Báo cáo khoa học: Small peptides derived from the Lys active fragment of the mung bean trypsin inhibitor are fully active against trypsin pptx

Small peptides derived from the Lys active fragment of the mung bean trypsin inhibitor are fully active against trypsin Rui-Feng Qi 1 , Zhi-Xue Liu 2 , Shao-Qiong Xu 1 , Ling Zhang 1 , Xiao-Xia Shao 1 and Cheng-Wu Chi 1,2 1 Institute of Protein Research, Tongji University, Shanghai, China 2 Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, Shanghai, China Introduction Proteinase inhibitors occur ubiquitously in microor- ganisms, plants, and animals [1]. In plants, there are a variety of serine proteinase inhibitors, which are divided into 16 classes [2]. A Bowman–Birk protease inhibitor (BBI) was first isolated from soybean by Bowman [3], and was later characterized by Birk et al. [4]. BBIs have been found in the Fabaceae [5,6], with two catalytic sites [7–10]. The specificity of each reactive site is dependent on the amino acid at the P 1 position. The structural features, molecular evolution and potential applications of BBIs were reviewed in our recently published article [11]. BBIs share a homologous sequence, especially in the reactive site loop, and a conserved seven disulfide bridge network [12]. Because of the highly stable struc- ture of disulfide bridges, BBIs can be resistant even to cooking temperatures, and can survive in the digestive system of animals [13]. Thus, one important role of BBIs is thought to be as defensive agents against insect and microbial pest attack [14,15], and plants with BBI transgenes can efficiently retard larval growth [16]. In addition, it was found that BBIs may act as cancer preventive and suppressing agents; for example, the soybean BBI concentrate was tested in phase II clinical Keywords Bowman–Birk inhibitor (BBI); gene cloning; gene expression; inhibitory activity; peptide synthesis Correspondence C W. Chi, Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, 320 Yue Yang Road, Shanghai 200031, China Fax: +86 21 54921011 Tel: +86 21 54921165 E-mail: zwqi@sibs.ac.cn or chi@sunm.shcnc.ac.cn (Received 23 August 2009, revised 20 October 2009, accepted 4 November 2009) doi:10.1111/j.1742-4658.2009.07476.x The Bowman–Birk protease inhibitors have recently attracted attention for their potential as cancer preventive and suppressing agents. They contain two canonical binding loops, both consisting of nine highly conserved resi- dues capable of inhibiting corresponding serine proteases. In this study, we cloned the cDNA of the mung bean trypsin inhibitor, one of the most studied Bowman–Birk protease inhibitors. A modified peptide, Lys33GP, with 33 residues derived from the long chain of the Lys active fragment of mung bean trypsin inhibitor, was successfully expressed in Escherichia coli as a glutathione-S-transferase fusion protein. The recombinant product was obtained with a high yield, and exhibited potent inhibitory activity. Mean- while, a shorter peptide composed of only 16 residues (the Lys16 peptide), corresponding to the active core of the fragment, was synthesized. Both the recombinant and the synthesized peptides had the same inhibitory activity toward trypsin at a molar ratio of 1 : 1, implying that the Lys16 peptide with two disulfide bonds is possibly the essential structural unit for inhibitory activity. Using site-directed mutagenesis, the P 1 position Lys was replaced by Phe, and the resulting mutant, Lys33K ⁄F, was determined to have potent chymotrypsin inhibitory activity. Both Lys33GP and the Lys33K ⁄ F mutant may be potential pharmaceutical agents for the prevention of oncogenesis. Abbreviations Acm, acetamidomethyl; BApNA, N-benzoyl- DL-arginine-p-nitroanilide; BBI, Bowman–Birk protease inhibitor; BTEE, N-benzoyl-L-tyrosine ethyl ester; Fmoc, fluorenylmethoxycarbonyl; GST, glutathione-S-transferase; IPTG, isopropyl thio-b- D-galactoside; MBTI, mung bean trypsin inhibitor; PSP, PreScission protease; SFTI-1, sunflower trypsin inhibitor-1; SOE-PCR, splicing by overlapping extension PCR; TFA, trifluoroacetic acid; Trt, trityl. 