Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

USE OF iPS CELL-DERIVED NEURAL STEM CELL AS A CELLULAR VEHICLE FOR GLIOMA AND BREAST CANCER THERAPY ESTHER LEE XING WEI (B,Biomed Sci., University of Melbourne) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILISOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE & INSTITUTE OF BIOENGINEERING AND NANOTECHNOLOGY (A*STAR) 2011 ACKNOWLEDGEMENTS First and foremost I would like to thank A/P Wang Shu for his scientific support and guidance The members of our lab: Ghayathri Balasundaram, Xiaoying Bak, Yukti Choudhury, Timothy Kwang, Dang Hoang Lam, Jiakai Lin, Seong Loong Lo, Yovita Ida Purwanti, Chrishan Julian Alles Ramachandra, Mohammad Shahbazi, Chunxiao Wu, Kai Ye, Ying Zhao, Jieming Zeng and Detu Zhu have been invaluable resources, not only for their technical help, tips and advices but also the camaraderie I am grateful for my family, especially my husband and son who have been with me through the tough times They have been nothing but supportive in all my endevaours Finally and most importantly,I would also like to thank God for His countless grace LIST OF PUBLICATIONS E X W Lee, D.H Lam and S.Wang iPS-cell derived Neural Stem Cell for Glioma Therapy Poster presentation World Stem Cell Summit, Detriot, USA, 2010 X Y Bak, D H Lam, J Yang, K Ye, E X W Lee, S K Lim and S Wang, "Human Embryonic Stem Cell-Derived Mesenchymal Stem Cells as Cellular Delivery Vehicles for Prodrug Gene Therapy of Glioblastoma," Human Gene Therapy, (2011) E X W Lee, D.H Lam, C.X Wu, J Yang, C.K Tham, W.H Ng and S Wang Glioma Gene Therapy Using Induced Pluripotent Stem Cell Derived Neural Stem Cells Molecular Pharmaceutics , Oct 3;8(5):1515-24Jul 22,2011 E X W Lee, Y Kai, G Balasundaram, F Tay, S.Goh, S Wang Comparison of three suicide gene/prodrug systems in cancer gene therapy mediated by baculovirus-transduced neural stem cells derived from human pluripotent stem cells Poster presentation Stem Cell Society Singapore Symposium 2011 TABLE OF CONTENTS Introduction 1.1 Glioblastoma 13 1.2 Breast cancer 13 1.3 Gene therapy: the methods of gene transfer 1.3.1 Viral vectors 14 14 1.3.1.1 Adenovirus 15 1.3.1.2 Retrovirus 16 1.3.1.3 Baculovirus 16 1.3.2 Synthetic vectors 18 1.3.3 Molecular approach for cancer gene therapy 18 1.3.3.1 Prodrug converting/suicide gene therapy 18 1.3.3.2 Expression of molecules that affect angiogenesis, tumor invasion and metastasi 20 1.3.3.3 RNA interference (RNAi) targeting approach 21 1.3.4 Immunomodulation approach to cancer gene therapy 21 1.3.5 Current status of gene therapy for glioma and breast cancer 22 1.4 Stem cells 1.4.1 Adult stem cells 1.4.1.1 Neural stem cells 1.4.2 Induced pluripotent stem cells 1.5 Stem cell as a vehicle for cancer gene therapy 1.5.1 Stem cell based cancer gene therap 23 24 24 25 26 26 1.5.2 Cancer tropism of stem cells 27 1.5.3 Route of administration of stem cell 28 1.5.4 Clinical trials with stem cell based cancer gene therapy 28 1.5.5 Future of stem cell based cancer gene therapy 30 Aims and objective 31 Material and methods 33 3.1 Cell culture 33 3.2 Mouse iPSC-derived NSC for glioma therapy 34 3.2.1 Lentivirus preparation, reprogramming and maintenance of mouse iPSC 34 3.2.2 Alkaline phosphatase staining 36 3.2.3 Generation of mouse iPSC-derived NSC (msiPSC-NSC) 36 3.2.4 Characterization of msiPSC-NSC 37 3.2.5 RT2 profiler PCR array 38 3.2.6 Baculoviral vector construction and transduction 40 3.2.7 Cytotoxicity assay 40 3.2.8 In vitro migration assay 3.2.9 In vitro sensitivity of TK expressing-neural stem cells (msiPSCNSCtk) to GCV 42 3.2.10 In vitro tumoricidal effect in glioma cells 42 3.2.11 Animal study design: the use of msiPSC-derived NSC for glioma therapy 42 3.3 Comparison of different delivery methods of stem cells in breast cancer mouse model 43 3.3.1 Derivation, maintenance of iPSC-NSC 43 3.3.2 Characterization of iPSC-NSC 44 3.3.3 Fluorescence labelling and biocompatibility analysis 45 3.3.4 Animal study design: comparison of different delivery methods 45 3.4 Comparison of suicide gene systems: HSVtk, Fcy and CodA 3.4.1 Baculovirus preparation and cell transduction 46 46 3.4.2 In vitro sensitivity of HSVtk, Fcy and CodA-expressing iPSC-NSC 47 3.4.3 Animal study design: comparison of prodrug systems in 4T1 breast cancer mouse models 49 Results 4.1 Use of msiPSC-NSC in glioma therapy 4.1.1 Aim 50 50 4.1.2 Reprogramming of mouse