Để làm rõ hơn đặc điểm của các chủng PPV trong nhóm mẫu được xét nghiệm,chúng tôi đã tiến hành giải trình tự phân đoạn gen NS1 của 10 chủng PPV (đã trình bày ở bảng 4.4). Kết quả ở hình 4.12 cho thấy 10 chủng PPV thực địa ở Việt Nam có trình tự phân đoạn gen NS1 ít thay đổi, với mức tương đồng rất cao từ 99,7% đến 100%. So với các chủng tham chiếu mức tương đồng về trình tự gen là 96,5% đến 99,6%.
Hình 4.12. Trình tự nucleotide của gen mã hóa protein NS1
Dấu “.” biểu thị các vị trí có nucleotide giống với chủng tham chiếu là SD-68. P1-P11 là trình tự gen của các chủng PPV ở Việt Nam thu được trong nghiên cứu này.
Như vậy, kết quả PCR và kết quả giải trình tự đã khẳng định sự lưu hành của PPV ở đàn lợn nuôi tại các địa phương lấy mẫu. Mối quan hệ di truyền giữa các chủng PPV thực địa được xác định bằng phương pháp phân tích cây phát sinh chủng loại. Kết quả phân tích cây phát sinh chủng loại (hình 4.13) đã xác định 10 chủng PPV được giải trình tự trong nghiên cứu này thuộc về nhóm 1, bao gồm các chủng châu Mỹ (American strain, ví dụ: NADL-2, POVG, Kresse), chủng Trung Quốc (Chinese strain, ví dụ: SR-1, BQ, NJ) và chủng Hàn Quốc (Korean strain, VRI-1). Đặc điểm phân loại dựa vào trình tự gen NS1 thu được trong nghiên cứu của chúng tôi hoàn toàn phù hợp với cách phân loại tương tự đã được công bố (Hao, 2011).
1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570
| . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . .
AY502114_SD-68 GTTAGAATAGGATGCGAGGAAAGACCAGAACATACACAACCAATAAGAGACAGAATGTTAAACATAAACCTAACCAGAAAACTGCCAGGTGATTTTGGACTTTTAGAAGA D00623_POVG .............................................................................................................. M32787_POVCAP .............................................................................................................. M38367_POVNADL-2 .............................................................................................................. U44978_Kresse .............................................................................................................. NC_001718_NADL-2 .............................................................................................................. AY390557_VRI-1 .............................................................................................................. AY739664_Nanjin-1 .............................................................................................................. AY789532_NJ-2 .............................................................................................................. AY789533_HN-Z1 .............................................................................................................. AY789534_HN-Z3 .............................................................................................................. AY684869_Tornau ..............T.................C..................................................A.....A.................... AY684871_27a .............................................................................................................. AY684872_IDT ................................C..................................................A.....A.................... AY686601_NJ .............................................................................................................. DQ675456_SR1 .................................................G............................................................ EU790641_BQ .............................................................................................................. EU790642_ZJ .............................................................................................................. P1 .............................................................................................................. P2 .............................................................................................................. P3 .............................................................................................................. P4 .............................................................................................................. P5 .............................................................................................................. P6 .............................................................................................................. P7 .............................................................................................................. P8 .............................................................................................................. P9 .............................................................................................................. P11 .............................................................................................................. 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . .
AY502114_SD-68 AACTGAATGGCCACTAATATGTGCTTGGTTGGTAAAGAAAGGTTACCAAGCAACAATGGCTAGCTATATGCATCATTGGGGAAATGTACCTGATTGGTCCGAAAAATGGG D00623_POVG ...................................................................................................A........ M32787_POVCAP ...................................................................................................A........ M38367_POVNADL-2 ...................................................................................................A........ U44978_Kresse ............................................................................................................ NC_001718_NADL-2 ...................................................................................................A........ AY390557_VRI-1 ..............................A....................................................................A.......A AY739664_Nanjin-1 .................................................T.................................................A........ AY789532_NJ-2 ..................G..............................T.................................................A........ AY789533_HN-Z1 .................................................T.................................................A........ AY789534_HN-Z3 .................................................T.................................................A........ AY684869_Tornau ..........................................C........................................................A........ AY684871_27a ...................................................................................................A....G..... AY684872_IDT ...................................................T...............................................A........ AY686601_NJ ............................................................................................................ DQ675456_SR1 ...................................................................................................A........ EU790641_BQ ...................................................................................................A........ EU790642_ZJ ...................................................................................................A........ P1 ...................................................................................................A........ P2 ...................................................................................................A........ P3 ...................................................................................................A........ P4 ...................................................................................................A........ P5 ...................................................................................................A........ P6 ...................................................................................................A........ P7 ...................................................................................................A........ P8 ...................................................................................................A........ P9 ...................................................................................................A........ P11 ...................................................................................................A........
PHẦN 5. KẾT LUẬN VÀ KIẾN NGHỊ 5.1. KẾT LUẬN
Từ các kết quả như đã trình bày ở trên chúng tôi rút ra một số kết luận sau: 1. Sự lưu hành huyết thanh học của PPV là rất phổ biến ở lợn thịt với tỷ lệ trung bình là 86,76%. Trong đó tỷ lệ dương tính ở đàn có quy mô ≤ 100 con cao hơn rõ rệt so với đàn có quy mô > 100 con.
2. Đã xác định được sự lưu hành virus bằng phản ứng PCR, trong đó hiện tượng virus huyết không phụ thuộc vào hàm lượng kháng thể kháng PPV.
10 chủng PPV được giải trình tự gen trong nghiên cứu này được xếp vào nhóm 1, gồm các chủng châu Mỹ, chủng Trung Quốc và chủng Hàn Quốc.
5.2. KIẾN NGHỊ
PPV đã được xác định là một trong nhiều yếu tố kết hợp quan trọng trong cơ chế sinh bệnh của PCV2. Kết quả của nghiên cứu này chỉ ra sự lưu hành phổ biến của PPV ở lợn thịt. Do đó, cần nghiên cứu sâu hơn nữa để làm rõ vai trò của PPV trong hội chứng bệnh do PCV2 gây ra. Các kết quả nghiên cứu đó sẽ góp phần điều chỉnh lịch vacxin phòng bệnh PPV ở lợn.
TÀI LIỆU THAM KHẢO
Tiếng Việt:
1. Hồ Đình Chúc(1993). Kết quả điều tra và phân lập virus từ lợn bị rối loạn sinh sản ở một số tỉnh phía Bắc. Báo cáo khoa học tại Hội nghị Chăn nuôi – Thú y toàn quốc. Tháng 6, năm 1993.
2. Hồ Đình Chúc, N., Thị Phương Đông, và Trần Duy Khanh (1995). Tình hình hội chứng rồi loạn sinh sản của lợn nái ở Thái Bình. Tạp chí Thú y, 1. tr. 1-4.
3. Trần Duy Khanh (2004). Hội chứng rối loạn sinh sản ở lợn tại Thái Bình và vai trò của porcine parvovirus. Luận án Tiến sĩ, Viện Thú Y: 143 tr.
Tiếng Anh:
4. Awad, A. M., M. Okela and B. A. Mohamed, 2012: Factors affecting hemagglutination activity of avian influenza virus subtype H5N1. Alexandria Journal of Veterinary Sciences, 35, 123-130.
5. Bachmann, P. A., 1969: Vorkommen und Verbreitung von Picodna (Parvo)—Virus beimSchwein. Zentralbl. Veterinarmed. B., 16 (4), 341–345.
6. Bachmann, P. A., 1972: Porcine Parvovirus Infection In Vitro: A Study Model for the Replication of Parvoviruses I. Replication at Different Temperatures.
