undies—or at least from indonesia to spain
Tiêu chuẩn ASTM A 962: Standard Specification for Common Requirements for Steel Fasteners or Fastener Materials, or Both, Intended for Use at Any Temperature from Cryogenic to the Creep Range
... that specification A1.1.2 The application shall be accompanied by a statement from at least one user indicating that there is a need for the new grade to be included in the applicable specification ... certification S58 Positive Material Identification Examination S58.1 Bolting shall receive Positive Material Identification to ensure that the purchaser is receiving bolting of the correct material ... 3.1.8.1 bolting material, heat treated in batch type furnaces—all material of the same heat or cast of material, Ordering Information 4.1 It is the purchaser’s responsibility to specify in the...
- 8
- 864
- 1
Tài liệu Báo cáo khoa học: Different modes of dipeptidyl peptidase IV (CD26) inhibition by oligopeptides derived from the N-terminus of HIV-1 Tat indicate at least two inhibitor binding sites doc
... hydrogen atom and one oxygen atom of the side chain carboxylic group of Glu668 and between the carbonyl carbon atom of Pro of the substrate Ala-Pro-pNA and the Ser630 oxygen atom of the enzyme to hold ... plot Compound Tat(1–9) Tat(1–9)a Trp1-Tat(1–9) Gly3-Tat(1–9) Ile3-Tat(1–9) Lys2-Tat(1–9) Trp2-Tat(1–9) Trp2-Tat(1–9)* Met-Trp1-G-CSF(1–8) Met-IL-2(1–12) Met-Trp-Val Trp2,Ile3-Tat(1–9) TXA2-R(1–9) ... as substrates The inhibition of the hydrolysis of the substrates in at least five different concentrations (10)5 M to · 10)5 M) in the absence and presence of different inhibitor concentrations...
- 10
- 505
- 0
Báo cáo Y học: Stepwise adaptations of citrate synthase to survival at life’s extremes From psychrophile to hyperthermophile pot
... Citrate Citrate Citrate – – Citrate 2.1 2.7 2.0 2.5 2.7 1.9 and CoA only and CoA & CoA a It should be noted that, although Arthrobacter DS23R was isolated from a habitat temperature of approximately ... contribute, and may reflect the fact that the majority of the substrate-binding and catalytic residues are from the small domain Fig Schematic drawings of CS From top to bottom: ArCS(31), PigCS(37), TaCS(55), ... volume statistics of CSs CS ArCS(31) (closed) PigCS(37) (open) PigCS(37) (closed) PigCS(37) (closed, N-terminally deleted) ˚ ASA ( · 104 A2) No of atoms calculated for No of atoms buried Atoms buried...
- 11
- 380
- 0
How To Get At Least One-Million Visitors A Year ppt
... that you get at least a million visitors a year to your web site I wanted to ask you exactly how that happens and how other people can copy that success So what would be your first steps, what ... not to Because they have the Google Ad-Words Select don’t they so I was just looking at that today just dipping my toe in that water to see if it makes money And just to talk about your affiliate ... back-water area of the directory I think I pay $100 a month to sponsor the Business Opportunities directories web site Then you get an enhanced listing at the top of that part of the directory...
- 9
- 228
- 0
Báo cáo lâm nghiệp: "ree nutrition of Norway spruce as modified by liming and experimental acidification at the Höglwald site, Germany, from 1982 to 2004" pdf
... was thought to exist However, our data show that the high year to year variations have to be considered when interpreting needle data, and a lot of repeated estimations are needed to show a real ... our data, and no reason is given for a translocation of Mg from older to younger needles Nearly all estimated elemental concentrations showed very high year to year variations, but low treatment ... treatment effect could be observed during the whole investigation period Ca concentrations reached from low to high on the unlimed treatments and from average to very high on the limed treatments...