embryonic fibroblasts to induced pluripotent stem cells and the derivation of neural stem cells 50 4.1.3 msiPSC-NSC display migratory behavior to glioma 57 4.1.4 msiPSC-NSC can be successfully transduced with baculovirus 59 4.1.5 msiPSC-NSCtk generated by baculoviral transduction display bystander killing effects on glioma cells in vitro 65 4.1.6 Gene therapy using HSVtk-expressing NSCs in glioma mouse model successfully reduces tumor growth rate 67 4.2 Comparison of different stem cell delivery methods in breast cancer mouse model 67 4.2.1 Aim 67 4.2.2 DiR labeled iPSC-NSC as a tool for tracking stem cell migration in vivo 67 4.2.3 iPSC-NSC injected intravenously exhibits observable but limited migration to mammary fatpad tumor in vivo 69 4.2.4 Baculovirus successfully transduces iPSC-NSC iPSCNSCtk/GCV exhibits breast cancer therapeutic effect 4.3 Comparison of suicide gene systems: HSVtk, Fcy and CodA 4.3.1 Aim 73 76 76 4.3.2 iPSC-NSC transduced with baculovirus carrying herpes simplex virus thymidine kinase or cytoskine deaminase are sensitive to GCV and 5’-FC respectively 76 4.3.3 A small population of suicide gene carrying cells is sufficient to elicit bystander mediated killing effect 80 4.3.4 CD/5-FC system shows slightly better therapeutic effect in 4T1 breast cancer mouse in vivo Discussion 5.1 Use of msiPSC-NSC in glioma therapy 82 86 86 5.1.1 NSCs as a suitable gene delivery vehicle for glioma therapy 86 5.1.2 The population size of NSC is a limiting factor for gene delivery 87 5.1.3 Using baculoviral vector for gene transfer 89 5.1.4 The immunomodulatory effects of NSCs 90 5.1.5 The suitability of U87 glioblastoma model as a tool for studying glioma therapy in vivo 92 5.2 Comparison of different stem cell delivery methods in breast cancer mouse model 92 5.2.1 Issues regarding the different methods of stem cell administration 93 5.2.2 DiR as a suitable label for in vivo tracking of iPSC-NSC 94 5.3 Comparison of suicide gene systems: HSVtk, Fcy and CodA 95 5.3.1 HSVtk/GCV and CD/5-FC mediates bystander effect by different methods 96 5.3.2 Tumor growth rates were reduced but no complete eradication of cancer was observed 98 5.3.3 Possible strategies to improve therapeutic efficiency 98 5.3.4 Possible cytotoxic side effects from prodrug treatment 100 Conclusion 101 Future Direction 106 Summary Using neural stem cells with tumor tropic migratory capacity to deliver therapeutic genes is an attractive strategy in eliminating metastatic or disseminated tumor Different methods have been studied and developed to isolate or generate NSCs, but it has not been assessed whether induced pluripotent stem cells (iPSCS), a type or pluripotent stem cells that hold great potential for regenerative medicine, can be used as a source for derivation of NSCs with tumor tropism In this study, we used a conventional lentivirus transduction method to derive both mouse and human iPSCs from embryonic fibroblasts and then generated NSCs from these iPSCs To investigate whether the iPSC-derived NSCs can be used in the treatment of disseminated brain tumor and metastatic breast cancer, the cells were transduced with baculoviral vector containing the herpes simplex virus thymidine kinase or the cytosine deaminase suicide gene In the glioma study, the mouse iPSC-NSCtk were injected contralaterally to tumor inoculation site in a mouse intracranial human glioma xenograft model In the breast cancer study, the human iPSC-NSCtk, iPSC-NSCFcy, iPSC-NSCCodA were injected either intravenously or directly into the tumor site We observed that NSCs expressing the suicide gene were, in the presence of respective prodrugs ganciclovir or 5fluorocytosine, effective with varying extents in inhibiting the cancer development of the glioma xenograft and breast cancer metastatic model and prolonging the survival of tumor-bearing mice Our findings provide evidence for the feasibility of using iPSC derived NSCs as a vehicle for targeted anticancer gene therapy LIST OF TABLES Table RT-PCR primer sequences for pluripotent stem cell “stemness”-specific and neural stem cell-specific markers 57 Table Changes in expression of embryonic stem cell-specific markers and embryonic stem cell differentiation/lineage marker genes between msiPSCs and MEFs 58 10 for glioblastoma Cancer Gene Ther 15: 605-615 Lowry WE, Richter L, Yachechko R, Pyle AD, Tchieu J, Sridharan R, Clark AT, Plath K (2008) Generation