224 FEBS Journal 277 (2010) 224–232 ª 2009 The Authors Journal compilation ª 2009 FEBS trials for the treatment of patients with oral leucopla- kia [17–19]. As tumor formation is related to an abnormally high protease activity, especially the chy- motrypsin-like protease activity, it would be desirable to discover a small peptide drug capable of inhibiting this enzyme. In the early 1960s, we purified and crystallized mung bean trypsin inhibitor (MBTI) and its com- plexes with one or two molecules of trypsin [20,21]. We also demonstrated that MBTI contains two active domains [22]. Later, the two active fragments of MBTI were successfully separated by restricted peptic digestion [23], and the sequence of MBTI was eluci- dated [24]. The active fragment with Arg at the reac- tive site P 1 is composed of 27 residues, whereas the active fragment with Lys at the reactive site is com- posed of two peptide chains, a 26-residue long chain being linked to a nine-residue short chain by two in- termolecular disulfide bonds. The two peptide chains of the Lys active fragment could be separated from each other by reduction, and the long peptide chain still exhibited inhibitory activity after reoxidation [25]. A 22-residue peptide derived from the long chain, with three intramolecular disulfide bonds, was synthesized, giving two disulfide isoforms, both of which remained active against trypsin, with K i values of 1.2 · 10 )7 m and 4 · 10 )8 m, respectively [26]. In the present article, we describe the cDNA cloning of MBTI, and the gene expression of a 35-residue peptide and its mutant both derived from the long chain of the Lys active fragment of MBTI. The total synthesis of a 16-residue peptide corresponding to the core of the active fragment and the inhibitory activity assays of all expressed and synthetic peptides are also reported. Results Gene cloning of MBTI In the early 1980s, we elucidated the incomplete pro- tein sequence of MBTI with 72 residues [24]. In the present work, based on the known amino acid sequence, we cloned the cDNA of MBTI (GeneBank accession number AY713305) by using 3¢-RACE and 5¢-RACE (Fig. 1). The 591 bp full-length cDNA includes a 3¢-UTR and two polyA signals (AATAAA) located upstream of the polyA tail. The 321 bp ORF encodes a 107-residue protein that shares high sequence homology with several BBIs from other leguminous dicotyledons (Fig. 2). The MBTI gene (GeneBank accession number AY251011) was then amplified from total genomic DNA, demonstrating that there is no intron in the genomic gene sequence. The deduced MBTI sequence was compared with the previously determined sequence [24,27] and the MBTI-F reported by Wilson et al. [28] (PRF accession number 0907248A) (Fig. 3). The results showed that the deduced sequence was basically consistent with the determined sequence, except for six undetermined resi- dues at the N-terminus and two additional Asp resi- dues at the C-terminus. These differences can be explained by the fact that the previous sample used for sequencing was first treated with aminopeptidase M to eliminate the heterogeneity of the N-terminal part of MBTI, so the N-terminal hexapeptide (SSHHHD) was neglected. Also, the two additional Asp residues were missed because they followed an Asp residue that was regarded as the terminal end of the determined sequence. Therefore, the deduced sequence consists of a 19-residue signal peptide predicted by the signalp program [29], followed by a short eight-residue peptide (GMDLNQLR) that may be a propeptide, and an 80-residue mature protein. Design and expression of the recombinant Lys33GP and Lys33K ⁄ F peptides Gene expression of the intact MBTI was unsuccessful because of mispairing of its seven disulfide bonds, and the inhibitory activity of the recombinant only accounted for 1 ⁄ 10 of the activity of the native MBTI (unpublished data). Subsequently, we attempted to express a smaller fragment of MBTI that may have more significant activity for potential applications. Our early studies indicated that the long peptide chain of the Lys fragment (Fig. 4A) still retained antitrypsin activity after air oxidation [25]. The synthetic gene coding for this peptide was designed as follows: (a) as a very small peptide is not suitable for gene expression, the gene coding for the total N-terminal part of MBTI, from residues 1 to 33, designated Lys33GP (Fig. 4B) was amplified by splicing by overlap extension PCR (SOE-PCR), using synthetic primers 1 and 2 (Fig. 5A); (b) in order to avoid formation of isoforms caused by disulfide mispairing, the Cys12 and Cys16 linked with the short chain of the Lys active fragment were mutated to Ser (Figs 4B and 5A); (c) two residues, Gly and Pro, were introduced before to the N-terminus