a niche of neural stem cells

... dehydrated, cleared and mounted for visualization Statistics analysis Means and standard error of the mean (SEM) were calculated The one-way analysis of variance (ANOVA) was applied to analyze ... collected and analyzed data KST interpreted data and wrote the manuscript CRS, JL and HH acquired data FZC analyzed and interpret data YHA designed the study and approved the manuscript Additional material ... hyaluronic acid (HA)-collagen neural corRepresentative image of scanning electron microscopy of neural stem cell (NSC) at passage three derived from the neural cortex of E16 Sprague-Dawley rat...

Ngày tải lên: 18/06/2014, 15:20

... of publications • Tham M, Ramasamy S, Gan H, Ramachandran A, Poonepalli A, Yu YH, Ahmed S Chondroitin sulfate proteoglycan stimulates neural stem cell survival via EGFR signalling pathways Manuscript ... Bulge cells are normally quiescent and only become activated at the start of each hair cycle In addition, they are activated during tissue damage and participate in wound healing (Blanpain and ... growth factor Notch intracellular domain Neurosphere assay Neural stem cells Neural stem cell conditioned medium Okadaic acid Parkinson's disease Platelet derived growth factor receptor Paraformaldehyde...

Ngày tải lên: 12/09/2015, 21:26

... Laboratories, PA, USA) The following primers were used: HSVtk, 5'-CCCATATCGGGGACACGTTATTT3' (forward) and 5'-GATAAAGACGTGCATGGAACGGAG-3' 5'-CCTGGATGCCGAACAAGGTTTA-3' (forward) CCAGCGTTCAATGCCTTCAAAC-3' TGGTGTTCCTATTGGCGGATGTCT ... GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG -3’ (forward) and 5’- CCGCTCGAGCTACTCACCAATATCTTCA -3’ (reverse), ... Timothy Kwang, Dang Hoang Lam, Jiakai Lin, Seong Loong Lo, Yovita Ida Purwanti, Chrishan Julian Alles Ramachandra, Mohammad Shahbazi, Chunxiao Wu, Kai Ye, Ying Zhao, Jieming Zeng and Detu Zhu have...

Ngày tải lên: 09/09/2015, 18:56

... brain autopsies of patients with AD and animal models of AD may originate from the limitations of animal models, particularly transgenic mice, as representative models of complex diseases, particularly ... temperature of Alzheimer's disease patients as a possible indicator of chronic neuroinflammation: a meta-analysis Gerontology 2007; 53: 7-11 [23] Sivaprakasam K Towards a unifying hypothesis of Alzheimer's ... light of these data In all, the modulation of adult neurogenesis during inflammatory processes and after X-irradiation treatments remains to be further evaluated Neural progenitor and stem cells...

Ngày tải lên: 08/08/2014, 17:20

... KW, MacKenzie TC, Shaaban AF, Radu A, Moseley AM, Deans R, Marshak DR, Flake AW: Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation ... mesenchymal stem cells and neural progenitor cells Haematologica 2003, 88:126-133 Reyes M, Verfaillie CM: Characterization of multipotent adult progenitor cells, a subpopulation of mesenchymal stem cells ... et al.: Feasibility of allogeneic hematopoietic stem cell transplantation for autoimmune disease: position statement from a National Institute of Allergy and Infectious Diseases and Page of 10...

Ngày tải lên: 09/08/2014, 08:23

... constituent of Curcuma longa: a review of preclinical and clinical research Altern Med Rev 2009, 14:141-153 12 Aggarwal BB, Kumar A, Bharti AC: Anticancer potential of curcumin: preclinical and clinical ... studies, data interpretation and manuscript preparation All authors have read and approved the final manuscript Acknowledgements Ms Christina Pfaff and Ms Ursula Schwikowski are gratefully acknowledged ... longa is a promising therapeutic agent for the treatment of OA and RA as it has pro-apoptotic properties in synovial lining cells [33,34] and has been shown to have anti-inflammatory and anti-apoptotic...

