aldehyde dehydrogenase cancer and stem cells
Intestine of zebrafish regionalization, characterization and stem cells
Ngày tải lên :
11/09/2015, 10:04
... (columnar cells, goblet cells, enteroendocrine cells and Paneth cells) in mouse small intestine [28] The second school believes that the stem cells are sandwiched between the post-mitotic Paneth cells ... marks stem cells in the hair follicle [48] It is also suggested to mark stem cells in the stomach and mammary gland [34, 45] Like Lgr5, Ascl2 has also been identified to mark intestinal stem cells ... system 1.5 Intestinal stem cells 1.5.1 Location of intestinal stem cells 1.5.2 Intestinal stem cell number 1.5.3 Intestinal stem...
- 270
- 347
- 0
BREAST CANCER – FOCUSING TUMOR MICROENVIRONMENT, STEM CELLS AND METASTASIS ppt
Ngày tải lên :
27/06/2014, 17:20
... Telmer and Eva Turley Breast Cancer Stem Cells 235 Chapter 11 The Microenvironment of Breast Cancer Stem Cells Deepak Kanojia and Hexin Chen Chapter 12 Involvement of Mesenchymal Stem Cells in ... of breast cancer cells, molecular tumor classification methods, in vitro cancer models, breast cancer and microenvironment, breast cancer stem cells, gene regulation in breast cancer, and mechanism ... Muehlberg, F., Beckmann, C and Song, Y H (2009) Tissue resident stem cells produce CCL5 under the influence of cancer cells and thereby promote breast cancer cell invasion Cancer Lett, Vol 284, No.1:...
- 594
- 989
- 0
cancer stem cells theories and practice_part1 pps
Ngày tải lên :
12/08/2014, 06:20
... Stem Cells to Overcome Drug Resistance 401 Miaorong She and Xilin Chen Chapter 21 Cancer Stem Cells and Chemoresistance Suebwong Chuthapisith Chapter 22 Cancer Stem Cells in Drug Resistance and ... Chapter Prostate and Colon Cancer Stem Cells as a Target for Anti -Cancer Drug Development Galina Botchkina and Iwao Ojima Niches and Vascularization 135 155 Importance of Stromal Stem Cells in Prostate ... Cruz and Isidro Sanchez-Garcia Part Stem Cells in Specific Tumors 61 Chapter Breast Cancer Stem Cells 63 Marco A Velasco-Velázquez, Xuanmao Jiao and Richard G Pestell Chapter Glioma Stem Cells: ...
- 45
- 277
- 1
cancer stem cells theories and practice_part2 pdf
Ngày tải lên :
12/08/2014, 06:20
... normal stem cells to cancer stem cells Adult normal stem cells represent one purported origin of cancer stem cells What causes the transformation from normal stem cells to cancer stem cells? ... checkpoint activation and apoptosis in cancer stem cells Another possible reason for increased genomic instability in cancer stem cells is malignant transformation of aged stem cells Stem cells have a ... Clarke, M.F., and Weissman, I.L (2001) Stem cells, cancer, and cancer stem cells Nature 414, 105-111 Ringrose, L., and Paro, R (2004) Epigenetic regulation of cellular memory by the Polycomb and Trithorax...
- 45
- 217
- 0
cancer stem cells theories and practice_part3 pot
Ngày tải lên :
12/08/2014, 06:20
... [62] Murine and human hematopoietic stem cells [63-64], murine neural stem cells [65], normal and malignant human mammary stem cells [66], and normal and malignant human colorectal stem cells [62,67] ... normal neural stem cells and glioma stem cells, and may identify new CD133- glioma stem cells 4.4 New markers: Podoplanin and Integrin Alpha There are two new promising cancer stem cell markers ... factors For instance, Wnt ligands are produced and released from both stem cells and niche cells, BMP and Shh are released from niche cells and epithelial cells respectively, and Notch signaling is...
- 45
- 216
- 0
cancer stem cells theories and practice_part4 ppsx
Ngày tải lên :
12/08/2014, 06:20
... 118 Cancer Stem Cells Theories and Practice Fig Expression of ALDH1, ALDH2 and CD133 mRNA in immortalized human airway cell and lung cancer cell lines Levels of mRNA of ALDH1, ALDH2 and CD133 and ... chemiluminescence system (ECL, Amersham) This is trial version www.adultpdf.com 124 Cancer Stem Cells Theories and Practice This is trial version www.adultpdf.com Cancer Stem Cells in Lung Cancer: Distinct ... 126 Cancer Stem Cells Theories and Practice Table Cancer stem cell markers in small cell lung carcinoma amd non-small cell lung carcinoma This is trial version www.adultpdf.com Cancer Stem Cells...