of Lys33GP, as these two residues correspond to the C-terminal part of the recognition sequence for the PreScission protease (PSP) (Leu-Glu-Val-Leu-Phefl- Gly-Pro; the arrow indicates the scissile bond) used to cleave the Lys33GP fusion protein; (d) the preferential amino acid codons of Escherichia coli were used for better expression; and (e) to create the mutant Lys33K ⁄F, the reactive site Lys20 at the P 1 position R F. Qi et al. Recombinant peptides of mung bean trypsin inhibitor FEBS Journal 277 (2010) 224–232 ª 2009 The Authors Journal compilation ª 2009 FEBS 225 Fig. 1. cDNA and deduced sequences of MBTI. The ORF is in capital letters, and the 3¢-UTR sequence is in small letters. The sequence of the signal peptide is shaded, and the following eight residues comprise the putative prosequence. The sequence corresponding to the 80-residue mature protein is in bold. The two polyA signals, AATAAA, in the 3¢-UTR are underlined. (a) n represents polyA. GSP1, gene-specific primer 1; GSP2, gene-specific primer 2. Fig. 2. Sequence alignment of BBIs from soybean (Glycine max, P01055), kidney bean (Phaseolus vulgaris, P01060), cowpea (Vigna ungui- culata, Q1WA43), garden bean (Pisum sativum, Q41066), lentil (Lens culinaris, Q8W4Y8), and mung bean (Vigna radiata). Identical or similar residues are shaded in black or gray. The potential N-terminal signal peptides are boxed; two canonical loops of nine residues are underlined; the two residues at the P 1 position are indicated by asterisks. Recombinant peptides of mung bean trypsin inhibitor R F. Qi et al. 226 FEBS Journal 277 (2010) 224–232 ª 2009 The Authors Journal compilation ª 2009 FEBS was replaced with Phe. The synthetic gene of Lys33GP flanked by EcoRI and XhoI restriction sites was then cloned into the pGEX-4T-1 expression vector. The recombinant Lys33GP was expressed in E. coli strain BL21(DE3) (Fig. 5B, lanes 1–6) as a glutathi- one-S-transferase (GST) fusion protein, and the yield was found to be relatively high at around 180–200 mg per liter of culture. The fusion protein GST–Lys33GP was purified in a one-step procedure by affinity chro- matography, using a glutathione Sepharose 4B matrix (Fig. 5B, lane 6), and successfully cleaved by PSP (Fig. 5B, lanes 6 and 7). The recombinant 35-residue Lys33GP was then applied to an RP-HPLC C18 semi- preparative column (Fig. 5C). The molecular mass of the purified Lys33GP was determined by MS to be 3702.0 Da (Fig. 5D), consistent with the theoretical value of 3703.0 Da (Table 1). The mutant Lys33K ⁄ F was also expressed in the same system with a yield of approximate 20–30 mg of fusion protein per liter of culture, much lower than the yield of Lys33GP. The molecular mass of Lys33K ⁄ F was determined to be 3722.0 Da, which is identical to the theoretical value (Table 1). Chemical synthesis of the core peptide Lys16 To determine the minimal unit necessary for the inhibi- tory activity of BBI, a linear peptide with only 16 residues (CDSSRCTKSIPPQCHC), the core sequence of Lys33GP (from Cys13 to Cys28), was synthesized using fluorenylmethoxycarbonyl (Fmoc)-based solid- phase peptide synthesis on an ABI 433 peptide synthe- sizer. After two-step selective oxidation of disulfide bonds and purification on a reverse-phase C18 semi- preparative column, the Lys16 peptide, consisting of only two conjugated loops (Fig. 4C), was correctly formed and confirmed by MS. The molecular mass was 1761.0 Da, which is identical to the theoretical value (Table 1). Inhibition kinetic analysis of Lys33GP, Lys33K ⁄ F, and Lys16 peptide The inhibition kinetics of the native MBTI, Lys33GP, Lys33K ⁄F and the Lys16 peptide for bovine trypsin or chymotrypsin were studied by determining the equilib- rium dissociation constant K i , using the Dixon plot Fig. 3. Sequence comparison of MBTI with MBTI-F (PRF: 0907248A) and the cDNA-deduced sequence MBTI (Ded.). Identical residues are shaded in black or gray. The potential N-terminal signal peptides are boxed. A CD B Fig. 4. Amino acid sequence and schematic structure of four peptides: the Lys fragment (A), Lys33GP (B), the Lys16 peptide (C), and SFTI-1 (D). The two shaded residues (Cys12 and Cys16) linked with the short chain of the Lys active fragment were mutated to Ser. Gly-Pro derived from the cleavage site of PSP is not numbered and is also shaded. The reactive site P 1 residue is indicated by asterisks. Our residue numbering system according