Proceedings of the Society for Experimental Biology and Medicine, pp. 1369-1374. 7. Bachmann, P. A., Hoggan, M. D., Kurstak, E., Melnick, J. L., Pereira, H. G., Tattersall, P., and Vago, C., 1979: Parvoviridae: second report. Intervirology,
11(4), 248-254.
8. Berns, K. I., 1984: The Parvoviruses.New York: Plenum Press.
9. Brown, J. T. T., 1981: Laboratory evaluation of selected disinfectants as virucidal agents against porcine parvovirus, pseudorabies virus, and transmissible gastroenteritis virus. American journal of veterinary research, 42(6), 1033-1036. 10. Brown, J. T. T., Paul, P. S., and Mengeling, W. L., 1980: Response of
conventionally raised weanling pigs to experimental infection with a virulent strain of porcine parvovirus. American journal of veterinary research, 41(8), 1221-1224. 11. Cartwright, S. F., 1970: Tests available for the detection of some virus infections of
pigs and their interpretation. Vet Annu., 11, 77–82.
12. Cartwright, S. F., Lucas, M., and Huck, R. A., 1969: A small haemagglutinating porcine DNA virus: I. Isolation and properties. Journal of comparative pathology,
13. Chaniago, T. D., Watson, D. L., Owen, R. A., and Johnson, R. H., 1978: Immunoglobulins in blood serum of foetal pigs. Australian veterinary journal, (adsbygoogle = window.adsbygoogle || []).push({});
54(1), 30-33.
14. Coackley W. and & Smith V. W., 1972: Porcine parvoviruses in Western Australia.
Australian veterinary journal, 48(9), 536-536.
15. Cotmore, S. F., Sturzenbecker, L. J., and Tattersall, P., 1983: The autonomous parvovirus MVM encodes two nonstructural proteins in addition to its capsid polypeptides. Virology, 129(2), 333-343.
16. Cropper, M., Dunne, H. W., Leman, A. D., Starkey, A. L., and Hoefling, D. C., 1976: Prevalence of antibodies to porcine enteroviruses and procine parvovirus in body fluids of fetal pigs from small vs large litters. Journal of the American Veterinary Medical Association, 168(3), 233–235.
17. Cutlip R. C. and Mengeling W. L., 1976: Experimentally induced infection of neonatal swine with porcine parvovirus. American journal of veterinary research,
36(8), 1179–1182.
18. Darbyshire J. H. and Roberts D. H., 1968: Some respiratory virus and mycoplasma infections of animals. J. Clin. Pathol., 21(Suppl 2, 61–92.
19. Dea, S., Elazhary, M. A., Martineau, G. P., and Vaillancourt, J., 1985: Parvovirus- like particles associated with diarrhea in unweaned piglets. Canadian Journal of Comparative Medicine, 49(3), 343-345.
20. Dias, A. S., Gerber, P. F., Araujo, A. S., Auler, P. A., Gallinari, G. C., and Lobato, Z. I. P., 2013: Lack of antibody protection against Porcine circovirus 2 and Porcine parvovirus in naturally infected dams and their offspring. Research in veterinary science, 94(2), 341-345.
21. Ellis, J. A., A. Bratanich, E. G. Clark, G. Allan, B. Meehan, D. M. Haines, J. Harding, K. H. West, S. Krakowka, C. Konoby, L. Hassard, K. Martin and F. McNeilly, 2000: Coinfection by porcine circoviruses and porcine parvovirus in pigs with naturally acquired postweaning multisystemic wasting syndrome. J Vet Diagn Invest, 12, 21-27.
22. Forman, A., Lenghaus, C., Hogg, G., and Hale, C., 1977: Association of a parvovirus with an outbreak of foetal death and mummification in pigs. Australian veterinary journal, 53(7), 326-329.
23. Fujisaki, Y., Morimoto, T., Sugimori, T., and Suziki, H., 1975: Experimental infection of pigs with porcine parvovirus. Natl Inst Anim Health Q. (Tokyo), 22, 205–206.