- 9
- 286
- 0
Báo cáo y học: "Characterization of an H3N2 triple reassortant influenza virus with a mutation at the receptor binding domain (D190A) that occurred upon virus transmission from turkeys to pigs" potx
... DIVA (Differentiating Infected from Vaccinated Animals) strategy for the control of avian influenza Vaccine 2004, 22:3175-3181 19 Neumann G, Watanabe T, Ito H, Watanabe S, Goto H, Gao P, Hughes ... Jolla, CA) based on manufacture protocol In addition, we generated a virus with a mutation at residue 627 of PB2 gene (Glu627Lys) that has been shown to affect replication and transmission of influenza ... DMEM media supplemented with μg/ml TPCK-treated trypsin on top of the cells Supernatant from inoculated cells was collected at 24, 48, and 72 hpi and titrated in Madin-Darby canine kidney (MDCK)...
- 7
- 512
- 0
Báo cáo khoa học: " Respiratory viral infections detected by multiplex PCR among pediatric patients with lower respiratory tract infections seen at an urban hospital in Delhi from 2005 to 2007" docx
... GATTACTCATAGCTGCAGAAG G GATCCACTGTGTCACCGCTCA ATACC CTGAGTGGATATTTGGAAGTG ACCTGG AAGCATGCTATATTAAAAGAGT CTCA 197 bp 266 bp 440 bp ATTATGGGTGTGTCTGGTGCT GA AAGCAAATGGAGTGGATGTAA CAAC CTCCTAATCACAGCTGTAAGA ... matrix gene Inf AF Inf AR Influenza B matrix gene Inf BF Inf BR GAPDH primers ACCATAGGCATTCATAAACAA TC TCTGGCGGAGGAGCAATTATA CCTGG 84 bp ATCTGCATCATCTGTCACACT CGGGC GATGACACTCCAGTACCTCTT G GATTACTCATAGCTGCAGAAG ... CCCA CAAACTATGTGGTATGCTATTA ATCA ACACAGTATTATCATCCCACA GTC AGGYWCTYATGGARTGGCTAA AG 260 bp 328 bp 105 bp GCAGTCCYCGCTCASTGGGC GGAGAAGGCAAAGCAGAACTA GC CCATTCCATTCATTGTTTTTGC TG TCA TCC ATG ACAACT...
- 11
- 275
- 0
Báo cáo y học: " The cnidarian-bilaterian ancestor possessed at least 56 homeoboxes: evidence from the starlet sea anemone, Nematostella vectensis" pdf
... including 130 from the genome of Nematostella, a representative non-bilaterian, 228 from Homo, a representative deuterostome bilaterian, and 97 from Drosophila, a representative protostome bilaterian ... data file 1; Table 1) According to both trees, Nematostella appears to possess representatives from 17 of these 21 families (Additional data files to 3) Single Nematostella home- The genes of the ... predicted Nematostella genes, we were able to identify a single protein that exhibits significant similarity to bilaterian CUT genes The extensive intermingling of homeodomains from Nematostella,...
- 20
- 190
- 0
178. Morocco''''s New Way to Teach English Proves Popular, at Least With Students docx
... very satisfied with their work, and they encouraged them and they felt very happy that the students can really something with the language and in topics of interest to them that are motivating ... the classroom?" LAHCEN TIGHOULA: "Sure I can assure you that at least my students have done a lot in this And I feel really satisfied that a lot of my students have done so much in this domain ... then the second part of her project was to talk about the American culture and to try to explain the difference between American culture and the image that we have about America in the media "And...
- 2
- 220
- 0
Progressive Muslim Feminists in Indonesia from Pioneering to the Next Agendas
... and went on to become a student of Fazlur Rahman at the University of Chicago He returned to Indonesia and introduced a rational approach to the study of the Qur’an I was fortunate to study under ... points out that all interpretations are part of a tradition of Islamic teaching relevant to different social-historical situations Madjid argues that the history of Islamic thought proves that the ... al-salat wa atu al-zakat” (And be constant in prayer (salat) and render the purifying dues (zakat)) (al-Baqarah (2): 110) The words aqimu and atu are masculine forms, though the obligation of salat...
- 162
- 253
- 0
Media representation of indonesia in the sydney morning herald from 2004 to 2009 1
... same: negative stereotypes of Indonesians tend to be recycled among Australians from generation to generation (Freedman, 2000) This study is also motivated by personal experience As an Indonesian ... independence declaration of Indonesia in August 1945, “the only Western-bloc country to so” (Brown, 1996: p 1) Australia mediated the Linggarjati Treaty that later brought the full recognition of Indonesia s ... fourth meaning of representation in Gronbeck’s list is the typification in the democratization process in relation to a legislative or deliberative assembly The representation is done by choosing,...
