0

1 2 3 and 7 using a layered model approach

Giao an tuan 1, 2, 3 lop 7

Giao an tuan 1, 2, 3 lop 7

Tiếng anh

... hear - Compare the result with their classmates a- 2 51 654 c- 2 51 936 e- 32 7 0 41 b- 25 0 514 d- 3 51 7 93 f- 8 21 625 - Answer Ts Qs - There are - They are Lan and Hoa - Maybe they are talking about ... drill Nam/ Nguyen/ 15 / 32 Thai Hoc II street Hoa/ Pham/ 12 / Hai Duong Minh/ Tran/ 16 / Tran Hung Dao street You/ Vu/ 9/ Nguyen Trai street -Make a model Ask Ss to practice speaking as the model ... homework - Read A6 - Practice reading A2 +6 Do Ex 2, 4- workbook - Prepare B1 -2 b- 2; Prepared by Pham Van Kinh Lesson Plans English Week Unit 1: Back To School Period Lesson 4: B1 -2) names and addresses...
  • 15
  • 848
  • 0
Báo cáo y học:

Báo cáo y học: "Serum levels of matrix metalloproteinases -1,-2,-3 and -9 in thoracic aortic diseases and acute myocardial ischemia" potx

Báo cáo khoa học

... 12 .39 ± 1. 34 408 .16 ± 14 2. 57 8. 92 ± 3. 92 13 2. 72 ± 5 .18 13 . 52 ± 1. 14 616 .65 ± 70 .35 6. 62 ± 1. 52 11 7 . 23 ± 7 .14 23 . 71 ± 4.46 12 0.96 ± 19 .15 3. 38 ± 1. 25 13 4. 02 ± 8.06 29 .50 ± 6 .25 12 3. 36 ± 33 . 93 0. 010 ... Creatinine > 14 0 μmol/l (%) 60 .1 ± 14 .8 26 /8 22 (64 .7% ) 13 (38 .2% ) 11 ( 32 . 3% ) (26 .4%) 33 ( 97% ) ( 17 .6%) ( 23 .5%) 60.6 ± 13 .1 17 /1 13 ( 72 . 2%) (16 .6%) (11 .1% ) (38 .8%) 0 (16 .6%) 60 .7 ± 13 .7 14 /4 15 ... individuals Total 31 18 18 13 15 95 12 . 92 ± 1. 01 17. 50 ± 3. 60 17 .64 ± 3. 64 17 .33 ± 2. 03 10 .66 ± 1. 77 14 . 93 ± 1. 11 MMP-9 Acute aortic dissection Chronic aortic dissection Aneurysm Myocardial ischemia...
  • 6
  • 387
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Profile of time-dependent VEGF upregulation in human pulmonary endothelial cells, HPMEC-ST1.6R infected with DENV-1, -2, -3, and -4 viruses" pps

Báo cáo khoa học

... 15 , 529 .7 ± 23 8 .3 11 ,7 82. 0 ± 53. 7 96 876 .0 ± 28 .6 6 ,15 0.6 ± 73 0 .1 10 ,34 9.4 ± 18 9.9 13 ,5 41. 0 ± 5 23 .6 4, 610 .1 ± 20 7. 9 19 2 3 ,24 7. 7 ± 39 8.5 25 ,948.5 ± 4 32 . 0 29 ,889.6 ± 828 .4 41, 560.4 ± 13 1 .2 20 ,2 81. 7 ... 0.5 425 04 0.0 875 79 0 .16 79 50 0.05 71 9 1 0.000089 0.008 074 0.006 035 0.00 4 23 4 24 0.008 879 0.045 426 0.0 0 17 75 0.00 029 7 96 0. 079 31 6 0.0 022 76 0. 010 524 0. 0 13 508 19 2 0.006 6 17 0. 0 12 808 0.0 016 83 0. 018 874 Competing ... DENV -3 -infected zDENV-4 -infected 0 ± 1. 4 ± 5 .7 ± 0.4 ± 1. 4 0±0 1, 24 4.0 ± 1. 4 14 ,9 97. 5 ± 50 .2 14 ,22 3. 8 ± 460 .3 21 , 27 5.6 ± 550.5 9,094.5 ± 22 0.6 24 600 .1 ± 59.4 10 ,16 7 .1 ± 38 4 .3 11 , 039 .2 ± 969.4 15 , 529 .7...
  • 5
  • 404
  • 0
Câu 1,2,3 trang 7 SGK Tiếng Việt 5