Ngày tải lên: 12/08/2014, 14:22

... Professor Ling Eng Ang, ex-Head of Anatomy Department, and Professor Bay Boon Huat, current Head of Anatomy Department, National University of Singapore, for their constant support and encouragement, ... cell transplantation attenuates blood brain barrier damage and neuroinflammation and protects dopaminergic neurons against MPTP toxicity in the substantia nigra in a model of Parkinson’s disease ... Congress of Neuroscience, Melbourne, Australia Chao YX, He BP, Tay SSW (2007) Mesenchymal stem cells transplantation attenuates peripheral infiltration of inflammatory factors and protects dopaminergic...

Ngày tải lên: 11/09/2015, 09:05

... a fascinating academic environment I am also grateful to Associate Professor Tay Sam Wah Samuel, Deputy Head, Department of Anatomy, National University of Singapore, for his constant encouragement, ... increases with age (Ballard et al., 1988) Among individuals with diabetes mellitus, the prevalence of macrovascular disease is also markedly increased The major manifestations of macrovascular ... genital abnormalities such as cryptorchidism and hypospadias, cardiac abnormalities such as ventricular septal defect and pulmonary artery stenosis, gastrointestinal tract abnormalities such as gastroschisis,...

Ngày tải lên: 30/09/2015, 06:36

... upstream HA fw GGGTTCCTGC^GGCCGCCGTTTCTGCTTTTTAAAGCTCATGT NotI P2 upstream HA rv TATGGATCCA^CTAGTTATGTAAATACAAACACAGAAAACCAA SpeI P3 downstream fw P4 GGGTTCCTGC^GGCCGCCTACTACTAATTGGCCAAAGTTTAA downstream ... Neo rv GCGATACCGTAAAGCACGAG P11 QuikChange fw GCAGCAGGGGGACCTGTCAGGACAGAGTT P12 QuikChange rv AACTCTGTCCTGACAGGTCCCCCTGCTGC HA ACCACTGTGCA^TATGGGTTATTTTGTGATGAAAATACCTACC NdeI In case of cloning ... downstream HA rv GA NotI P5 Sca3 fw AGCACTTCCATATTTTAAAGTAATCTG P6 Sca3 rv TGCTCCTTAATCCAGGGAAA P7 ADK fw TTGCAGATGATTTTGCACCT P8 ADK rv GACCCCTTTGGGGTATCTGT P9 Neo fw GCTTGGGTGGAGAGGCTATT P10...

Ngày tải lên: 26/11/2015, 09:54

... Emilia Madarász, Caetana Carvalho, Bruno P Carreira, Ines Araujo, Ana Isabel Santos, Angelique Bordey, Manavendra Pathania, Shan Bian, Emmanuel Moyse, Young Gyu Chai, Nando Dulal Das, Verdon Taylor, ... Neural Stem Cells as Progenitor Cells Chapter Systems for ex-vivo Isolation and Culturing of Neural Stem Cells Simona Casarosa, Jacopo Zasso and Luciano Conti Additional information is available ... Pluripotent Stem Cells: Insights from Regenerative Biology and Regenerative Medicine 271 Kaneyasu Nishimura, Yoshihisa Kitamura, Kiyokazu Agata and Jun Takahashi Chapter 11 Systemic Neural Stem Cell-Based...

Ngày tải lên: 08/03/2014, 19:20

... essential for de novo methylation and mammalian development Cell 99, 247–257 33 Tsumura A, Hayakawa T, Kumaki Y, Takebayashi S, Sakaue M, Matsuoka C, Shimotohno K, Ishikawa F, Li E, Ueda HR et al ... Hayashizaki Y & Watanabe S (1997) Restriction Landmark Genomic Scanning (RLGS) Springer, Tokyo Matsuyama T, Kimura MT, Koike K, Abe T, Nakano T, Asami T, Ebisuzaki T, Held WA, Yoshida S & Nagase ... Martins-Silva J & Saldanha C (2003) Multidisciplinary utilization of dimethyl sulfoxide: pharmacological, cellular, and molecular aspects Biochem Pharmacol 65, 1035–1041 19 Wakayama T & Yanagimachi...