of Human Induced Pluripotent Stem Cells from Dermal Fibroblasts PNAS 105: 2883-2888 Maherali N., Sridharan R., Xie W., Utikal J, Eminli S, Arnold K, Staftfeld M, Yachechko R, Tschie J, Jaenisch R, Plath K, Hochedlinger K (2007) Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution Cell stem cell 1: 55-70 Majumdar AS, Zolotorev A, Samuel S, Tran K, Vertin B, Hall-Meier M, Antoni BA, Adeline E, Philip M, R P (2000) Efficacy of herpes simplex virus thymidine kinase in combination with cytokine gene therapy in an experimental metastatic breast cancer model Cancer Gene Ther 7: 1086-1099 Mali P, Ye S, Hommond HH, Yu X, Lin J, Chen G, Zou J, Cheng L (2008) Improved Efficiency and Pace of Generating Induced Pluripotent Stemm Cells from Human Adult and Fetal Fibroblasts Stem Cells doi10.1634 Marcucci G, Byrd JC, Dai G, Klisovic MI, Kourlas PJ, Young DC, Cataland SR, Fisher DB, Lucas D, Chan KK, Porcu P, Lin ZP, Farag SF, Frankel SR, Zwiebel JA, Kraut EH, Balcerzak SP, Bloomfield CD, Grever MR, MA C (2003 ) Phase and pharmacodynamic studies of G3139, a Bcl-2 antisense oligonucleotide, in combination with chemotherapy in refractory or relapsed acute leukemia Blood 101: 452-432 Marshall E (2002) Clinical research Gene therapy a suspect in leukemia-like disease Science 298: 34-35 Matthews T, R B (1988) Antiviral acitivuty and mechanism of action of ganciclovir Rev Infec Dis 10: 490-494 Meissner A, Wenig M, Jaenisch R (2007) Direct Reprogramming of Genetically Unmodified Fibroblasts into Pluripotent Stem Cells Nature Biotechnology 25: 11771181 Merrihew RV, Clay WC, Condreay JP, Witherspoon SM, Dallas WS, TA K (2001) Chromosomal integration of transduced recombinant baculovirus DNA in mammalian cells J Virol 75: 903-909 Mesnil N., H Y (2000) Bystander effect in herpes simplex virus-thymidine kinase/ganciclovir cancer gene therapy:role of gap-junctional intercellular communication Cancer Res 60: 3989-3999 120 Mi R., Luo Y.Q., Cai J.L., Limke T.L., Rao M.S., Hoke A (2005) Immortalised neural stem cells differ from nonimmortalised cortical neurospheres and cerebellar granule cell progenitors Expt Neurol 194: 301-319 Michael L Edelstein, Abedi MR, Wixon J (2007) Gene Therapy Clinical Trials Worldwide to 2007- An Update Journal Of Gene Medicine 9: 883-842 Morshead C.M., Benveniste P., Iscove N.N., Kooy van der D (2002) Hematopoietic Competence is a Rare Property of Neural Stem Cells that May Depend Genetoc amd Epigenetic Alterations Nat Med 8: 268-273 Mullen CA., Kilstrup M., RM B (1992) Transfer of the bacterial fene for sytosine demianse to mammalian cells confer lethal sensitivity to 5-fluorocytosine L a new negative slection system PNAS 89: 33-37 Murry C.E., G K (2009) Differentiation of embryonic stem cells to clnically relevant populations: lessons from embryonic development Cell 132: 661-680 Nakagawa M, Koyanagi M, Tanabe K, Takahashi K, Ichisaka T, Aoi T, Okita K, Mochiduki Y, Yamanaka S (2007) Generation of Induced Pluripotent Stem Cells Without Myc From Mouse and Human Fibroblasts Nature Biotechnology adv onlien public Narsinh KH., Plews J, Wu JC (2011) Comparison of human induced pluripotent and embryonic stem cells: fraternal or identical twins? Mol Therapy 16: 635-380 Nielsen LL, Lipari P, Dell J, Gurnani M, G H (1998) Adenovirus-mediated p53 gene therapy and paclitaxel have synergistic efficacy in models of human head and neck, ovarian, prostate, and breast cancer Clin Cancer Res 4: 835-846 Nishikawa S., Goldstein R.A., C.R N (2008) The promise of human induced pluripotent stem cells for research and therapy Nat Rev Mol Cell Biol 9: 725-729 Okita K., Ichisaka T., Yamanaka S (2007) Generation of germline-competent induced pluripotent stem cell 448: 313-318 Okita K., Nakagawa M., Hyenjong H., Ichisaka T., S Y (2008) Generation of mouse induced pluripotent stem cells without viral vectors Science 322: 949-953 Oligino TJ, Yao Q, Ghivizzani SC, P R (2000) Vector systems for gene transfer to joints Clin Orthop Relat Res: S17-S30 Packer RJ, Cogen P, Vezina G, LB R (1999) Medulloblastoma: clinical and biologic aspects Neuro Oncol 1: 232-250 121 Pandha HS, Martin LA, Rigg A, Hurst HC, Stamp GW, Sikora K, NR L (1999) Genetic prodrug activation therapy for breast cancer: A phase I clinical trial of erbB-2directed suicide gene expression J Clin Oncol 17: 2180-2189 Park I-H, Lerou PH, Zhao R, Huo H, Daley GQ (2008) Generation of Human Induced Pluripotent