to MBTI is used. R F. Qi et al. Recombinant peptides of mung bean trypsin inhibitor FEBS Journal 277 (2010) 224–232 ª 2009 The Authors Journal compilation ª 2009 FEBS 227 method (Table 1). The substrates N-benzoyl-dl-argi- nine-p-nitroanilide (BApNA) for trypsin and N-ben- zoyl-l-tyrosine ethyl ester (BTEE) for chymotrypsin were used in the assays. The K i value of the native MBTI (5.24 · 10 )9 m) was in good agreement with that previ- ously reported (5.0 · 10 )9 m [26,30]), and the K i values of the expressed Lys33GP and the Lys16 peptide were 2.12 · 10 )8 m and 2.28 · 10 )8 m, respectively. The mutant Lys33K ⁄F displayed a strong inhibitory activity toward chymotrypsin, with a K i of 7.21 · 10 )9 m; mean- while, it also maintained an apparent activity towards trypsin, with a K i of 1.30 · 10 )6 m. The native double- headed MBTI is capable of inhibiting two molecules of trypsin, whereas both Lys33GP and Lys16 peptide with one reactive site, as expected, can each inhibit only one molecule of trypsin, as shown in Fig. 6A, similar to the interaction between the mutant Lys33K ⁄F and chymo- trypsin (Fig. 6B). A BC 1.05e5 1.00e5 9.50e4 9.00e4 8.50e4 8.00e4 7.50e4 7.00e4 6.50e4 6.00e4 5.50e4 5.00e4 4.50e4 4.00e4 3.50e4 3.00e4 2.50e4 1.50e4 1.00e4 5000.00 2.00e4 3702.0 2000 2200 2400 2600 2800 3000 3200 3400 3600 3800 4000 4200 4400 4600 4800 5000 Mass ( amu ) 2073.0 2223.0 2503.0 2776.0 2963.0 3046.0 3212.0 3416.0 3723.0 3684.0 3759.0 4099.0 4281.0 4446.0 4627.0 4664.0 D Mass reconstruction of +EMS: 0.738 to 1.122 min from Sample 14 (Qrf15) of 080722.wiff (Turbo Sp Max. 1.1e5 cps. Fig. 5. Gene synthesis of the recombinant Lys33GP and its expression in E. coli BL21(DE3). (A) Gene amplification of Lys33GP with two designed primers by SOE-PCR. Two Cys residues mutated to Ser are marked by squares. The flanking EcoRI and XhoI restriction sites were designed for cloning into the pGEX-4T-1 vector. The boxed nucleotide acid sequence corresponds to the recognition region of PSP (the scis- sile bond between Glu and Gly is indicated by fl). (B) Expression and cleavage of the fusion protein GST–Lys33GP detected by SDS ⁄ PAGE in a 10% polyacrylamide gel. Lane M: molecular mass marker. Lane 1: pre-IPTG induction. Lane 2: after IPTG induction for 3 h. Lane 3: the supernatant after sonication. Lane 4: the unbound fraction on the GST affinity resin. Lane 5: the purified GST–Lys33GP eluted from the GST resin. Lane 6: GST–Lys33GP cleaved partially by PSP. Lane 7: GST–Lys33GP completely cleaved with PSP, the electrophoretic band above the band of GST comes from the PSP enzyme preparation itself; compared with the molecular mass of GST, Lys33GP was too small to be detected and ran out of the gel. Line 8: the PSP enzyme preparation itself. (C) HPLC profile of the purified GST–Lys33GP after enzymatic cleavage with PSP. (D) The sequence of purified Lys33GP and the MS profile. Lys33GP contains additional Gly-Pro derived from the PSP recognition region at the N-terminus, and two Cys residues are mutated to Ser (underlined). Recombinant peptides of mung bean trypsin inhibitor R F. Qi et al. 228 FEBS Journal 277 (2010) 224–232 ª 2009 The Authors Journal compilation ª 2009 FEBS Discussion A reported array of BBI variants caused by polymor- phism has been found, not only in mung bean, but also in pea, horsegram, and other legume seeds [28,31– 33]. Wilson et al. reported that ungerminated seeds of mung bean contain a main BBI protein (designated MBTI-F), as well as several polymorphic forms derived from MBTI-F by limited specific proteolysis at both ends [28,34]. In determining the MBTI sequence, we encountered the same problem, in that the N-termi- nus of MBTI was heterogeneous. Thus, the purified protein was briefly treated with aminopeptidase M prior to sequence determination, until the N-terminal residue could be definitely identified. Not surprisingly, as compared with the deduced MBTI peptide in this work, some residues of the N-terminus in the deter- mined sequence were neglected. Our MBTI most likely corresponds to the MBTI-F reported by Wilson et al. (Fig. 3) in 1983 [28], one year after our sequence was published. We further confirmed that the M r of the native MBTI, determined by MS, was 8883.0, consis- tent with the theoretical M r of 8884.8 for MBTI-F. As expected, the Lys16 peptide, consisting of a canonical nine-residue loop and a conjugated disulfide loop (from Cys13 