Ngày tải lên: 23/03/2014, 07:20

... Masaki Warashina, Makoto Asashima and Tomoko Kuwabara Chapter 12 Noncoding RNAs in Neural Stem Cell Development 239 Shan Bian and Tao Sun Part Neural Stem Cells and Therapy 257 Chapter 13 Neural Stem/ Progenitor ... Nakayama, Hisashi Nagase, Chang-Sung Koh and Takeshi Ohkawara Chapter Role of Growth Factor Receptors in Neural Stem Cells Differentiation and Dopaminergic Neurons Generation 189 Luc a Calatrava, ... Stem Cells and Microglia as Valuable Research Tools 383 Bruno P Carreira, Maria Inês Morte, Caetana M Carvalho and Inês M Araújo Chapter 19 Immune System Modulation of Germinal and Parenchymal Neural...

Ngày tải lên: 30/03/2014, 23:20

... KITAJIMA (5), Department of Molecular Cell Biology, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita Osaka, Osaka 565-0871, Japan RAJA KITTAPPA (22), Laboratory ... Stem Cells: Hematopoietic and Vascular Cell Types STUART T FRASER, JUN YAMASHITA, L MARTIN JAKT, MITSUHIRO OKADA, MINETARO OGAWA, SATOMI NISHIKAWA, AND SHIN-ICHI NISHIKAWA 59 KENJI KITAJIMA, MAKOTO ... R WATERMAN VOLUME 273 RNA Polymerase and Associated Factors (Part A) Edited by SANKAR ADHYA VOLUME 274 RNA Polymerase and Associated Factors (Part B) Edited by SANKAR ADHYA VOLUME 275 Viral Polymerases...

Ngày tải lên: 11/04/2014, 00:32

... the United States of America 10 Library of Congress Cataloging in Publication Data Neural stem cells: methods and protocols / edited by Tanja Zigova, Juan R Sanchez-Ramos, and Paul R Sanberg p cm.—(Methods ... in an undifferentiated state and that can be manipulated at will to generate diverse cells types We are on the threshold of a great new therapeutic era of cellular therapy that has as great, ... “Utilization/Characterization of Neural Stem Cells in vivo,” is a collection of techniques to identify and characterize endogenous stem cells as well as exogenous stem cells after transplantation...

Ngày tải lên: 11/04/2014, 09:58

... global analysis and structural analysis As an example of the first category, we find techniques such as template matching, moment invariant, mathematical transforms (Fourier, Walsh, Hadamard, ... degree of correlation between a feature’s template and the input image A value of indicates that a feature template did not match the digit image; a value of indicates a complete match; and values ... Shannon’s entropy It is a statistical measurement of the capability of a feature to separate digit classes If the information measure of a feature is high, it indicates that the feature is able...

Ngày tải lên: 28/04/2014, 10:10

... classical pharmacology–and to maintain the three-dimensional architecture that allows for formation and differentiation of new tissue Materials may be metals, ceramic materials, natural materials, ... Benati D, Krampera M, Pasini A, Sbarbati A: Clinical treatment of radiotherapy tissue damage by lipoaspirate transplant: a healing process mediated by adipose-derived adult stem cells Plast Reconstr ... mesenchymal cells, and some allogeneic neural cells, are currently being assessed in various clinical studies As regards transplantation of bone marrow and mesenchymal cells, many data showing its safety...

Ngày tải lên: 18/06/2014, 16:20

... Therapy, Department of Medicine, University of Alabama at Birmingham, Birmingham, Alabama 35294- 2172, USA, 2Division of Human Gene Therapy, Department of Pathology, University of Alabama at Birmingham, ... Birmingham, Birmingham, Alabama 35294- 2172, USA, 3Division of Human Gene Therapy, Department of Surgery, University of Alabama at Birmingham, Birmingham, Alabama 35294- 2172, USA, 4Division of Human ... Stoff A, Pereboeva L, Curiel DT: Mesenchymal stem cells as a vehicle for targeted delivery of CRAds to lung metastases of breast carcinoma Breast Cancer Res Treat 2007, 105(2):157-67 14 Rachakatla...

Ngày tải lên: 20/06/2014, 07:20