Stem Cells Nature Protocol 3: 1180-1186 Park I-H, Zhao R, West JA, Yabuuchi A, Huo H, Ince TA, LErou PH, Lensch MW, Daley GQ (2008b) Reprogramming of Human Somatic Cells to Pluripotency with Defined Factors Nature 451: 141-147 Parker M.A., Anderson J.K., Corliss D.A., Abvraria V.E., Sidman R.L., Park K.I., Teng Y.D., Cotanche D.A., E.Y S (2005) Expression profile of an operationally-defined neural stem cell clone Expt Neurol 194: 320-332 Peters BS, Carlin E, Weston RJ, Loveless SJ, Sweeney J, Weber J, J M (1994) Adverse effects of drugs used in management of opportunistic infections associated with HIV infections Drug Saf 10: 439-454 Pluchino S, Quattrini A, Brambilla E, Gritti A, Salani G, Dina G, Galli R, Del Carro U, Amadio S, Bergami A, Furlan R, Comi G, Vescovi AL, G M (2003) Injection of adult neurospheres induces recovery in a chronic model of multiple sclerosis Nature 422: 688-694 Pollard SM., Conti L., Sun Y., Goffredo D., A S (2006) Adherent neural stem cells from fetal and adult forebrain Cereb Cortex 16: 112-120 Prockop D (2009) Repair of Tissues By Adult Stem/progenitor cells (MSCs): Controversies, Myths, And Changing Paradigms Mol Therapy 17 Profile ARD (2003) INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy - Introgen, RPR/INGN 201 Biodrugs: 17: 216-222 Pulaski BA, S O-R (1998) Reduction of established spontaneous mammary carcinoma metastases following immunotherapy with major histocompatibility complex class II and B7.1 cell-based tumor vaccines Cancer Res 58: 1486-1493 Pule MA, Savoldo B, Myers GD, Rossig C, Russell HV, Dotti G, Huls MH, Liu E, Gee AP, Mei Z, Yvon E, Weiss HL, Liu H, Rooney CM, Heslop HE, MK B (2008) Virusspecific T cells Engineered To Coexpress Tumor-specific Receptors: Persistence And Antitumor Activity In Individuals With Neuroblastoma Nature Med 14: 1264-1270 Rainov N.G., Gorbatyuk K., V H (2008) Clinical Trials With Intracerebral ConvectionEnhanced Delivery of Targetd Toxins In Malignant Glioma Rev Recent Clin Trials 3: 2-9 122 Rainov NG, H R (2003) Clinical trials with retrovirus mediated gene therapy what have we learned? J Neurooncol 65: 227-236 Rainov NG (2000) A Phase III Clinical Evaluation Of Herpes Simplex Virus Type Thymidine Kinase And Ganciclovir Gene Therapy As An Adjuvant to Surgical Resection and Radiation In Adults With Previously Untreated Glioblastoma Multiforme Hum Gene Ther 11: 2389-2401 Ramnaraine M, Pan W, M G, Lynch C, Lewis V, Orchard P, Mantyh P, DR C (2003) Direct and Bystander Killing of Sarcomas By Novel Cytosine Deaminse Fusion Gene Cancer Res 63: 6847-6854 RathP., Shi H., Maruniak JA., Litofasky NS., Maria BL., MD K (2009) Stem cell as vectors to delivery HSVtk gene ttherapy for malignant glioma Curr Stem Cell Res Ther 4: 44-49 Reto Sutter, Gokhan Yadirgi, Marino S (2007) Neural stem cells, tumor stem cells and brain tumors: dnager relationships? Biochim Biophys Acta 1776: 125-137 Ritter T, Lehmann M, HD V (2002) Improvements in gene therapy: averting the immune response to adenoviral vectors BioDrugs 16: 3-10 Ronaghi M., Erceg S., Moreno-Manzano V., Stojkovic M (2009) Challenges of stem cell therapy for spinal cord injury:human esmbyronic stem cells, endogenous neural stem cells or induced pluripotent stem cells Stem Cells doi10.1002/stem.253 Rosenberg SA (2004) Shedding Light On Immunotherapy For Cancer N Engl J Med 350: 1461-1463 Rosenberg SA, Aebersold P, Cornetta K, Kasid A, Morgan RA, Moen R, Karson EM, Lotze MT, Yang JC, SL T (1990) Gene transfer into humans immunotherapy of patients with advanced melanoma, using tumor-infiltrating lymphocytes modified by retroviral gene transduction N Engl J Med 323: 570-578 Rossella G, Angela G, Luca B, Luigi VA (2003) Neural Stem Cells: An Overview Circulation Research 92: 598-608 Rubsam LZ, Davidson BL, DS S (1998) Superior cytotoxicity with ganciclovir compared with acyclovir and 1-beta-D-arabinofuranosylthymine in herpes simplex virus-thymidine kinase-expressing cells: a novel paradigm for cell killing Cancer Res 58: 3878-3882 Sandmair AM, Loimas S, Puranen P, Immonen A, Kossila M, Puranen M, Hurskainen H, Tyynelä K, Turunen M, Vanninen R, Lehtolainen P, Paljärvi L, Johansson R, Vapalahti M, S Y-H (2000) Thymidine kinase gene therapy for human malignant glioma, using replication-deficient retroviruses or adenoviruses Hum Gene Ther 11: 123 2197-2205 Sarkis C, Serguera C, Petres S, Buchet D, Ridet JL, Edelman L, J M (2000) Efficient transduction of neural cells in vitro and in vivo by a baculovirus-derived vector PNAS 97: 14638-14643 Scharovsky OG, Rozados VR, Gervasoni SI, P M (2000) Inhibition of ras oncogene: a novel approach to antineoplastic therapy J Biomed Sci 7: 292-298 Schmidt NO., Przylecki W., Yang W., Ziu M., Teng Y., Kim SU., Black PM., Aboody KS., RS C (2005) Brain Tumor Tropism of Transplanated Human Neural Stem Cells Is Induced by Vascular Enothelial Growth Factor Neoplasia 7: 625-629 Schulter K., Figiel M., Rozyczka J., Engele J (2003) CNS region-specific regulation of glial glutamate transporter expression Eu J Neurosci 16: 836-842 Shi Y, Do JT, Desponts C, Hahn HS, Scholer HR, Ding S (2008) A Combined Chemical and Genetic Approach For the generatioh of Induced Pluripotent Stem Cells Cell 2: 525-528 Shimato S., Natsume A., Takeuchi H., Wakabayashi T., Fujii M., Ito M., Ito S., Park I.N., Bang J.K., S.U K (2007) Human neural stem cells target and deliver therapeutic gene to experimental leptomeningeal medulloblastoma Gene Ther 14: 1132-1142 Siwistowski Andrezj, Peng Jun, Han Yi, Maria SA, Rao Mahendra S., Xianmin Z (2009) Xeno-free Defined Conditions for Culture of Human Embryonic Stem cells, Neural Stem Cells and Dopaminergic NEurons Derived from Them PLOS One 4: 111 Smukler SR., Runciman SB., Xu S., D Kvd (2006 ) Embryonic stem cells assume a primitive neural stem cell fate in the absence of extrinsic influences J Cell Biol 172: 79-90 Sommer CA, Matthias S, George MJ, Konrad H, Darrell KN, Gustavo M (2008) iPS Cell Generation Using a Singale LEtiviral STem Cell CAssette Stem Cells 27: 543549 Staftfeld M, Brennand K, Hochedlinger K (2008) Reprogramming of Pancreatic Beta Cells into Induced Pluripotent Stem Cells Current Biology 18: 890-894 Stefani AL, Barzon L, Castagliuolo I, Guido M, Pacenti M, Parolin C, Farinati F, G P (2005) Systemic efficacy of combined suicide/cytokine gene therapy in a murine model of hepatocellular carcinoma J Hepatol 42: 728-735 Stevanato L, Corteling RL, Stroemer P, Hope A, Heward J, Miljan EA, JD S (2009 ) c-MycERTAM transgene silencing in a genetically modified human neural stem cell 124 line implanted into MCAo rodent brain BMC Neurosci 10 Strauss R, Hüser A, Ni S, Tuve S, Kiviat N, Sow PS, Hofmann C, A L (2007) Baculovirus-based vaccination vectors allow for efficient induction of immune responses against plasmodium falciparum circumsporozoite protein 15: 193-202 Sullivan KM, Muraro P, A T (2010) Hematopoietic cell transplantation for autoimmune disease: updates from Europe and the United States Biol Blood Marrow Transplant 16(1 Supply) Sun L., Lee J., H.A F (2004) Neuronally Expressed Stem Cell Factor Induces Neural Stem Cell Migration to Areas of Brain Injury J Clin Invest 113: 13674-13674 Suslov O.N., Kukekov V.G., Ignatova T.N., Steindler D.A (2002) Neural Stem cell Heterogeneity Demonstrated by Molecular Phenotyping of Clonal Neurospheres PNAS 99: 14506-14511 Takahashi K, Okita K, Nakagawa M, Yamanaka S (2007) Induction of Pluripotent Stem Cells from Fibrobasts Cultures Nature Protocol 2: 3081-3089 Takahashi K., Tanabe K., Ohnuki M., Narita M., Ichisaka T., Tomoda K., Yamanaka S (2007) Induction of Pluripotent Stem Cells from Adult human Fibroblasts by Defined Factors Cell 131: 861-872 Tolar J, O'shaughnessy MJ, Panoskaltsis-Mortari A, McElmurry RT, Bell S, Riddle M, McIvor RS, Yant SR, Kay MA, Krause D, Verfaillie CM, BR B (2006) Host factors that impact the biodistribution and persistence of multipotent adult progenitor cells Blood 107: 4182-4188 Tomoyuki Suzuki, Myint Oo Chang, Masayuki Kitajima, Takaku H (2010) Baculovirus Activates murine dendritic cells and induces non-specific NKT and T cell immune responses Cell Immun 362: 35-43 Tomoyuki Suzuki, Myint Oo Chang, Masayuki Kitajima, Takaku H (2010) Induction of antitumor immunity against mouse carcinoma by baculovirus-infected dendritic cells Cell Mol Immun 7: 440-445 Tongbiao Zhao, Zhang Zhen Ning, Rong Zhili, Yang X (2011) Immunogenicity Of Induced Pluripotent Stem Cells Nat Letters 474: 212-216 Trinh QT, Austin EA, Murray DM, Knick WC, BE H (1995) Enzyme/Prodrug Gene Therapy:Comparison of cytosine DEaminase/5-Fluorocytosine versus thymidine kinase/ganciclovir enzyme/prodrug systems in a human colorectal carcinoma cell line Cancer Res 55: 4808-4812 125 Trounson A, Thakar RH, Lomax Geoff, D G (2011) Clinical Trials For Stem Cell Therapies BMC