- 45
- 198
- 0
cancer stem cells theories and practice_part8 pptx
Ngày tải lên :
12/08/2014, 06:20
... in stem cell regulation and cancer formation and progression are an attractive area of research Self-renewal of cancer stem cells Stem cells are defined by their multi-lineage differentiation and ... (Papagiannakopoulos and Kosik, 2008) According to this cancer stem cell hypothesis, cancer stem cells are tumorinitiating cells that proliferate uniquely through self-renewal Cancer stem cells are thought ... distinction between normal adult stem cells and cancer stem cells Pharmacology & therapeutics 119, 74-82 This is trial version www.adultpdf.com 16 MicroRNAs and Cancer Stem Cells in Medulloblastoma Massimo...
- 45
- 301
- 0
cancer stem cells theories and practice_part9 docx
Ngày tải lên :
12/08/2014, 06:20
... review this issue with depth Stem cells and cancer stem cell theory Stem Cells In order to understand cancer stem cells a brief description of normal adult stem cells and the environment in which ... metastasis, and immunosurveillance avoidance in tumors This is trial version www.adultpdf.com Cancer Stem Cells as a New Opportunity for Therapeutic Intervention 381 Cancer Stem Cells Cancer Stem Cells ... (2010) Metformin and cancer: Doses, mechanisms and the dandelion and hormetic phenomena Cell Cycle, in press This is trial version www.adultpdf.com 376 Cancer Stem Cells Theories and Practice McDermott,...
- 45
- 247
- 0
Báo cáo y học: " Gene expression profiling of human prostate cancer stem cells reveals a pro-inflammatory phenotype and the importance of extracellular matrix interactions" pps
Ngày tải lên :
14/08/2014, 08:21
... primitive cancer cells PTL induces apoptosis in primitive cancer cells Percent viability of prostate cancer cells and cells from a patient with BPH treated with increasing concentrations of PTL Cells ... signature Stem cells Stem cells (c) Committed basal Committed basal Stem Committed cells basal (d) Malignancy signature Tumour Birnie et al R83.3 Gleason included Benign Figure Distinctive stem cell and ... interactions and stem cell self-renewal Results Identification of gene products associated with a cancer stem cell phenotype By comparing RNA expression patterns from stem and committed cells, independent...
- 13
- 682
- 0
IDENTIFICATION, KINETIC AND STRUCTURAL CHARACTERIZATION OF SMALL MOLECULE INHIBITORS OF ALDEHYDE DEHYDROGENASE 3A1 (ALDH3A1) AS AN ADJUVANT THERAPY FOR REVERSING CANCER CHEMO-RESISTANCE
Ngày tải lên :
24/08/2014, 09:51
... butyraldehyde 5–Hydroxyindoleacetaldehyde Acetaldehyde Retinal Aldehyde Formaldehyde Formaldehyde, acetaldehyde, acrolein Aldophosphamide, acrolein Acetaldehyde Benzaldehyde, lipid aldehydes, acrolein, glyoxal, ... ALDH Aldehyde Dehydrogenase ALDH1A1 Aldehyde Dehydrogenase class A1 (cytosol) ALDH2 Aldehyde Dehydrogenase class (mitochondria) ALDH3A1 Aldehyde Dehydrogenase class ... Nicotine Aldehyde Betaine aldehyde 21–Dihydrocorticosteroids 3, 4–Dihydroxyphenylacetaldehyde Succinic semialdehyde Malondialdehyde, 4–Hydroxynonenal, Hexanal Glutamic–γ–semialdehyde γ–amino butyraldehyde...
- 179
- 351
- 0
Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy
Ngày tải lên :
09/09/2015, 18:56
... to cancer gene therapy 21 1.3.5 Current status of gene therapy for glioma and breast cancer 22 1.4 Stem cells 1.4.1 Adult stem cells 1.4.1.1 Neural stem cells 1.4.2 Induced pluripotent stem cells ... cells 1.5 Stem cell as a vehicle for cancer gene therapy 1.5.1 Stem cell based cancer gene therap 23 24 24 25 26 26 1.5.2 Cancer tropism of stem cells 27 1.5.3 Route of administration of stem cell ... al., 2001) Stem cells as delivery vehicles have been shown to enhance gene delivery efficiency (elaborated in section 3.1) 1.4 Stem cells 1.4.1 Adult stem cells (ASCs) Adult stem cells (ASCs),...
- 134
- 439
- 0
Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"
Ngày tải lên :
25/10/2012, 11:18
... searchers have transplanted the bone marrow stem cells into the necrotic femoral heads, and results show bone marrow stem cells can remove vascular lesions and promote angiogenesis in necrotic femoral ... [19-21] Recently, in order to improve the efficacy of stem cell transplantation, committed stem cells are isolated and purified, and single lineage stem cell transplantation is then performed Deng ... expressed in injured tissues play important roles (2) Stem cells circulate among tissues, and stem cells migrate to the injured tissues once injury occurs Stem cell homing is a complicated process in...
- 10
- 584
- 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
Ngày tải lên :
18/02/2014, 04:20
... mesenchymal stem cells and mononuclear cells Stem Cells 25, 1166–1177 Li L, Zhang S, Zhang Y, Yu B, Xu Y & Guan Z (2009) Paracrine action mediates the antifibrotic effect of transplanted mesenchymal stem ... of the cells paracrine anti-fibrotic effects These findings help to improve our understanding of the cellular and molecular basis of MSCs’ anti-inflammatory and paracrine effects Materials and methods ... TGGACAGATGCTGGTGCTGAG and GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth muscle actin (a-SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢...