Câu 1,2,3 trang 7 SGK Tiếng Việt 5

Trung học cơ sở - phổ thông

... không thay ví dụ trẽn Vì ngh a chúng không giống hoàn toàn.) Câu 3: Thế từ đồng ngh a? (+ Từ ngh a từ có ngh a giống gần giống Ví dụ : siêng năng, chăm chỉ, cần cù, + Có từ ngh a hoàn toàn, thay ... * Nhận xét: Hai từ kiến thiết xây dựng thay cho nhau, ngh a từ giống hoàn toàn (làm nên công trình kiễn trúc; hình thành tổ chức hay chế độ trị, xã hội kinh tế) b Màu l a chín đồng vàng hoe ... u, + Có từ ngh a không hoàn toàn Khi dùng từ này, ta phải cân nhắc để l a chọn cho Ví dụ: - ăn, xơi, chén, (biểu thị thái độ, tình cảm khác người đối thoại điều nói đến) - mang, khiêng, vác,...
  • 2
  • 513
  • 0
Giải bài 1,2,3 trang 7 SGK Toán 9 tập 2: Phương trình bậc nhất hai ẩn

Giải bài 1,2,3 trang 7 SGK Toán 9 tập 2: Phương trình bậc nhất hai ẩn

Lớp 9

... trình 3x + 5y = -3: – ( -2) + = -6 + = -1 ≠ -3 nên ( -2; 1) không nghiệm phương trình – + = 10 ≠ -3 nên (0; 2) không nghiệm – ( -1) + = -3 nên ( -1; 0) nghiệm – 1, 5 + = 4,5 + 15 = 19 ,5 ≠ -3 nên ... nên ( -1; 0) không nghiệm phương trình – 1, 5 + = 7, 5 + 12 = 19 ,5 ≠ nên (1, 5; 3) không nghiệm phương trình – + ( -3) = 20 - 12 = nên (4; -3) nghiệm phương trình Vậy có hai cặp số (0; 2) (4; 3) nghiệm ... (d1) qua A, B Vẽ đường thẳng x – y = – Cho x = => y = -1 C(0; -1) – Cho y = => x = D (1; 0) Đường thẳng cần vẽ đường thẳng (d2) qua C, D Giao điểm hai đường thẳng có t a độ M (2; 1) Ta có (2; 1) ...
  • 5
  • 1,422
  • 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Báo cáo khoa học

... P+–CH2, H -11 a and H -3) , 1. 75 2. 4 (8H, m, O-CH2-CH2, P+–CH2-CH2, H -1 and H -2) p.p.m., 31 PNMR d 25 .65 p.p.m ESMS found (M+) 5 63 .24 69 calculated for C35H36O3N2P (M+) 5 63 .24 58 H (30 0 MHz) and 31 P ( 12 1 ... yielding as a mustard coloured solid ( 12 mg, 0. 014 mmol, 14 %) 1H NMR d 7. 6 7. 9 (m (16 H, P+–ArH and H -11 ), 7. 46 (1H, s, H-6), 6.49 (1H, s, H-9), 4 .1 4 .2 (2H, m, Ar-O-CH2), 3. 71 (3H, s, O-CH3), 3. 4– ... replication and expression (Fig 1) For the DNA alkylating reagent we chose the antibiotic (11 aS)-8hydroxy -7- methoxy -1, 2, 3 ,11 a- tetrahydro-5H-pyrrolo [2, 1c] [1, 4]benzodiazepin-5-one; (DC- 81) [1, 25 ]...
  • 10
  • 638
  • 0
E 7 Unit4 A 1,2,3

E 7 Unit4 A 1,2,3

Tiếng anh

... History Saturday 1. 00 2. 40 3. 40 4 .30 Physical Education Math English Physics INTER VIEW: • • • • • 1. What time you get up? 2. What time classes start? What time they end? What time you have lunch? ... sử Geography(n): Đ a lý Biology(n): Sinh OPEN- PREDICTION: GUESS SUBJECTS MAY HAVE IN THE LISTENING CHECKING PREDICTION: GRID: Friday 7. 00 English 7. 50 8.40 Geography Music 9.40 10 .30 Physics ... 1. New words: Physical education (n) Thể dục 1. New words: Physics (n) vật lý 1. New words: History (n) Lịch sử 1. New words: Geography (n) Đ a1. New words: Biology (n)...
  • 13
  • 353
  • 0
E 6 U 7 A 1,2,3