Medicine Tso CL, Shintaku P, Chen J, Liu Q, Liu J, Chen Z, Yoshimoto K, Mischel PS, Cloughesy TF, Liau LM, SF N (2006) Primary glioblastomas express mesenchymal stem-like properties Mol Cancer Res 9: 607-619 Uckert W, Kammertons T, Haack K, Qin Z, Gebert J, Schendel DJ, T B (1998) Double suicide gene (cytosine deaminase and herpes simplex virus thymidine kinase) but not single gene transfer allows reliable elimination of tumor cells in vivo Hum Gene Ther 9: 855-865 Uhl M., Weiler M., Wick W., Jacobs A.H., Weller M., U H (2005) Migratory neural stem cells for improved thymidine kinase-based gene therapy for malignant gliomas Biochem Biophy Res Comm 328: 125-129 Varas F, MAtthias S, Andreas-Aguayo LD, Maherali N, Tullio AD, PAntano L, Cedric Notredame, Konrad H, Grad T (2009) Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions Stem Cells 27: 300-306 Virions FD, Wu JK, Qi P, Waltzman M, Cherrington V, DC S (1997) The bystander effect exerted by tumor cells expressing the herpes simplex virus thymidine kinase (HSVtk)gene is dependent on connexin expression and cell communication via gap junctions Gene Ther 4: 577-585 Vlachaki MT, Chhikara M, Aguilar L, Zhu X, Chiu KJ, Woo S, Teh BS, Thompson TC, Butler EB, E A-C (2001) Enhanced therapeutic effect of multiple injections of HSVTK + GCV gene therapy in combination with ionizing radiation in a mouse mammary tumor model Int J Radiat Oncol Biol Phys 51: 1008-1017 Walczak P, Zhang J, Gilad AA, Kedziorek DA, Ruiz-Cabello J, Young RG, Pittenger MF, van Zijl PC, Huang J, JW B (2008) Dual-modality monitoring of targeted intraarterial delivery of mesenchymal stem cells after transient ischemia Stroke 39: 1569-1574 Wang J., Sakariassen P.O., Tsinkalovsky O., Immervoll H., Boe S.O., Svendsen A., Prestegarden L RG, Thorsen F., Stuhr L., Loven A., Berkvig R., Enger P.O (2008) CD133 negative glioma cells form tumors in nude rats and give rise to CD133 positive cells Int J Cancer 122: 761-768 Wang S, G B (2010) Potential cancer gene therapy by baculoviral transduction Curr Gene Ther 10: 214-225 Wernig M., Lengner C.J., Hanna J., Lodato M.A., Steine E., Foreman R., Staerk J., Markoulaki S., R J (2007) A drug-inducible transgenic system for direct reprogramming of multiple somatic cell types Nat Biotech 26: 916-924 126 Wernig M., Zhao J.P., Pruszak J., Hedlund E., Fu D., Soldner P., Broccoli V., Constantine-Paton M., Sacson O., Jaenisch R (2008) Neurons derived from Reprogramming Fibroblasts Functionally Integrate into Fetal Brain and Improve Symptoms of Rats With Parkinson's Disease PNAS 105: 5856-5861 Wijeyekoon R., Barker RA (2009) Cell replacement therapy for Parkinson's disease Biochem et Biophy Acta 1792: 688-702 Xia K, Liang D, A T, Feng Y, Zhang J, Pan Q, Long Z, Dai H, Cai F, Wu L, Zhao S, Chen Z, J X (2004) A Novel Fusion Suicide Gene Yeast CDglyTK Plays a Role in Radio-gene Therapy of Nasopharyngeal Carcinoma Cancer Gene Therapy 11: 790796 Xin H, Sun R, Kanehira M, Takahata T, Itoh J, Mizuguchi H, Y S (2009) Intratracheal delivery of CX3CL1-expressing mesenchymal stem cells to multiple lung tumors Mol Med 15: 321-327 Yamazaki M, Straus FH, Messina M, Robinson BG, Takeda T, Hashizume K, LJ D (2004) Adenovirus-mediated tumor-specific combined gene therapy using Herpes simplex virus thymidine/ganciclovir system and murine interleukin-12 induces effective antitumor activity against medullary thyroid carcinoma Cancer Gene Ther 11: 8-15 Yang I, Han SJ, Kaur G, Crane C, AT P (2010 ) The role of microglia in central nervous system immunity and glioma immunology J Clin Neurosci 17: 6-10 Yang J, Lam DH, HGoh SS, Lee EX, Zhao Y, Tay FC, Chen C, Du S, Balasundaraum G, Shabazi M, Tham CK, Ng WH, Toh HC, S W (2012) Tumor Tropism of Intravenously Injected Human Induced Pluripotent Stem Cell-Derived Neural Stem Cells and Their Gene Therapy Application in a Metastatic Breast Cancer Model Stem Cells doi: 10.1002/stem.1051 Ying QL, Stavridis M, Griffiths D, Li M, A S (2003) Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture Nat Biotech 21: 183186 Yip S., Sabetrasekh R., Sidman R.L., Snyder E.Y (2006) Neural stem cells as novel cancer therapeutic vehicles Eu J Cancer 42: 1298-1308 Yoneda T, Michigami T, Yi B, Williams PJ, Niewolna M, T H (2000) Actions of bisphosphonate on bone metastasis in animal models of breast carcinoma Cancer 88: 2979-2988 Yu J., Vodyanik M.A., Smuga-Otto K., Antosiweicz-Bourget J., Frane