trauma copeptin a stable peptide derived from the avp precusor does not reflect osmoregulation but correla
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx
... also contained a Tyr residue at this position AaHIT4, the unique anti-insect toxin also has a toxic effect on mammals and can acts on the a- and b-sites of the mammalian sodium channel [44] Therefore, ... inserted into pSPORT I The primers A3 were as follows: 5¢-GCCGGATCCCCGATGACGATGACAAG GATGGATATATAAGA-3¢ as forward primer containing a BamHI restriction enzyme site (underlined) and corresponding ... amino acids and termed BmKIM The 5¢ and 3¢ UTRs of BmKIM cDNA are 17 bp and 76 bp, respectively A single AATAAA polyadenylation signal was found 11 nt upstream of the poly (A) tail There was only...
- 8
- 473
- 0
Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf
... Carlsbad, CA, USA) and anti-T7 Tag monoclonal antibody (Novagen, San Diego, CA, USA) A pcDNA/Amp eukaryotic expression vector and LipofectAMINE Reagent were purchased from Invitrogen (Carlsbad, CA) pGEM-T ... (5¢TGCCTGGGTGAGTTTCTC-3¢) and a reverse primer (5¢-TGGGTCGGCATTTATCTG-3¢) derived from p35 (Fig 1A) A CMV-tau fragment (amino acids 181–242) was generated by PCR from a rat brain cDNA library The primer ... fixed and stained with polyclonal phospho-tau (S202, a and b) and monoclonal antitau (total tau, : 100; c and d) antibodies FITC-conjugated (total tau) goat anti-(mouse IgG) and rhodamine-labeled...
- 8
- 329
- 0
báo cáo hóa học: " Development and validation of a preference based measure derived from the Cambridge Pulmonary Hypertension Outcome Review (CAMPHOR) for use in cost utility analyses" doc
... valued on the same scale using the same variant of the same valuation technique, as was the case for the CAMPHOR and EQ-5D models, then the valuations should be comparable [25] The valuation exercise ... ran the analysis to identify items for the valuation exercise, analysed the validation data and contributed to the writing of the manuscript JB designed and managed the valuation survey, analysed ... analysed and reported on the valuation data and contributed to the writing of the manuscript All authors read and approved the final manuscript Acknowledgements The authors would like to thank Actelion...
- 8
- 590
- 0
Báo cáo hóa học: "Research Article A Dependent Multilabel Classification Method Derived from the k-Nearest Neighbor Rule" ppt
... the Euclidean distance was used Note that usually, when feature variables are numeric and are not of comparable units and scales, that is, there are large differences in the ranges of values encountered ... on each subproblem, and Table reports the average results For each method, the mean values of the different evaluation criteria, as well as the standard deviations (std) (iii) The yeast dataset ... threshold value that separates the relevant from the irrelevant labels The value is chosen by solving a learning problem The goal is to minimize a ranking loss function while having a large margin RankSVM...
- 14
- 508
- 0
Báo cáo y học: " A 176 amino acid polypeptide derived from the mumps virus HN ectodomain shows immunological and biological properties similar to the HN protein" pdf
... Moncla and Braham, [50] Additionally, a spectrophotometric assay was used In both assays, the relative neuraminidase activity was expressed as a percentage of the NA activity observed in similar ... because the IMI did not reduce the weight loss and MuV was detected in all of the analyzed organs (data not shown) Therefore, the pcDNAHN176-construct could be a good candidate for use as a DNA ... Neutralization assay Two MuV strains, the Urabe and the Jeryl Lynn strains, were used in the assay The NT antibody titer was calculated using Kärber’s formula and expressed as the 50% neutralizing...
- 11
- 374
- 0
The Art Of Creating A Successful Blog – Tips From The Pros
... WordPress-based I asked Joshua whether that was actually limiting at all in any way, since there weren’t the library of readymade tools available to “add-on” to the base platf orm Joshua didn’t hesitate to ... design, the way we wanted to features and the way we wanted to reviews That all comes from a huge collaboration among editors In my opinion, you’re only as good as the team that you have My goal, and ... a Site from Scratch I started the interview asking Vitaly about the f irst year that he and Sven f ounded Smashing Magazine, and what their hopes and dreams were f or the site and what their...