E 6 U 7 A 1,2,3

Tiếng anh

... practice with a partner a Vocabularies b Model sentences c Now work with a partner Ask questions about their house Listen and read Then match the questions and answers a Listen and choose the ... Thursday, November 18 th, 2 010 Unit : Your house Period : 39 A: Is your house big ? (1, 2, 3) Listen Then practice with a partner a Vocabulary - Vegetable garden (n) : V­ên rau - Bank (n): Ngân ... that ? It’s a bank What is that ? It’s a supermarket 3 Practice with a partner a) Ex: What is that? It’s a hotel What are those? They are flowers Is b) Ex: a hotel near your house? Yes , there...
  • 16
  • 374
  • 0
Báo cáo khoa học: Copines-1, -2, -3, -6 and -7 show different calcium-dependent intracellular membrane translocation and targeting pdf

Báo cáo khoa học: Copines-1, -2, -3, -6 and -7 show different calcium-dependent intracellular membrane translocation and targeting pdf

Báo cáo khoa học

... TTCTGGATCCTCAGGCAGGCTCTGAGTTGGTG -3 (copine -2) , and 5¢-GTTTCTGAATTCAAAGTACCGAG ACAAGAAGAAGAATTACAAGAG -3 and 5¢-GTTTCT GGATCCTCATGGGCTAGGG CTGGGAG -3 (copine-6) To clone EYFP-tagged chimaera of the C2C2-domains ... (5¢-GTTTCTGGATCCAAAGTACCGAGACAA GAAGAAGAATTACAAGAG -3 and 5¢-GTTTCTGGAT CCGATGGGCTAGGGCTGGGAG -3 ) was inserted into the BamHI site of the C2C2–copine -2 construct The C 6A2 (fusion of the C2C2-domains ... Biol 74 , 37 9– 38 8 16 Nakayama T, Yaoi T & Kuwajima G (19 99) Localization and subcellular distribution of N-copine in mouse brain J Neurochem 72 , 37 3 37 9 17 Nakayama T, Yaoi T, Yasui M & Kuwajima...
  • 16
  • 273
  • 0
Giáo án Tiếng anh lớp 3 - LESSON PLAN UNIT 7: FAMILY MEMBERS / Section A (1,2,3) ppt

Giáo án Tiếng anh lớp 3 - LESSON PLAN UNIT 7: FAMILY MEMBERS / Section A (1,2,3) ppt

Mầm non - Tiểu học

... Father - the st part of exchange - T & SS - the 2nd … - the 3rd … - SS & T - the last part of - opened pairs exchange Brother Sister - closed pairs 10 ’ IV: Role play: (Call ss go to the board ... copy the form on the board into notebook Ai đó? - explains the - try to Đó form, meaning remember the and use form, meaning * Meaning: * Use: Dùng để hỏi người ai? and use * Picture cue ... Time 8’ Stages and contents T’ activities SS’ activitives - follows the - follow the T’s techniques of guides warmer I Warmer: Shark attack: - work in group - guess a word - checks -...
  • 5
  • 2,693
  • 22
Giáo án tiếng anh lớp 5 - UNIT 7 MY HEALTH Section A (1, 2, 3) Period 35 pot

Giáo án tiếng anh lớp 5 - UNIT 7 MY HEALTH Section A (1, 2, 3) Period 35 pot

Mầm non - Tiểu học

... t Play a tape times class c- Post-listen Other listen carefully and remar Call some Ss read again Look and say Activity3 (10 ’) - Read follow teacher (2- 3 times Look and say T ask- Ss answer Guide ... in pair: -Calls Ss to make a dialogue A: Do you want to (play badminton)? B: Yes, I A: How often you play Activity 2: ( 10 ’) badminton? 1. Look, listen and repeat B: Sometimes 1. Look, listen and ... repe a- Pre listen T says about the situation in the dialogue New words: Look, Listen The matter a headache a sore throat -Look, listen and repeat a cough Listen and repeat sentence by a toothache...
  • 6
  • 2,474
  • 4
Giáo án tiếng anh lớp 5 - UNIT 12 DIRECTIONS AND ROAD SIGNS Section A (1, 2, 3) Period 59 pps

Giáo án tiếng anh lớp 5 - UNIT 12 DIRECTIONS AND ROAD SIGNS Section A (1, 2, 3) Period 59 pps

