Intestine of zebrafish regionalization, characterization and stem cells

... Significance of the study of the digestive system 1.5 Intestinal stem cells 1.5.1 Location of intestinal stem cells 1.5.2 Intestinal stem cell number ... characteristics of the crypt-villus system 158 5.3.2 Determination of the number of epithelial stem cells in a 2D section of the inter-villi pocket of zebrafish (Danio rerio) intestine ... epithelial cells o...

Ngày tải lên: 11/09/2015, 10:04

... intravenously injected into nude mice and the distribution and migration of MSCs were dynamically monitored to evaluate the feasibility and safety of intravenous implantation of allogeneic MSCs in the ... transplanted the bone marrow stem cells into the necrotic femoral heads, and results show bone marrow stem cells can remove vascular lesions...

Ngày tải lên: 25/10/2012, 11:18

... daily intraperitoneal injection of the HO-1 inhibitor zinc-protoporphyrin (ZnPP, Porphyrin Products, Logan, UT, USA) at a concentration of 50 μmol/kg/day, starting two days before and continuing ... et al.: Over-expression of HO-1 on mesenchymal stem cells promotes angiogenesis and improves myocardial function in infarcted myocardium Journal of Biomedic...

Ngày tải lên: 10/08/2014, 05:21

... this article as: Yang et al.: High efficient isolation and systematic identification of human adipose-derived mesenchymal stem cells Journal of Biomedical Science 2011 18:59 Submit your next manuscript ... differentiation of cryopreserved human adipose-derived stem cells Cryobiology 2008, 57:18-24 Chen MY, Lie PC, Li ZL, Wei X: Endothelial differentiation of...

Ngày tải lên: 10/08/2014, 10:20

... status of gene therapy for glioma and breast cancer 22 1.4 Stem cells 1.4.1 Adult stem cells 1.4.1.1 Neural stem cells 1.4.2 Induced pluripotent stem cells 1.5 Stem cell as a vehicle for cancer ... primers as follows: was performed using the forward and reverse CodA, GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA...

Ngày tải lên: 09/09/2015, 18:56

... plating of hESC-derived chondrogenic cells Fig 17 Chondrogenic differentiation capability of hESC-derived chondrogenic cells Fig 18 Analysis of pluripotency and lineage- restriction of hESC-derived chondrogenic ... explored for their potential as viable cell sources for cartilage tissue engineering (Chung et al., 2008) Human embryonic stem cells (hES...

Ngày tải lên: 11/09/2015, 09:57

... the American Foundation for AIDS Research (amfAR) for providing the international collaboration for our research group This workshop was supported by an unrestricted grant from Pfizer Pharma GmbH, ... utilization of health-care resources Therapy with CCR5-negative stem cells In the early 1980s, alloHSCT appeared to be attractive as a therapy for HIV in patients with advanced d...

Ngày tải lên: 20/06/2014, 08:20

... phosporylation of MAPKs proteins may result in the prevention of downstream events such as activation of NF-κB [44] Therefore, we suggest that the Effect of dihydrotestosterone on mouse embryonic stem cells ... sodium-nucleoside transport system in brush border membrane vesicles from human kidney Pharm Res 1993, Effect of dihydrotestosterone on mouse embryonic...

Ngày tải lên: 07/08/2014, 20:23

... Sphingosine-1-phosphate promotes the differentiation of human umbilical cord mesenchymal stem cells into cardiomyocytes under the designated culturing conditions Journal of Biomedical Science 2011 ... have successfully produced both neonatal cardiac myocyte and cardiomyocytes sheets from differentiated human umbilical cord mesenchymal stem cells...

Ngày tải lên: 10/08/2014, 05:21

... of potential markers for cancer stem cells in large cell neuroendocrine carcinoma of the lung An FFPE proteomic study Journal of Clinical Bioinformatics 2011 1:23 Submit your next manuscript to ... upon Tyne, U.K.), polyclonal rabbit anti CGA antibody (DAKO Japan, Kyoto, Japan) and monoclonal mouse anti SYN antibody (DAKO Japan, Kyoto, Japan) The staining...

Ngày tải lên: 10/08/2014, 09:22

... using the corresponding inhibitors They included 1-MT (1 mM), an inhibitor of IDO enzymatic activity, INDO (5 μM), an inhibitor of PGE2 synthesis, L-NAME (1 mM), a specific inhibitor of NO synthase, ... Notably, delayed addition of UC-MSCs maintained such inhibitory effects, suggesting that the transplantation of these cells is practicable and effective for treatment of RA...

Ngày tải lên: 12/08/2014, 15:22

... percentage of NK cells are shown in Figure Patients with NK cells >20% survived longer compared with those patients with NK cells ≤20% (P = 0.041) Twenty-four out of 38 patients with NK cells ≤20% ... present study investigated whether changes of lymphocytes and NK cells occur early in severe sepsis A cohort of patients with severe...

Ngày tải lên: 13/08/2014, 03:20

... Types of cells used in bone tissue engineering for osteogenic differentiation 59 2.3.1 Potential of mesenchymal stem cells (MSCs) for bone healing 60 2.3.2 Potential of bone marrow derived mesenchymal ... Casey K Chan Effects of mechanical stimulation in osteogenic and chondrogenic differentiation of bone marrow- derived mesenchymal stem cells on...

Ngày tải lên: 11/09/2015, 09:57

... the canine umbilical cord blood is attractive In conclusion, this study provides a simplified isolation and characterization procedure for mesenchymal stem cells derived from canine umbilical cord ... was measured and calculated and drawn as a graph A Fig Identification of the cumulative population doubling level (CPDL) and culture of canine umbilical cord...

Ngày tải lên: 07/08/2014, 23:22

... CHARACTERIZATION OF THE SECRETION OF MESENCHYMAL STEM CELLS AND ITS RELEVANCE TO CARDIOPROTECTION LAI RUENN CHAI (B.Eng (Hons.)), NTU A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... identified Thesis The specific aims of this PhD project were to identify the active cardioprotective factor of the MSCs secretion and to elucidate t...

Ngày tải lên: 10/09/2015, 08:42