and a jacket that bears the name of the local electric utility The younger man needs a car He admires the three-year-old Nissan Altima but can’t afford its ... human, a natural act that serves as a social glue and a sign of trust Yet they, too, assign it a nonhuman label They call it the “chameleon effect.”10 In an award-winning study, Galinsky and Maddux, ... years ago—travel agents maintained an information monopoly that allowed the unscrupulous ones to overcharge and mistreat their customers Not anymore Today, a mom with a laptop has about the same...
- 165
- 512
- 3
Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx
... statistical software package (Statview 4. 5; Abacus Concept Inc, Berkeley, CA, USA) and expressed as mean ± SEM Groups of data were compared by analysis of variance; the means of groups with variances ... in the PCR reaction were 5′-TGA-CTC-TAA-GTG-GCATTC-AAG-G (sense) and 5′-GAT-TCA-GAC-ATC-TCTTCT-CAC-CC (antisense) for IP-10 [ 24] , and 5′-GTG-GGG-CGC-CCC-AGG-CAC-CA (sense) and 5′-CTC-CTT-AAT-GTC-ACG-CAC-GAT-TTC ... for the classification of rheumatoid arthritis Arthritis Rheum 1988, 31:315-3 24 21 Iwabuchi H, Kasama T, Hanaoka R, Miwa Y, Hatano Y, Kobayashi K, Mori Y, Negishi M, Ide H, Adachi M: Down-regulation...
- 8
- 446
- 0
Báo cáo lâm nghiệp: "Changing electrophoretic patterns of glutamate dehydrogenases and aspartate aminotransferases in a few tree species under the influence of ectomycorrhization" potx
... H.P (1987) The involvement of glutamine synthetase/glutamate synthase in ammonia assimilation by Aspergillus nidulans J Gen Microbiol 123 , 123 5 -1 24 2 Lea P.J & Miflin B.B (19 74) An alternative route ... in the mycorrhiza, which exhibited a high level of NAD-GDH activity as did the non-mycorrhizal roots (Fig B) As for aspartate aminotransferase, the distinct isoforms found in mycorrhizas, always ... Conclusion In all the associations investigated, fungal AAT was strongly repressed, whereas fungal NADP-GDH was only repressed in beech!ctomycorrhizas These results suggest that the repression may come...
- 3
- 240
- 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc
... M: Mammalian MAP kinase signalling cascades Nature 2001, 41 0:37 -40 Palanki MS: Inhibitors of AP-1 and NF-kappa B mediated transcriptional activation: therapeutic potential in autoimmune diseases ... primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) ... washed with PBS and total RNA was extracted with RNAzol (Campro, Veenendaal, The Netherlands) cDNA synthesis was done according to the manufacturer's protocol using random hexamer primers (Pharmacia,...
- 10
- 462
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25