- 469
- 394
- 0
Media representation of indonesia in the sydney morning herald from 2004 to 2009 2
... appreciation is also presented to Prof Kate Darian-Smith, the director of The Australia Center at the University of Melbourne, who allowed me to collect data there, Dr Katherine McGregor, from ... Evaluation of president Megawati 353 Figure 6.2b Top-three Evaluation Aspects of president Megawati 353 Figure 6.3a Aspects of Evaluation of president Soeharto 359 Figure 6.3b Top-four Evaluation ... Attached to president Soeharto Table 4.8 The Representations of the Government 228 Table 4.9a The Actor Representations of the Legislative 239 150 207 Institutions Table 4.9b The Actor Representations...
- 14
- 201
- 0
Conquest or collaboration in portuguese malacca from 1511 to 1521
... ideological leanings had to be separated from the literature.16 More Portuguese scholars have moved their attention away from South America to examine Southeast Asia This was an attempt at understanding ... Asian historians to rewrite their histories, but not in a nationalist way The historian George Winius warns that, Starting out with their national history, they [Asian scholars] must go to European ... History of Singapore, 1880-1940 (Singapore: Oxford University Press, 1986) ‘More recent’ also indicates the history that is closer to today Professor Warren was still able to use oral history to...
- 148
- 555
- 0
Conquest or collaboration in portuguese malacca from 1511 to 1521
... ideological leanings had to be separated from the literature.16 More Portuguese scholars have moved their attention away from South America to examine Southeast Asia This was an attempt at understanding ... Asian historians to rewrite their histories, but not in a nationalist way The historian George Winius warns that, Starting out with their national history, they [Asian scholars] must go to European ... History of Singapore, 1880-1940 (Singapore: Oxford University Press, 1986) ‘More recent’ also indicates the history that is closer to today Professor Warren was still able to use oral history to...
- 148
- 757
- 0
From planning to execution how executives at top utilities contribute to the success of capital projects
... negotiations, NorthWestern received regulatory approval on the condition that NorthWestern pay for a regulatory consultant to oversee the project “That wasn’t typical, but we knew that in order to ... position.” If a regulated utility can demonstrate that a project is good for customers, it will get it into the rate base agreed by regulators If it’s reasonable to believe that energy prices will ... the organisation.” Think of regulators as allies, not adversaries Utility companies that work in partnership with regulators achieve faster resolutions and have greater input into regulatory language...
- 17
- 180
- 0
17792 word formation from verb to noun or adjective
... TOLERANT/INTOLERANT person in my family (TOLERATE) Meg is so MANIPULATIVE! She can get whatever she wants (MANIPULATE) Most countries are trying to promote RENEWABLE energy (RENEW) Mary never stops ... weather is quite CHANGEABLE nowadays You never know what to wear (CHANGE) Stop singing such a REPETITIVE tune, Alan! (REPEAT) I usually feel SLEEPY after lunch (SLEEP) My father is the most TOLERANT/INTOLERANT ... The Managing Director was forced to accept the Sales Manager’s DISMISSAL (DISMISS) 10 The patient had to undergone a painful TREATMENT (TREAT) 11 Companies are really eager to get some financial...
- 2
- 283
- 0
Do you prefer to eat out or at hom2
... stands is good Everyone would like to have a little change from time to time It`s true that the taste of the food that they serve is different from that what we make in our homes and whether ... it, then they will appreciate that person and this improves his confidence and he would feel happy for that One would never disagree with the fact that occasionally going to restaurants or food ... person to always take food from restaurants because it will be too costly and everyone may not be able to afford In a restaurant, he may not always get his choice of food and he will have to cope...
- 2
- 270
- 0
Do you prefer to eat out or at hom3
... preparing and eating at home fits me better in these ways: keeping my healthy, saving money, and relaxing myself ...
- 2
- 346
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25