24. Hallauer, C., Siegl, G., and Kronauer, G., 1972: Parvoviruses as contaminants of permanent human cell lines III. Biological properties of the isolated viruses.
Archives of Virology, 38(4), 366-382.
25. Hao, X., Lu, Z., Sun, P., Fu, Y., Cao, Y., Li, P., and Li, D., 2011: Phylogenetic analysis of porcine parvoviruses from swine samples in China. 8(1), 8(1), 320. 26. Hogg, G. G., Lenghaus, C., and Forman, A. J., 1977: Experimental porcine
parvovirus infection of foetal pigs resulting in abortion, histological lesions and antibody formation. Journal of comparative pathology, 87(4), 539-549.
27. Hohdatsu, T., Baba, K., Ide, S., Tsuchimoto, M., Nagano, H., Yamagami, T., Yamagishi, H., Fujisaki, Y., and Matumoto, M. T., 1988: Detection of antibodies against porcine parvovirus in swine sera by enzyme-linked immunosorbent assay.
Vet Microbiol., 17(1), 11-19.
28. Johnson R. H. and Collings D. F., 1969: Experimental infection of piglets and pregnant gilts with a parvovirus. Veterinary Record, 85(16), 446-447.
29. Johnson, R. H., 1973: Isolation of swine parvovirus in Queensland. Australian veterinary journal, 49(3), 157-159.
30. Johnson, R. H., Donaldson‐Wood, C., Jod, H., and Allender, U., 1976: Observations on the epidemiology of porcine parvovirus. Australian veterinary journal, 52(2), 80-84.
31. Joo, H. S., Donaldson-Wood, C. R., and Johnson, R. H., 1977: Observations on the pathogenesis of porcine parvovirus infection. Archives of Virology, 51(1), 123-129. 32. Kawamura, H., Fujita, T., Imada, T., Hitoshi, F., T., and Imada, T., 1988: Plaque
formation and replication of porcine parvovirus in embryonic swine kidney cell line, ESK cells. Jpn J Vet Sci., 50(3), 803–808.
33. Kim, Y. H., 1974: Studies on hemagglutination and hemagglutination- inhibition reaction of porcine parvovirus. Bull AZABU Vet Coll., 27, 61–65.
34. Krakowka, S., Ellis, J. A., Meehan, B., Kennedy, S., McNeilly, F., and Allan, G., 2000: Viral wasting syndrome of swine: experimental reproduction of postweaning multisystemic wasting syndrome in gnotobiotic swine by coinfection with porcine circovirus 2 and porcine parvovirus. Veterinary Pathology, 37(3), 254-263.
35. Kresse, J. I., Taylor, W. D., Stewart, W. W., and Eernisse, K. A., 1985: Parvovirus infection in pigs with necrotic and vesicle-like lesions. Veterinary microbiology,,
10(6), 525-531.
36. Lenghaus, C., Forman, A. J., and Hale, C. J., 1978: Experimental infection of 35, 50 and 60 day old pig foetuses with porcine parvovirus. Australian veterinary journal, 54(9), 418-422.
37. Lucas M. H. and Napthine P., 1971: Fluorescent antibody technique in the study of three porcine viruses: Transmissible gastroenteritis virus, vomiting and wasting disease virus and the parvovirus 59e/63. Journal of comparative pathology, 81(1), 111-117. (adsbygoogle = window.adsbygoogle || []).push({});
38. Marrable A. W. and Ashdown R. R, 1967: Quantitative observations on pig embryos of known ages. J Agric Sci., 69(3), 443–447.
39. Mayr, A., Bachmann, P. A., Siegl, G., Mahnel, H., and Sheffy, B. E., 1968: Characterization of a small porcine DNA virus. Archives of Virology, 25(1), 38-51. 40. McAdaragh J. P. and Anderson G. A., 1975: Transmission of viruses through boar
semen. In: Proc 18th Annu Meet Am Assoc Vet Lab Diagn, pp. 69-76.