to Cys28 of Lys33GP), remains active, with the same K i value as that of the recombi- nant Lys33GP. Furthermore, it is worth pointing out that the Lys16 peptide has the same topologic struc- ture as the sunflower trypsin inhibitor (SFTI-1) (Fig. 4D), a native cyclic peptide with only 14 residues. In the canonical nine-residue loop, there is only one residue difference between MBTI and SFTI-1; namely, the Gln near the disulfide bond in MBTI is replaced by Ile in SFTI-1, and instead of another disulfide loop, as in MBTI, a cyclic peptide loop is formed between the N-terminal and C-terminal residues in SFTI-1. Therefore, the SFTI-1-like Lys16 peptide should be considered as the smallest essential unit of BBI main- taining inhibitory activity. A B Fig. 6. Inhibition curves of the native MBTI, Lys33GP, the Lys16 peptide and the mutant Lys33K ⁄ F against bovine trypsin (A) and against bovine chymotrypsin (B). MBTI, Lys33GP, the Lys16 pep- tide and Lys33K ⁄ F are indicated by open circles, open squares, filled triangles, and filled squares, respectively. Table 1. The relative molecular masses (M r ) and inhibition con- stants (K i ) of the native MBTI, Lys33GP, the Lys16 peptide, and the mutant Lys33K ⁄ F. Each K i value represents the mean ± stan- dard deviation determined from three independent experiments (MBTI was identical to MBTI-F [28] as clarified by this work). Inhibitor M r K i Calculated Determined Antitrypsin Antichymotrypsin MBTI 8884.8 8883.0 (5.24 ± 0.58) · 10 –9 Lys33GP 3703.0 3702.0 (2.12 ± 0.24) · 10 –8 Lys16 peptide 1761.0 1761.0 (2.28 ± 0.52) · 10 –8 Lys33K ⁄ F 3722.0 3722.0 (1.30 ± 0.31) · 10 –6 (7.21 ± 0.18) · 10 –9 R F. Qi et al. Recombinant peptides of mung bean trypsin inhibitor FEBS Journal 277 (2010) 224–232 ª 2009 The Authors Journal compilation ª 2009 FEBS 229 BBIs may act as cancer preventive agents to suppress abnormally high protease activity, especially the chymotrypsin-like protease activity in the tumor [17–19]. Regarding therapeutic applications, BBIs are given only orally as an extract from soybeans. It will be desirable to have a small and stable peptide drug that is capable of inhibiting chymotrypsin or trypsin, or even elastase. From this point of view, our success- ful expression of the potently active Lys33GP and the mutant Lys33K ⁄ F demonstrated that it may be feasi- ble to produce BBI-derived anticarcinogenic pharma- ceuticals on a large scale for clinical therapy or treatment. Experimental procedures Materials The 3¢-RACE and 5¢-RACE kit and TRIzol Reagent were from Life Technologies (Gaithersburg, MD, USA). Taq DNA polymerase, the PCR preps DNA purification system, the Minipreps DNA purification system and the pGEM-T Easy vector system were from Promega (Madison, WI, USA). E. coli strain DH5a was used for transformation of pGEM-T Easy vector, and E. coli BL21(DE3) for expres- sion of the GST fusion protein. T4 DNA polymerase was from TaKaRa Biotechnology Co. Ltd. pGEX-4T-1 expres- sion vector, GST affinity resin (glutathione Sepharose 4B) and PSP were purchased from Amersham Biosciences (Uppsala, Sweden). The ZORBAX 300 SB-C18 semiprepar- ative column was from Agilent Technologies (Santa Clara, CA, USA). Trifluoroacetic acid (TFA) and acetonitrile were from Merck (Darmstadt, Germany). All Fmoc amino acids were obtained from Applied Biosystems (Foster City, CA, USA). Fmoc-Cys [trityl (Trt)] hydroxymethylphenoxy- methyl polystyrene resin was obtained from PE (Rockford, IL, USA). Bovine trypsin was from Sigma (St Louis, MO, USA). The chromogenic substrate BApNA was from Shanghai Bio Life Science & Technology Co. Ltd. Other solvents and reagents were of analytical grade. cDNA cloning of MBTI About 1 g of mung bean seeds at the late germinating stage was ground to fine powder in liquid nitrogen, and the total RNA was then extracted with TRIzol reagent (Invitrogen), according to the user manual. 