Mầm non - Tiểu học

... listen carefully and remar b- White- listen Reads times c- Post-listen Call some Ss read again Activity3 (10 ’) Look and say Look and say - Read follow teacher (2- 3 times Guide Ss to say follow ... listen and repeat 1. Look, listen and repeat a- Pre listening T says about the situation in the dialogue Look, Listen New words: -Look, listen and repeat go straight ahead Listen and repeat sentence ... summer? 10 ) She’s going Ha Long Bay New lesson TEACHER’S ACTIVITIES STUDENTS’ ACTIVITIES Activity 1: (3 ) Warm up and review Work in pair: -Calls Ss to make a dialogue Activity 2: ( 10 ’) 1. Look,...
  • 6
  • 1,332
  • 1
Giáo án tiếng anh lớp 5 - UNIT 5 SPORTS AND GAMES Section A (1, 2, 3) Period 21 ppsx

Giáo án tiếng anh lớp 5 - UNIT 5 SPORTS AND GAMES Section A (1, 2, 3) Period 21 ppsx

Mầm non - Tiểu học

... Other listen and remark play hide and- seek 3. Let’s talk Work in pair: one asks – one Activity 4 (10 ’) answers 3. Let’s talk Other listen and remark - Guide Ss to talk - Call some pairs talk in front ... teacher (2- 3 times) Activity3 (10 ’) T ask- Ss answer Look and say Line A ask- Line B answer then Guide Ss to say follow structures:change Do you want to (play skipping Then Ss practice to say in pair ... hide-andseek,exciting Sure, want -Look, listen and repeat Listen and repeat sentence by - Guide Ss use question and sentence answer: Ss work in pair Do you want to play hide -and- se Some pairs practice...
  • 6
  • 2,470
  • 2
tiếng anh lớp 5 unit 7, section A 1,2,3

tiếng anh lớp 5 unit 7, section A 1,2,3

Tiếng anh

... matter with you ? I have 13 00 20 19 18 17 16 15 14 12 11 10 Chúc mừng em ! Friday, December nd ,2 011 Open your notebooks and write down ! Friday, December nd ,2 011 a headache: Đau đầu a ... Friday, December nd ,2 011  Section A Friday, December nd ,2 011 C A Headache B A cough A A sore throat D A toothache 2 Key: A: B: C: D: Friday, December nd ,2 011 a headache: Đau đầu a Sore throat: ... Friday, December nd , 2 011  Section A : ( Part : 1, , ) Friday, December nd , 2 011 What’s the matter with you ? I have a fever Friday, December nd ,2 011 Mai : What’s the matter with you? Nam...
  • 21
  • 528
  • 1
Nghiên cứu thành tích sản xuất của đàn bò sữa lai 1/2, 3/4 và 7/8 máu Holstein Fresian

Nghiên cứu thành tích sản xuất của đàn bò sữa lai 1/2, 3/4 và 7/8 máu Holstein Fresian

Nông nghiệp

... s a (kg) Nhóm giống 1/ 2HF 3/ 4HF Tháng cho s a n= 57 n =76 10 ,90 12 ,65 14 ,44 15 , 31 13, 55 14 , 97 12 ,77 14 ,40 11 , 67 13 ,38 11 , 37 12 , 73 10 ,70 12 , 12 9,95 11 ,46 8,85 10 ,70 10 7, 84 8 ,78 X 11 ,20 12 ,65 Sx 2, 04 ... 2, 04 2, 01 Cv% 18 , 21 15, 91 Sản lượng s a toàn kỳ 3. 4 17 ,22 3. 858 ,25 * Trần Đình Hiếu, An Phước, 20 01 7/ 8HF n= 31 13, 34 16 ,39 15 , 81 14,88 13 ,89 12 , 81 11, 78 11 , 57 9,48 8 ,77 12 , 87 2, 53 19 ,66 3. 925 ,96 ... Thành Long Thành An Phú 1/ 2HF 3 . 17 2 4.0 61 3. 074 3. 422 3. 346 Nhóm giống 3/ 4HF 3 .14 1 3. 889 3. 309 3. 4 83 4.0 32 7/ 8HF 3. 080 3. 7 91 3. 474 3, 516 5 .20 3 Bảng cho thấy sản lượng s a cải thiện qua năm cải thiện...
  • 6
  • 519
  • 0
tuần 1,2, 3, 4, 5, 6, 7, 8, 9, 10