- 10
- 566
- 0
Tài liệu Báo cáo khoa học: Different modes of dipeptidyl peptidase IV (CD26) inhibition by oligopeptides derived from the N-terminus of HIV-1 Tat indicate at least two inhibitor binding sites doc
... of Tat(1–9) with the substrate Ala-Pro-pNA at the active site of a model of DP IV Carbon atoms are colored orange [Tat(1–9)], magenta (Ala-Pro-pNA) or gray (DP IV) For clarity only amino acid ... by the factor a The Ki values of the inhibition of DP IV by these oligopeptides were in the micromolar range and the a values were in a range between 9.4 and 16 (Table 1) indicating a greater affinity ... values of the inhibition of DP IV by these peptides were in the high micromolar up to the millimolar range, and using the substrate Ala-Pro-pNA the a values were a >1 (Table 1) As shown for Tat(1–9),...
- 10
- 505
- 0
A SOCIAL MEDIA GUIDE FROM THE EDGE ppt
... Participation is Marketing. The better the participation – in terms of tone, responsiveness and frequency – the better the marketing. Think about what the customers want to hear, not what you want them to hear. (And certainly not what you want them to buy. Social Media is not the right forum for a sales pitch. If you work on building loyalty to your brand’s personality, sales will follow in ... Further syndicate the content by offering it to the online versions of mainstream media sites (in this case, AARP.com, etc.); to any bloggers who do start tackling the eldercare issues; and via Social Media Releases. Start a blog that showcases these content assets. Become the advocate, the expert. Provide the best‐of the web (pictures, ... Note again that these “tactics from tomorrow” are not necessarily targeted to the media.” They are aimed at sharing fresh content, using it to empower “passalong sharing” and spur conversation and reactions across all sorts of interested stakeholders. ...
- 41
- 294
- 0
Báo cáo khoa học: Study of synthetic peptides derived from the PKI55 ppt
... la Genetica Medica, Parma, Italy; and the Fondazione Cassa di Risparmio di Ferrara, Italy We are grateful to Banca del Sangue of Ferrara for providing fresh blood and Dr Amanda Neville for the ... ⁄ PAGE standards (New England Bio-Labs Inc., Milan, Italy) and densitometric analysis of autoradiographic bands was performed with a Bio-Rad densitometer GS700 and expressed as absorbance (A) ... identified and characterised in our laboratory, is not ATP-competitive and does not compete with the main C1 and C2 cofactors [12] A series of peptides derived from the PKI55 protein was synthesized...
- 9
- 427
- 0
Báo cáo khoa học: Small peptides derived from the Lys active fragment of the mung bean trypsin inhibitor are fully active against trypsin pptx
... was constructed by the SOEPCR strategy, using primer (5¢-GTGAATTCCTGGAAG TTCTGTTCCAGGGGCCCAGCAGCGATGAACCGAG CGAAAGCAGCGAACCGAGCTGCGATAGCAGC-3¢) and primer (5¢-GTCTCGAGTTACAGGCGAATATCG GCGCAATGGCACTGCGGCGGAATGCTTTTGGTGC ... (Uppsala, Sweden) The ZORBAX 300 SB-C18 semipreparative column was from Agilent Technologies (Santa Clara, CA, USA) Trifluoroacetic acid (TFA) and acetonitrile were from Merck (Darmstadt, Germany) ... sugarcane plants: effects on natural defense against Diatraea saccharalis Plant Physiol Biochem 41, 761–766 17 Kennedy AR (1998) The Bowman–Birk inhibitor from soybeans as an anticarcinogenic agent...