3¢-RACE and 5¢-RACE were performed as previously described [35]. About 5 lgof RNA were taken to convert mRNAs into cDNAs, using Superscript II reverse transcriptase and a universal oligo(dT)-containing adapter primer. Gene-specific primer 1 [5¢-AT(T ⁄ C ⁄ A)CC(A ⁄ G ⁄ C ⁄ T)CC(A ⁄ G ⁄ C ⁄ T)CA(A ⁄ G)TG (T ⁄ C)CA(T ⁄ C)-3¢], corresponding to the N-terminal sequence (IPPQCH) of BBI, was paired with the abridged universal amplification primer. The 3¢-end partial cDNA of BBI was then amplified by PCR. The PCR product contain- ing a polyA tail was directly cloned into the pGEM-T Easy vector for sequencing. On the basis of the 3¢-end partial cDNA sequence of BBI, the antisense gene-specific primer 2 (5¢-TCGTGTACACATACAGGA-3¢), corresponding to residues 48–53, was designed and synthesized. With the same strategy as described previously [35], the 5¢-end cDNA of MBTI was then amplified and sequenced. Construction of recombinant Lys33GP and mutant Lys33K ⁄ F expression vector The gene coding for Lys33GP was constructed by the SOE- PCR strategy, using primer 1 (5¢-GTGAATTC CTGGAAG TTCTGTTCCAGGGGCCCAGCAGCGATGAACCGAG CGAAAGCAGCGAACCGAGCTGCGATAGCAGC-3¢) and primer 2 (5¢-GTCTCGAGTTACAGGCGAATATCG GCGCAATGGCACTGCGGCGGAATGCTTTTGGTGC AGCGGCTGCTATCGCAGCTCGG-3¢). The underlined region in the primer 1 sequence corresponds to the PSP cleavage site. The SOE-PCR product was gel-purified, and digested with EcoRI and XhoI, and the resulting fragment was then ligated into the expression vector pGEX-4T-1. The pGEX–Lys33K ⁄ F construct was reconstructed by using a pair of primers for site-directed mutagenesis: the forward and reverse primers were 5¢-CGCTGCACC TT TAGCATTCCG-3¢ and 5¢-CGGAATGCTAAAGGTGC AGCG-3¢, respectively. Gene expression and purification of the recombinant Lys33GP and Lys33K ⁄ F E. coli strain BL21(DE3) was transformed with the recom- binant plasmid GST–Lys33GP and grown in 500 mL of LB ⁄ ampicillin medium (5 gÆL )1 tryptone, 10 gÆL )1 yeast extract, 5 gÆL )1 NaCl, 100 mgÆL )1 ampicillin) at 37 °C with shaking, until A 600 reached  0.5. The culture was induced with 0.5 mm isopropyl thio-b-d-galactoside (IPTG), and the incubation was continued for another 3 h. The cells were harvested by centrifugation at 8000 g for 5 min, resus- pended in 50 mL of 1 · NaCl ⁄ P i (140 mm NaCl, 2.7 mm KCl, 10 mm Na 2 HPO 4 , 1.8 mm KH 2 PO 4 , pH 7.3) contain- ing 1 mm phenylmethanesulfonyl fluoride, and lysed by sonication on ice. The debris was removed by centrifuga- tion at 12 000 g for 10 min. The purification of the recom- binant protein was conducted according the GST gene fusion system handbook from Amersham Biosciences. The fusion protein was cleaved at 4 °C for about 5 h with PSP. The cleaved Lys33GP was loaded onto an HPLC ZOR- BAX C18 semipreparative column (9.4 · 250 mm) equili- brated with buffer A (0.1% TFA), and then eluted with a two-step gradient of 0–30% buffer B (acetonitrile in 0.1% TFA) in 5–20 min and 30–100% buffer B in 20–25 min at Recombinant peptides of mung bean trypsin inhibitor R F. Qi et al. 230 FEBS Journal 277 (2010) 224–232 ª 2009 The Authors Journal compilation ª 2009 FEBS a flow rate of 2 mLÆmin )1 . The mutant Lys33K ⁄ F was also expressed and purified with the same procedure. The puri- fied Lys33GP and Lys33K ⁄ F were lyophilized for inhibi- tory activity assays. Peptide synthesis The linear Lys16 peptide (CDSSRCTKSIPPQCHC) was synthesized using an ABI 433 peptide synthesizer, starting from Fmoc-Cys (Trt) hydroxymethylphenoxymethyl polystyrene resin (wang resin). The protected amino acids are: Fmoc-Arg (2,2,4,6,7-pentamethyldihydrobenzofuran-5- sulfonyl), Fmoc-Lys (t-butoxycarbonyl), Ser (t-butyl), Fmoc-Cys (Trt, Acm), Fmoc-His (Trt), and Fmoc-Glu (Trt). For selective oxidation of disulfide bonds, two-step oxidation of S-Trt ⁄ S-Acm was adopted [36]. The TFA- labile Trt protecting group was used for Cys13 and Cys28 (outer conjugated loop), and the TFA-stable Acm protect- ing group for Cys18 and Cys26 (inner canonical loop). After completion of solid-phase synthesis, the resin was cleaved by TFA containing 5% p-cresol and a few drops of triethylsilane and thioanisole for 1.5 h at room tempera- ture. After removal of TFA, the product was washed with diethyl ether and extracted with 0.1% TFA containing 20% acetonitrile. The extract was then lyophilized and purified on a Sephadex G-15 column equilibrated with 0.1% TFA. The eluted peptide fraction was lyophilized and further purified on an RP-HPLC ZORBAX C18 semipreparative column (9.4 · 250 mm) equilibrated with buffer A (0.1% TFA) at a flow rate of 2 mLÆ min )1 . The peptide was eluted by a two-step gradient system: 0–18% buffer B (70% aceto- nitrile ⁄ 0.1% TFA) in 6 min, and 18–28% buffer B in 6–26 min. The purified peptide was characterized by MS. All protecting groups except Acm were removed. The deprotected Cys13 and Cys28 were oxidized to form the first disulfide bond in 50 mm Tris ⁄ HCl (pH 8.7) at room temperature