tuần 1,2, 3, 4, 5, 6, 7, 8, 9, 10

Ngữ văn

... ®ỵc 2/ 3 sè ý, cã bè cơc râ rµng, cßn m¾c lçi chÝnh t¶ 17 Trường THPT Chợ Lách A Giáo án Ngữ văn 11 nâng cao - Điểm 3, 4: Cha tr×nh bµy ®ỵc 1/ 2 sè ý, bè cơc cha râ rµng, m¾c nhiỊu lçi - Điểm 1, ... chung: 1. Hoµn c¶nh s¸ng t¸c: ( Sgk) 2. §äc: Bè cơc: Chia thµnh phÇn: - Lung khëi: c©u 1, 2: Lêi than ®Çu tiªn - ThÝch thùc: C©u 3- > 15 : Ca ngỵi c«ng ®øc c a ngêi sèng víi ngêi chÕt - Ai v·n: c©u 16 -> ... ChiĨu? - 18 33 H ¨n häc N¨m 18 43 vỊ Gia §Þnh thi tó tµi, n¨m 18 49 H chn bÞ thi tiÕp th× mĐ mÊt, «ng vỊ quª chÞu tang khãc th¬ng mĐ mï c¶ hai m¾t - ¤ng vỊ quª v a d¹y häc v a bèc thc - 18 59 thùc...
  • 123
  • 977
  • 0
hdng8 tiet 1,2,3,4,5,6,7

hdng8 tiet 1,2,3,4,5,6,7

Tư liệu khác

... Tự luận Câu (2 đ) Anh Câu (4đ) Pháp câu3 (1 ) Đức Mỹ Câu (2 ) Câu (ý 1) (0,5đ) Tổng cộng 0,5 10 Câu1 ( 2) 0,5 2, 5 4,5 4,5 1 Đáp án I, Trắc nghiệm ( đIểm ) Câu1: 1- a 2- c Câu 2: a, .quân chủ ... Trắc nghiệm ( đIểm ) Câu1: 1- a 2- c Câu 2: a, .Liên bang b, .đàn áp phong trào công nhân, c, Xâm lợc thuộc đ a d, quân phiệt Câu : A B a Anh 1, Thứ b Pháp 2, Thứ c Đức 3, Thứ d Mĩ 4, Thứ Thứ ... Câu (1 điểm): Hãy nối thông tin cột A cho phù hợp với cột B A B a Anh 1, Chủ ngh a đế quốc thực dân b Pháp 2, Chủ ngh a đế quốc cho vay nặng lãi c Đức 3, Chủ ngh a cộng sản d Mĩ 4, Chủ ngh a đế...
  • 4
  • 530
  • 0
tiêt 1-2-3-Mĩ thuât 7

tiêt 1-2-3-Mĩ thuât 7

Âm nhạc

... vật cần trang trí 3. Thái độ : HS yêu quý nghệ thuật trang trí dân tộc II Chuẩn bị 1. GV: - Tài liệu tham khảo"Chạm khắc dân gian Việt Nam" - Tranh ảnh hoa chim thú - Bản rập hoa văn trang trí - ... pháp - Quan sát- vấn đáp -trực quan - Luyện tập - thực hành III.Tiến trình dạy học 1- ổn định tổ chức: (1' ) Kiểm tra sĩ số 2- Kiểm tra cũ (2' ) ? Trình bày đôi nét mĩ thuật thời Trần 3- Bài (36 ') *Giới ... số 2- Kiểm tra cũ (2' ) : Nhận xét số vẽ theo mẫu 3- Bài (36 '): *Giới thiệu:Trang trí nghệ thuật tạo đẹp, điểm quan trọng trang trí tạo hoạ tiết hạo tiết cách điệu cao, sáng tạo trang trí có giá...
  • 6
  • 727
  • 0
AV 7 period 1,2,3

AV 7 period 1,2,3

Tiếng anh

... pair * Play the role work * Answer the questions - Pair work, and a Her name is Hoa individual b She is in class 7A c Nam is also in class 7A * Match a sentence in column A with - Guide and make ... pictures, extra board V Procedures: Steps and time Contents Note Warm up Jumble words: * Call a student to go to CALSSTEMA -> CLASSMATE the board and hold the cards Presentation A1 Listen Then practice ... work, ask and answer IV Teaching aid: cassette player, extra board V Procedures: Steps and time Contents Note Warm up Noughts and crosses T guide Ss the role to play the game morning How Classmate...
  • 6
  • 292
  • 0

Xem thêm