41. Mengeling W. L. and Cutlip R. C., 1975b: Pathogenesis of in utero infection: experimental infection of five-week-old porcine fetuses with porcine parvovirus.
American journal of veterinary research, 36(08), 1173-1177.
42. Mengeling W. L. and Cutlip R. C., 1976: Reproductive disease experimentally induced by exposing pregnant gilts to porcine parvovirus. American journal of veterinary research, 37(12), 1393-1400.
43. Mengeling, W. L., 1972: Porcine parvovirus: Properties and prevalence of a strain isolated in the United States. American journal of veterinary research, 33(11), 2239–2248.
44. Mengeling, W. L., 1975a: Porcine parvovirus: frequency of naturally occurring transplacental infection and viral contamination of fetal porcine kidney cell cultures. American journal of veterinary research, 36(1), 41-44.
45. Mengeling, W. L., 1978: Elimination of porcine parvovirus from infected cell cultures by inclusion of homologous antiserum in the nutrient medium. American journal of veterinary research, 39(2), 323-324.
46. Mengeling, W. L., Lager, K. M., and Vorwald, A. C., 2000: The effect of porcine parvovirus and porcine reproductive and respiratory syndrome virus on porcine reproductive performance. Animal reproduction science, 60, 199-210.
47. Mengeling, W. L., Lager, K. M., Zimmerman, J. K., Samarikermani, N., and Beran, G. W., 1991: A current assessment of the role of porcine parvovirus as a cause of fetal porcine death. Journal of veterinary diagnostic investigation, 3(1), 33-35.
48. Mengeling, W. L., Paul, P. S., and Brown, T. T., 1980: Transplacental infection and embryonic death following maternal exposure to porcine parvovirus near the time of conception. Archives of Virology, 65(1), 55-62.
49. Mengeling, W. L., Paul, P. S., Bunn, T. O., and Ridpath, J. F., 1986: Antigenic relationships among autonomous parvoviruses. Journal of general virology, 67(12), 2839-2844.
50. Mengeling, W. L., Ridpath, J. F., and Vorwald, A. C., 1988: Size and antigenic comparisons among the structural proteins of selected autonomous parvoviruses.
Journal of general virology, 69(4), 825-837.
51. Molitor, T. W., Joo, H. S., and Collett, M. S., 1983: Porcine parvovirus: virus purification and structural and antigenic properties of virion polypeptides. Journal of virology, 45(2), 842-854.
52. Molitor, T. W., Oraveerakul, K., Zhang, Q. Q., Choi, C. S., and Ludemann, L. R., 1991: Polymerase chain reaction (PCR) amplification for the detection of porcine parvovirus. Journal of virological methods, 32(2-3), 201-211.
53. Morimoto, T., Kurogi, H., Miura, Y., Sugimori, T., and Fujisaki, Y., 1972: Isolation of Japanese encephalitis virus and a hemagglutinating DNA virus from the brain of stillborn piglet. Tokyo Nat Inst Anim Health Quart., 12, 127–136. 54. Narita, M., Inui, S., Kawakami, Y., Kitamura, K., and Maeda, A., 1974:
Histopathological changes of the brain in swine fetuses naturally infected with procine parvovirus. National Institute of Animal Health Quarterly, 15(1), 24-28. 55. Opriessnig, T., Fenaux, M., Yu, S., Evans, R. B., Cavanaugh, D., Gallup, J. M., and
Halbur, P. G., 2004: Effect of porcine parvovirus vaccination on the development of PMWS in segregated early weaned pigs coinfected with type 2 porcine circovirus and porcine parvovirus. Veterinary microbiology, 98(3), 209-220.
56. Oravainen, J., M. Heinonen, A. Tast, J. Virolainen and O. Peltoniemi, 2005: High