in air for 1.5 h; the peptide was then acidified with 50% TFA and lyophilized. After being desalted on a Sephadex G15 column and purified by RP-HPLC, the pep- tide was dissolved in 0.1% TFA and treated with 5 mm iodine (1 : 5 molar ratio of the peptide to I 2 ) to remove the Acm protecting group and allow the formation of another disulfide bond (Cys18 and Cys26) [36]. The two disulfide bonds were then correctly paired, and the peptide was puri- fied on a ZORBAX C18 semipreparative column equili- brated with buffer A (0.1% TFA) at a flow rate of 2mLÆmin )1 with a two-step gradient system: 0–25% buffer B (70% acetonitrile ⁄ 0.1% TFA) in 8 min, and 25–30% buf- fer B in 8–28 min. The synthetic peptide was again charac- terized by MS. MS The expressed and synthetic peptides were analyzed in the scan type of Enhanced MS by Qtrap (Applied Biosystems, Foster City, CA, USA). The mass spectrometer, equipped with a TurboIonSpray Source, was operated in positive ionization mode. Inhibition kinetic analysis The assay for trypsin inhibitory activity of the native MBTI, Lys33GP, Lys33K ⁄ F and the Lys16 peptide was performed in 3 mL of 0.05 m Tris ⁄ HCl (pH 7.8) and 10 mm CaCl 2 , containing 5 lgÆmL )1 trypsin and various amounts of the sample, using BApNA (500 lm) as a sub- strate. All assays were carried out at 25 °C. The enzyme was first incubated with the inhibitor for 5 min to allow equilibrium to be reached, and the BApNA was then added. The residual trypsin activity was measured at 410 nm with a U-2800 spectrophotometer (Hitachi, Tokyo, Japan). The assay for chymotrypsin inhibitory activity of Lys33K ⁄ F used BTEE as a substrate at a concentration of 90 lm and 5 lgÆmL )1 chymotrypsin. The residual activ- ity was measured at 259 nm. The inhibition constants (K i ) for trypsin or chymotrypsin were determined by Dixon plot (1 ⁄ V against I), using two different concentrations of substrate, 300 and 600 lm for BApNA, and 50 and 100 lm for BTEE. Acknowledgements We thank Z Y. Guo for helpful discussions. We also would like to thank J B. Han for her generous assis- tance in this work. References 1 Laskowski M Jr & Kato I (1980) Protein inhibitors of proteinases. Annu Rev Biochem 49, 593–626. 2 Ryan CA (1990) Protease inhibitors in plants: genes for improving defenses against insects and pathology. Annu Rev Phytopathol 28, 425–449. 3 Bowman I (1946) The millionth map of Hispanic Amer- ica. Science 103, 319–323. 4 Birk Y, Gertler A & Khalef S (1963) A pure trypsin inhibitor from soya beans. Biochem J 87, 281–284. 5 Norioka S & Ikenaka T (1983) Amino acid sequence of a trypsin–chymotrypsin inhibitor, B-III, of peanut (Arachis hypogaea). J Biochem 93, 479–485. 6 Tanaka AS, Sampaio MU, Marangoni S, de Oliveira B, Novello JC, Oliva ML, Fink E & Sampaio CA (1997) Purification and primary structure determination of a Bowman–Birk trypsin inhibitor from Torresea cearensis seeds. Biol Chem 378, 273–281. 7 Odani S, Koide T & Ono T (1986) Wheat germ trypsin inhibitors. Isolation and structural character- ization of single-headed and double-headed inhibitors of the Bowman–Birk type. J Biochem 100, 975–983. R F. Qi et al. Recombinant peptides of mung bean trypsin inhibitor FEBS Journal 277 (2010) 224–232 ª 2009 The Authors Journal compilation ª 2009 FEBS 231 8 Tashiro M, Hashino K, Shiozaki M, Ibuki F & Maki Z (1987) The complete amino acid sequence of rice bran trypsin inhibitor. J Biochem 102, 297–306. 9 Tashiro M, Asao T, Hirata C, Takahashi K & Kanamori M (1990) The complete amino acid sequence of a major trypsin inhibitor from seeds of foxtail millet (Setaria italica). J Biochem 108, 669–672. 10 Prakash B, Selvaraj S, Murthy MR, Sreerama YN, Rao DR & Gowda LR (1996) Analysis of the amino acid sequences of plant Bowman–Birk inhibitors. J Mol Evol 42, 560–569. 11 Qi RF, Song ZW & Chi CW (2005) Structural features and molecular evolution of Bowman–Birk protease inhibitors and their potential application. Acta Biochim Biophys Sin (Shanghai) 37, 283–292. 12 Odani S & Ikenaka T (1973) Studies on soybean trypsin inhibitors. 8. Disulfide bridges in soybean Bowman– Birk proteinase inhibitor. J Biochem 74, 697–715. 13 Voss RH, Ermler U, Essen LO, Wenzl G, Kim YM & Flecker P (1996) Crystal structure of the bifunctional soybean Bowman–Birk inhibitor at 0.28-nm resolution. Structural peculiarities in a folded protein conforma- tion. Eur J Biochem 242, 122–131. 