- 11
- 653
- 0
Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx
Ngày tải lên :
07/03/2014, 12:20
... ES cells and in human hematopoietic progenitor cells Discussion B Fig Transcription of LCR hypersensitive site in undifferentiated murine embryonic stem cells and in human CD 133+ bone marrow cells ... Levings et al density of 105 cells well)1 The cells were passaged again and reseeded on day On days 0, 5, 8, 10 and 12, cells were collected and subjected to RT-PCR and ⁄ or ChIP analysis Globin ... structure modifications and factor recruitment at the murine b-globin locus in uninduced embryonic stem cells (day 0), as well as that of primitive and definitive erythroid cells (days and 12, respectively)...
- 10
- 422
- 0
Stem CELLS and the FUTURE OF REGENERATIVE MEDICINE pdf
Ngày tải lên :
15/03/2014, 09:20
... types: neural stem cells, including neural crest cells; hematopoietic stem cells; and pancreatic islet progenitors Neural stem cells, which are numerous in the fetal brain, can be isolated and grown ... cells derived from cultured mouse ESCs are fat cells, various brain and nervous system cells, insulin-producing cells of the pancreas, bone cells, hematopoietic cells, yolk sac, endothelial cells, ... embryonic stem cell lines In conjunction with research on stem cell biology and the development of stem cell therapies, research on approaches that prevent immune rejection of stem cells and stem...
- 112
- 628
- 0
Stem Cells in Human Reproduction Basic Science and Therapeutic Potential Second Edition pot
Ngày tải lên :
22/03/2014, 20:21
... Properties and Potential Benefits of Human Embryonic Stem Cells and Wharton’s Jelly Stem Cells 136 Chui-Yee Fong, Kalamegam Gauthaman, and Ariff Bongso 14 Amniotic Fluid and Placenta Stem Cells 150 ... differentiation of male mouse embryonic stem cells into both presumptive sperm cells and oocytes Cloning Stem Cells 2007; 9:535–548 24 Aldhous P Are male eggs and female sperm on the horizon? New ... testosterone and supported by both Sertoli and Leydig cells, prospermatogonia enter rounds of mitosis, generating spermatogonial stem cells From within this reservoir of self-generating stem cells emerge,...
- 273
- 510
- 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc
Ngày tải lên :
30/03/2014, 04:20
... mesenchymal stem cells (AT-MSCs) differentiate into hepatocyte-like cells upon treatment with hepatocyte growth factor (HGF), oncostatin M and dimethyl sulfoxide [13] These cells expressed albumin and ... mesenchymal stem cells of fetal or maternal origin from human placenta Stem Cells 22, 1338–1345 Bieback K, Kern S, Kluter H & Eichler H (2004) Critical parameters for the isolation of mesenchymal stem cells ... Huang CT, Tsai CC, Shen EY & Chiu WT (2005) Isolation and characterization of neurogenic mesenchymal stem cells in human scalp tissue Stem Cells 23, 1012–1020 In’t Anker PS, Scherjon SA, Kleijburg-van...
- 14
- 597
- 0
Neural Stem Cells and Therapy Edited by Tao Sun potx
Ngày tải lên :
30/03/2014, 23:20
... history and the most advanced discoveries in neural stem cells This book provides the strategies and challenges of utilizing neural stem cells for therapy of neurological disorders and brain and ... (slowly dividing astroglial cells and the bona fide adult neural stem cells) , type C cells (transit-amplifying cells derived from asymmetric division of Type B cells) , type A cells (immature neuroblasts ... Carvalho and Inês M Araújo Chapter 19 Immune System Modulation of Germinal and Parenchymal Neural Progenitor Cells in Physiological and Pathological Conditions 413 Chiara Rolando, Enrica Boda and...
- 452
- 381
- 0
Báo cáo Y học: Effect of coenzymes and thyroid hormones on the dual activities of Xenopus cytosolic thyroid-hormone-binding protein (xCTBP) with aldehyde dehydrogenase activity potx
Ngày tải lên :
31/03/2014, 21:21
... several dehydrogenases: pig heart malic dehydrogenase [34], beef liver glutamic dehydrogenase [34–36], pig heart malate dehydrogenase [37], horse and human alcohol dehydrogenases [38–40] and human aldehyde ... Yamauchi and J Nakajima (Eur J Biochem 269) Fig Photoaffinity-labeling of xCTBP/xALDH1 in Xenopus cells Xenopus cytosol from KR cells (lane 1), XL58 cells (lane 2) and adult liver (lane 3), and the ... KR and XL58 cells revealed, via autoradiography, a labeled protein band of the same size (lanes and in Fig 6), demonstrating that xCTBP/ xALDH1 is capable of binding T3 within the Xenopus cells...
- 8
- 405
- 0