J.L., Tian S., Nie J., Jonsdottir G.A., Ruotti V., Stewart R., Slukvin, Thomson J.A (2007) Induced 127 Pluripotent Stem Cells Derived from Human Somatic Cells Science Express 318: 1917-1920 Zaiss AK, DA M (2005) Immune responses to adeno-associated virus vectors Curr Gene Ther 3: 323-331 Zappia E., Casazza E., Pedemonte E., Benvenuto F., Bonanni I., Gerdoni E., Giunti D., Ceravolo A., Cazzanti F., Frazzoni F., Mancardi G., A U (2005) Mesenchymal stem cells ameliorate experimental autoimmune encephalomyelitis inducing T-cell anergy Blood 106: 1755-1761 Zeng J, Du J, Zhao Y, Palanisamy N, Wang S (2007) Baculoviral VEcotr-mediated Transient and Stable Transgene Expression in Human Embryonic Stem Cells Stem Cells 25: 1055-1061 Zhang L, Wikenheiser KA, JA W (1997) Limiations of retrovirus-mediated HSVtk gene transfer to pulmonary adenocarcinoma cells in vitro and in vivo Hum Gene Ther 8: 563-575 Zhao Y (2010) Human NT2 Neural Precursor-Derived Tumor-infiltratin Cells as Delivery Vehicles for Treatment of Glioblastomas Human Gene Therapy 6: 683-694 Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, Benhaim P, Lorenz HP, MH H (2001) Multilineage Cells From Human Adipose Tissue: Implications For Cellbased Therapies Tissue Eng 7: 211-228 Zvaifler NJ, Marinova-Mutafchieva L, Adams G, Edwards CJ, Moss J, Burger JA, RN M (2000) Mesenchymal Precursor cells in The Blood Of Normal Individuals Arthritis Res 2: 477-488 128 Appendices Figure A1 Mouse embryonic stem cell array PMM-018A: Mouse iPSC relative to mouse embryonic fibroblasts Description Fold change Functional Gene Grouping (I) Forkhead box D3 15 ESC-specific genes GATA binding protein Gastrulation brain homeobox ESC-specific genes 51 ESC-specific genes 273 ESC-specific genes 151 ESC-specific genes 14 ESC-specific genes 2018 ESC-specific genes 218 ESC-specific genes Nanog homeobox Nuclear receptor subfamily 5, group A, member Nuclear receptor subfamily 6, group A, member POU domain, class 5, transcription factor SRY-box containing gene Transcription factor CP2-like Undifferentiated embryonic cell transcription factor 229 ESC-specific genes 1195 ESC-specific genes Zinc finger protein 42 1107 ESC-specific genes COMM domain containing Cellular retinoic acid binding protein II ESC-specific genes ESC-specific genes Endothelin receptor type B ESC-specific genes Fibroblast growth factor 347 ESC-specific genes Fibroblast growth factor Gamma-aminobutyric acid (GABA) A receptor, subunit beta ESC-specific genes ESC-specific genes Galanin Growth factor receptor bound protein ESC-specific genes 27 ESC-specific genes ESC-specific genes 27 ESC-specific genes ESC-specific genes 36 ESC-specific genes 213 ESC-specific genes 287 ESC-specific genes ESC-specific genes 41 ESC-specific genes Hemopoietic cell kinase Interferon induced transmembrane protein Interleukin signal transducer Kit oncogene Left right determination factor Left-right determination factor Leukemia inhibitory factor receptor Nodal Functional Gene Grouping (II) Transcription factors maintaining "stemness" Transcription factors maintaining "stemness" Transcription factors maintaining "stemness" Transcription factors maintaining "stemness" Transcription factors maintaining "stemness" Transcription factors maintaining "stemness" Transcription factors maintaining "stemness" Transcription factors maintaining "stemness" Transcription factors maintaining "stemness" Transcription factors maintaining "stemness" Transcription factors maintaining "stemness" Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal 124 Noggin Numb gene homolog (Drosophila) Phosphatase and tensin homolog Secreted frizzled-related protein Teratocarcinoma-derived growth factor Brix domain containing CD9 antigen Diaphanous homolog (Drosophila) DNA methyltransferase 3B Interferon induced transmembrane protein Insulin-like growth factor mRNA binding protein Lin-28 homolog (C elegans) Podocalyxin-like RE1-silencing transcription factor Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A Telomerase reverse transcriptase Growth differentiation factor ESC-specific genes ESC-specific genes ESC-specific genes ESC-specific genes 897 1 ESC-specific genes ESC-specific genes ESC-specific genes Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal Signalling molecules required for pluripotency and self-Renewal other ESC-specific genes other ESC-specific genes 16 ESC-specific genes ESC-specific