14 Domoney C (1999) Inhibitors of Legume Seeds. Kluwer Academic Publishers, Dordrecht. 15 Richardson M (1991) Seed Storage Proteins: the Enzyme Inhibitors, Vol. 5. Academic Press, New York. 16 Falco MC & Silva-Filho MC (2003) Expression of soybean proteinase inhibitors in transgenic sugarcane plants: effects on natural defense against Diatraea saccharalis. Plant Physiol Biochem 41, 761–766. 17 Kennedy AR (1998) The Bowman–Birk inhibitor from soybeans as an anticarcinogenic agent. Am J Clin Nutr 68, 1406S–1412S. 18 Armstrong WB, Kennedy AR, Wan XS, Taylor TH, Nguyen QA, Jensen J, Thompson W, Lagerberg W & Meyskens FL Jr (2000) Clinical modulation of oral leukoplakia and protease activity by Bowman–Birk inhibitor concentrate in a phase IIa chemoprevention trial. Clin Cancer Res 6, 4684–4691. 19 Malkowicz SB, McKenna WG, Vaughn DJ, Wan XS, Propert KJ, Rockwell K, Marks SH, Wein AJ & Kennedy AR (2001) Effects of Bowman–Birk inhibitor concentrate (BBIC) in patients with benign prostatic hyperplasia. Prostate 48, 16–28. 20 Chu HM, Lo SS, Jen MH, Chi CW & Tsao TC (1965) The relationship between trypsin inhibitors A and B from mung bean (Phaseolus aureus Roxb.) and some chemical characteristics of the inhibitors. Sci Sin 14, 1454–1463. 21 Chu HM & Chi CW (1965) The isolation and crystalli- zation of two trypsin inhibitors of low molecular weight from mung bean (Phaseolus aureus Roxb.). Sci Sin 14, 1441–1453. 22 Chu HM & Chi CW (1965) Divalency of the mung bean inhibitor and the crystallization of two corre- sponding inhibitor–trypsin compounds. Acta Biochim Biophys Sin (Shanghai) 5, 519–528. 23 Tan F & Chi CW (1982) Active domains in mung bean trypsin inhibitor. Sci Sin [B] 25, 160–167. 24 Zhang Y, Luo S, Tan F, Qi Z, Xu L & Zhang A (1982) Complete amino acid sequence of mung bean trypsin inhibitor. Sci Sin [B] 25, 268–277. 25 Tan FL, Shi QL, Wang LX & Chi CW (1984) Studies on the mung bean trypsin inhibitor: reduction and reox- idation of the disulfide bonds of Lys active fragment. Sci China Ser B-Chem 27, 918–925. 26 Li Y, Huang Q, Zhang S, Liu S, Chi C & Tang Y (1994) Studies on an artificial trypsin inhibitor peptide derived from the mung bean trypsin inhibitor: chemical synthesis, refolding, and crystallographic analysis of its complex with trypsin. J Biochem 116, 18–25. 27 Lin G, Bode W, Huber R, Chi C & Engh RA (1993) The 0.25-nm X-ray structure of the Bowman–Birk-type inhibitor from mung bean in ternary complex with por- cine trypsin. Eur J Biochem 212, 549–555. 28 Wilson KA & Chen JC (1983) Amino acid sequence of mung bean trypsin inhibitor and its modified forms appearing during germination. Plant Physiol 71, 341–349. 29 Bendtsen JD, Nielsen H, von Heijne G & Brunak S (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340, 783–795. 30 Tan F, Lo SS, Chi CW, Xu L & Zhu D (1981) Studies on the mung bean trypsin inhibitor. Characterization of the N-terminal active fragment. Acta Biochim Biophys Sin (Shanghai) 13, 407–416. 31 Clementea A & Domoney C (2006) Biological signifi- cance of polymorphism in legume protease inhibitors from the Bowman–Birk family. Curr Protein Pept Sci 7, 201–216. 32 Domoney C, Welham T, Sidebottom C & Firmin JL (1995) Multiple isoforms of Pisum trypsin inhibitors result from modification of two primary gene products. FEBS Lett 360, 15–20. 33 Kumar P, Sreerama YN & Gowda LR (2002) Forma- tion of Bowman–Birk inhibitors during the germination of horsegram (Dolichos biflorus). Phytochemistry 60, 581–588. 34 Lorensen E, Prevosto R & Wilson KA (1981) The appearance of new active forms of trypsin inhibitor in germinating mung bean (Vigna radiata) seeds. Plant Physiol 68, 88–92. 35 Wu JJ, Dai L, Lan ZD & Chi CW (1999) Genomic organization of three neurotoxins active on small con- ductance Ca2+-activated potassium channels from the scorpion Buthus martensi Karsch. FEBS Lett 452, 360–364. 36 Nielsen JS, Buczek P & Bulaj G (2004) Cosolvent- assisted oxidative folding of a bicyclic alpha-conotoxin ImI. J Pept Sci 10, 249–256. Recombinant peptides of mung bean trypsin inhibitor R F. Qi et al. 232 FEBS Journal 277 (2010) 224–232 ª 2009 The Authors Journal compilation ª 2009 FEBS . Small peptides derived from the Lys active fragment of the mung bean trypsin inhibitor are fully active against trypsin Rui-Feng Qi 1 ,. expression of a 35-residue peptide and its mutant both derived from the long chain of the Lys active fragment of MBTI. The total synthesis of a 16-residue