Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

... status of gene therapy for glioma and breast cancer 22 1.4 Stem cells 1.4.1 Adult stem cells 1.4.1.1 Neural stem cells 1.4.2 Induced pluripotent stem cells 1.5 Stem cell as a vehicle for cancer ... primers as follows: was performed using the forward and reverse CodA, GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA...

Ngày tải lên: 09/09/2015, 18:56

134 439 0
Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery

Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery

... using human embryonic stem cells and derivatives as cellular model in implant testing for two main reasons One, human embryonic stem cells are the very original cells that our human body is developed ... OCT4 F: CGRGAAGCTGGAGGAGAAGGAGAAGCTG 55 oC R: AAGGGCCGCAGCTTACACATGTTC NANOG F: GGCAAACAACCCACTTCTGC 55 oC R: TGTTCCAGGCCTGATTGTTC β-ACTIN F: ACAGAGCCTCGCC...

Ngày tải lên: 16/10/2015, 15:38

117 385 0
Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders

Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders

... source of cells and the potential to derive the cell type of interest together with the possibility to enrich for genetic modifications during the dividing stem cell state 1.1.1 Human pluripotent stem ... stem cells Landmark discoveries of the young field of human stem cell science were the isolation and culture of inner cell mass from hu...

Ngày tải lên: 26/11/2015, 09:54

135 365 0
Human embryonic stem cell derived neural stem cells derivation, differentiation and MicroRNA regulation

Human embryonic stem cell derived neural stem cells derivation, differentiation and MicroRNA regulation

... HUMAN EMBRYONIC STEM CELL- DERIVED NEURAL STEM CELLS: DERIVATION, DIFFERENTIATION AND MICRORNA REGULATION KWANG WEI XIN TIMOTHY (B.Sc (Hons), NUS) ... mechanisms of regulation of NSC differentiation 1.1.5.2 Pluripotent stem cell- derived NSCs Human embryonic stem cells (hESCs), which are pluripotent cells derived from the inner cell mass of blast...

Ngày tải lên: 10/09/2015, 09:08

146 511 0
Báo cáo y học: " High efficient isolation and systematic identification of human adipose-derived mesenchymal stem cells." ppsx

Báo cáo y học: " High efficient isolation and systematic identification of human adipose-derived mesenchymal stem cells." ppsx

... this article as: Yang et al.: High efficient isolation and systematic identification of human adipose-derived mesenchymal stem cells Journal of Biomedical Science 2011 18:59 Submit your next manuscript ... differentiation of cryopreserved human adipose-derived stem cells Cryobiology 2008, 57:18-24 Chen MY, Lie PC, Li ZL, Wei X: Endothelial differentiation of...

Ngày tải lên: 10/08/2014, 10:20

9 519 0
Differentiation of bone marrow derived mesenchymal stem cells (BM MSCs) using engineered nanofiber substrates

Differentiation of bone marrow derived mesenchymal stem cells (BM MSCs) using engineered nanofiber substrates

... Types of cells used in bone tissue engineering for osteogenic differentiation 59 2.3.1 Potential of mesenchymal stem cells (MSCs) for bone healing 60 2.3.2 Potential of bone marrow derived mesenchymal ... Casey K Chan Effects of mechanical stimulation in osteogenic and chondrogenic differentiation of bone marrow- derived mesenchymal stem cells on...

Ngày tải lên: 11/09/2015, 09:57

241 446 0
Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf

Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf

... were harvested during total Table Histological scoring system for cartilage repair Category Points Cell morphology Hyaline cartilage Mostly hyaline cartilage Mostly fibrocartilage Mostly non -cartilage ... necessary, thereby increasing the safety and economic feasibility Our study will advance and extend the clinical application of MSC-based cell therapy for cartilage injury Ma...

Ngày tải lên: 09/08/2014, 10:23

10 470 0
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot

Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot

... glyoxalase pathway in Leishmania infantum A Fig Sensitivity analysis of the glyoxalase pathway in Leishmania infantum The effects of system parameters on the intracellular steady-state concentration ... 6C) The simulation results, based on experimentally determined parameters and a kinetic model of the 2393 The glyoxalase pathway in Leishma...

Ngày tải lên: 23/03/2014, 13:20

11 515 0
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx

Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx

... farmers who participated in this training Therefore, the course of training had already built up trainees’ confidence in using weaver ants as a major component of the cashew IPM program At the ... Baseline survey Farmers’ opinion towards the cashew IPM program using weaver ants as a major component The baseline survey was conducted by...

Ngày tải lên: 21/06/2014, 05:20

10 551 1
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf

Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf

... in the TOT training, and they include the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, ... 1 Institute Information Project Name Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam...

Ngày tải lên: 21/06/2014, 06:20

12 531 1
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf

Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf

... cashew IPM project Farmers’ opinion towards the cashew IPM program using weaver ants as a major component The baseline survey was conducted by TOT trainees in their own provinces using a standard ... birds In Vietnam, there are at least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasit...

Ngày tải lên: 21/06/2014, 06:20

7 400 0
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf

Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf

... undertake TOT training in cashew IPM, and (iii) TOT training in cashew IPM I (i) Identification of regions within each of the participating provinces to be targeted for the program A total of 30 cashew- growing ... Institute Information Project Name Implementation of the IPM program using weaver ants as a major component for cashew gr...

Ngày tải lên: 21/06/2014, 06:20

24 454 0
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt

Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt

... 1 Institute Information Project Name Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam Vietnamese Institution Institute of Agricultural Science ... the transplants from the farmer’s plot, almost every tree had weaver ants Apart from weaver ants, we also found ghost ants (Tapinoma melanocephal...

Ngày tải lên: 21/06/2014, 06:20

26 491 0
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx

Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx

... successfully passed their examinations Each of them was awarded a graduation certificate in the cashew IPM training Now, we have 112 TOT cashew IPM trainers, and they are distributed in ten cashew growing ... 1 Institute Information Project Name Implementation of the IPM program using weaver ants as a major component for cashew growers in...

Ngày tải lên: 21/06/2014, 06:20

10 303 0
Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt

Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt

... pest damage and weaver ant abundance An ICI photo book The integrated cashew improvement (ICI) program using weaver ants as a major component – photo book for cashew growers in Vietnam has also ... entitled The integrated cashew improvement (ICI) program using weaver ants as a major component - Manual for ICI program trainers and extension...

Ngày tải lên: 21/06/2014, 06:20

37 395 0
w