- 9
- 409
- 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
... primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) For PCR, the reaction mix consisted of · Taq buffer containing 1.5 mm ... are presumably derived from the translation of the MeVg1 gene from the hepatopancreas after rMeMIH-B stimulation The results from SDS ⁄ PAGE and western blot analysis of the hemolymph and ovarian ... northern blot analysis of MeMIH-B expression in the eyestalk (Es) and thoracic ganglia during the gonad maturation cycle Each lane represents an RNA sample from the eyestalk or the thoracic ganglion...
- 11
- 546
- 0
Báo cáo khoa học: Oxygen control of nif gene expression in Klebsiella pneumoniae depends on NifL reduction at the cytoplasmic membrane by electrons derived from the reduced quinone pool doc
... b-galactosidase synthesis rate that is equivalent to 10% of the synthesis rate in the parental strain (NCM1528) However, the ndh mutation does not affect NifA activity in the absence of NifL (Table ... rate compared to the parental strain (< 4%) This further shows that K pneumoniae M 5a1 does not exhibit a NADH-dehydrogenaseII, as the residual NADH-oxidation rate of an E coli nuo mutant strain ... horseradish peroxidase (Bio-Rad Laboratories) Purified NifA and NifL from K pneumoniae were used as standards Membrane preparation Cytoplasmic and membrane fractions of K pneumoniae UN4495 and mutant...
- 12
- 488
- 0
Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc
... show that each tablet nucleates at a specific location on the matrix surface [14] Today, the general consensus is that nacre tablets grow from their center and expand laterally until reaching the ... selfassembly, are finally occluded either between the superimposed parallel lamellae (‘interlamellar matrix’), at the boundary of adjacent mature nacre tablets (‘intertabular matrix’), or within the ... by the calcifying epithelium of the mantle The shell layers are composites of calcium carbonate crystals, which are densely packed together with an array of biomacromolecules that form a 3D framework...
- 14
- 383
- 0
Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt
... Molecular size markers are indicated on the right PAGE [35S]b-T1 has an apparent molecular mass indistinguishable from that of native b-tubulin from brain or recombinant human b5 tubulin After ... immediately after dilution or after h of incubation at 30 °C b-T1 behaviour was similar to that of b5 tubulin [33] At early times, the bulk of the radioactivity migrates as a broad band with a slower ... with CCT The reaction products were analyzed by nondenaturing PAGE; the ratios of labeled to unlabeled tubulins are indicated on the top of each lane and the arrow indicates the position of the b-tubulin/CCT...
- 7
- 500
- 0
Báo cáo khoa học: "The Derivation of a GrammaticaUy Indexed Lexicon from the Longman Dictionary of Contemporary English" pptx
... accurate lexicon from s machine-readable dictionary of variable accuracy and consistency Practical natural language applications require vocabularies substantially larger than those typically ... illnstrates These sets are el/ded and abbreviated in the code field associated with the word sense to save space in the dictionary Partial codes sharing an initial letter can be separated by commas, ... The values of PLU and P E R are predictable on the basis of the word grammar rules and need not be independently specified for each entry On the other hand, the values of SUBCAT and LAT are not...
- 8
- 353
- 0
Helping Older Adults Search for Health Information Online A Toolkit for Trainers from the National Institute on Aging potx
... The colored, scripted transition boxes which appear at the top of each page of the lesson plan are designed as “anchor points,” marking the end of one part of the lesson and the start of another ... from Goal 7: • Using the site map Ask students if they have any questions Have students check off Goal on their handout Read through the seven the goals accomplished in the class and answer any ... practice in clicking and using the back button Hold a short discussion with students, asking them to compare the usefulness of the site map to the search box on the NIA home page What are the advantages...