genes other ESC-specific genes other ESC-specific genes ESC-specific genes other ESC-specific genes 101 35 ESC-specific genes ESC-specific genes ESC-specific genes other ESC-specific genes other ESC-specific genes other ESC-specific genes ESC-specific genes other ESC-specific genes ESC-specific genes other ESC-specific genes ESC-specific genes other ESC-specific genes 48 ESC-specific genes ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage other ESC-specific genes Alpha fetoprotein Serine (or cysteine) peptidase inhibitor, clade A, member 1a Caudal type homeo box Eomesodermin homolog (Xenopus laevis) 26 Glial cells missing homolog (Drosophila) Keratin Fibronectin Laminin, alpha 21 Laminin B1 subunit Laminin, gamma visceral endoderm markers visceral endoderm markers Trophoblast markers Trophoblast markers Trophoblast markers Trophoblast markers Parietal endoderm marker Parietal endoderm marker Parietal endoderm marker Parietal endoderm marker 130 SRY-box containing gene 17 Glucagon Islet amyloid polypeptide Insulin II Paired box gene Pancreatic and duodenal homeobox Somatostatin Oligodendrocyte transcription factor Tyrosine aminotransferase Nestin Neurogenic differentiation 27 Paired box gene 6 Desmin Myogenic factor 5 Myogenic differentiation 1 Brachyury 97 Wilms tumor homolog DEAD (Asp-Glu-Ala-Asp) box polypeptide Synaptonemal complex protein 140 GATA binding protein markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers Parietal endoderm marker Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas other differentiation/lineage marker other differentiation/lineage marker Neural Neural Neural Muscle Muscle Muscle Mesoderm marker Mesoderm marker Germ cell Germ cell Extra-embryonic endoderm markers 131 Pancreas specific transcription factor, 1a Forkhead box A2 CD34 antigen Cadherin FMS-like tyrosine kinase Platelet/endothelial cell adhesion molecule 79 Collagen, type I, alpha Runt related transcription factor Hemoglobin X, alpha-like embryonic chain in Hba complex Hemoglobin Y, beta-like embryonic chain 5 ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers ESC differentiaiton/lineage markers Extra-embryonic endoderm markers Extra-embryonic endoderm markers Endothelial Endothelial Endothelial Endothelial Bone Bone Blood Blood 132 Figure A2 Measurement of serum alanine aminotransferase (ALT), aspartate aminotransferase (AST) and urine creatinine levels 4T1 breast cancer mice were injected with iPSC-NSCtk, iPSC-NSCFcy and IPSCNSCCodA and thereafter ip GCV and 5FC treatment respectively After week of treatment , sera and urine samples were collected from animals per group AST, ALT assays (Biovision; Ca, USA) and creatinine assays (R&D Systems) were conducted according to manufacturer’s protocol Liver function tests usually includes both AST and ALT measurements and altered creatinine levels are often an indicator of kidney dysfunction After week of 5FC treatment, no significant elevations were observed in AST, ALT and creatinine levels in the iPSCNSCFcy/5FC and iPSCNSCtk/GCV group as compared to control breast cancer group The AST and creatinine levels in the iPSCNSCCodA/5-FC group was comparable to the others but the ALT levels were significantly higher, suggesting possible liver toxicity 128 Figure A3 Biodistribution of DiR labeled hESC-derived NSCs and MSCs NSG immunodeficient mice were intravenously injected with x 106 DiR labeled hESC-derived NSCs and MSCs and fluorescence signal from DiR labeled cells was monitored by imaging the mice 24 hours, days, days and 12 days post injection As expected, the hESC derived cells when introduced intravenously, was maintained mainly in the lungs initially, then migrated towards the liver However the fluorescent signal diminished very rapidly after days Hence DiR labeled cells would only be a reliable tool for biodistribution analysis for a short period of time 129 ... status of gene therapy for glioma and breast cancer 22 1.4 Stem cells 1.4.1 Adult stem cells 1.4.1.1 Neural stem cells 1.4.2 Induced pluripotent stem cells 1.5 Stem cell as a vehicle for cancer. .. primers as follows: was performed using the forward and reverse CodA, GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG... potential benefit As these cancers have a high risk of relapse, irrespective of grade and stage, they account for a large proportion of metastatic breast cancers (Irvin WJ and Carey 2008) 4T1 mammary