- 42
- 344
- 0
Báo cáo khoa học: A novel carbonic anhydrase from the giant clam Tridacna gigas contains two carbonic anhydrase domains pptx
... CTCAG TACAG TCAAG TACAA TCGAG TTGAA TAAAG GTCAG ttccag ttgtag ttctag ttctag tttcag ttacag ttacag ctacag tttcag tttcag tttcag ttccag a gtaaac gtaggt gtgggt gttagt gtatat gttggg gtatgt gtactt gtactg ... (RACE-PCR) using the ClontechTM cDNA Amplification Kit The mantle library was initially synthesized as a phage library in k-ZapII (Stratagene, La Jolla, CA, USA) It was used as a template for RACE-PCR ... Transcriptase 3303 A dual domain carbonic anhydrase (Qiagen, Valencia, CA, USA) using the following primer: 5¢-CCAgTgAgCAgAgTgACggAggACTCgAgCTCAAgCTT TTTTTTTTTTTTTT-3¢ PCR products were then amplified...
- 9
- 350
- 0
báo cáo hóa học:" Short- and long-term evacuation of people and livestock during a volcanic crisis: lessons from the 1991 eruption of Volcán Hudson, Chile" docx
... farmers to evacuate and in some cases abandon farms, the agronomic and social impacts of the evacuation, the rationale and execution of livestock evacuation, and the factors that encouraged farmers ... heavy ashfall hazards Over 20,000 cattle were evacuated from areas impacted by heavy ashfalls in the weeks following the eruption warnings have dramatically reduced casualties from volcanic hazards ... had evacuated from Los Antiguos due to the health hazards from airborne ash inflaming a chronic asthma condition The family had Table Roof collapse mitigation actions Ash & snow fall depth (farmer...
- 11
- 433
- 0
Báo cáo hóa học: "Short- and long-term evacuation of people and livestock during a volcanic crisis: lessons from the 1991 eruption of Volcán Hudson, Chile" pot
... farmers to evacuate and in some cases abandon farms, the agronomic and social impacts of the evacuation, the rationale and execution of livestock evacuation, and the factors that encouraged farmers ... heavy ashfall hazards Over 20,000 cattle were evacuated from areas impacted by heavy ashfalls in the weeks following the eruption warnings have dramatically reduced casualties from volcanic hazards ... had evacuated from Los Antiguos due to the health hazards from airborne ash inflaming a chronic asthma condition The family had Table Roof collapse mitigation actions Ash & snow fall depth (farmer...
- 11
- 418
- 0
I Love Kickoff: How to create a successful project culture from the first meeting.
... Doesn’t evaluate Doesn’t contribute Coordinates/Manages @kevinmhoffman #kickoffs Facilitator Recorder Is a neutral servant Doesn’t evaluate Doesn’t contribute Coordinates/Manages @kevinmhoffman Creates ... @kevinmhoffman #kickoffs Does a great kickoff meeting guarantee a great project? NO! @kevinmhoffman #kickoffs Does a great kickoff meeting guarantee a great project? NO! Does a lousy kickoff guarantee project ... Contributes ideas Stays positive Isn’t defensive Checks/balances @kevinmhoffman #kickoffs Facilitator Recorder Is a neutral servant Doesn’t evaluate Doesn’t contribute Coordinates/Manages Creates...
- 120
- 440
- 0
- variations on a theme by mozart from the magic flute opus 9
- they start in the north west but lie only a few hundred miles from the centre in more southrn areas
- create a windows based application from the command line
- the ability of the ventricles to generate blood flow and pressure is derived from the ability of individual myocytes to shorten and generate force myocytes are tubular structures during contraction the muscles shorten and gene
- a few enriching ideas from the classic classical civilization
- run a single user boot from the cd rom
- a new dihydroisoquinoline alkaloid from the roots of stephania brachyandra diels
- situations a mixed motive perspective from the dadia soufli lefkimi forest national park greece
- a terrestrial pulmonate gastropod from the late miocene baynunah formation emirate of abu dhabi uae
- a monkey primates cercopithecidae from the late miocene of abu dhabi uae
- lutamide a new ceramide isolated from the leaves of ficus lutea
- b—a complex organic compound from the ginkgo tree
- 16 20 a file chooser resulting from the user clicking on browse in a file upload control
- ffts derived from the mir
- of the advantages which europe has derived from the discovery of america and from that of a passage to the east indies by the cape of good hope
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008