torque characteristic of d c motor
Text book of electrical technology
... Metal Arc Welding—Advantages of Coated Electrodes—Types of Joints and Types of Applicable Welds—Arc Welding Machines—V-I Characteristics of Arc Welding D. C Machines — D. C Welding Machines with Motor ... System—Chopper Speed Control of a WRIM—Electronic Speed Control of Synchronous Motors—Speed Control by Current fed D. C Link—Synchronous Motor and Cycloconverter— Digital Control of Electric Motors ... with D. C Motors — Objective Tests 44 Industrial Applications of Electric Motors Advantages of Electric Drive—Classification of Electric Drives —Advantages of Individual Drive—Selection of a Motor Electrical...
- 454
- 849
- 1
RAMIFICATION OF THE GAUSS MAP AND THE TOTAL CURVATURE OF A COMPLETE MINIMAL SURFACE
... Φ∗ ds ds = Γ0 0,w0 C ( R2 2R )ρ |dw| < +∞, − |w|2 where d 0 denotes the length of the divergent curve Γ0 in M, contradicting the assumption of completeness of M Thus, we conclude that A1 is complete ... Thus we can find a positive constant C such that C |d | ≥ |z − z0 | ρ∗ q |dz| in a neighborhood of z0 and then, combining with (3.21), we thus have d = ∞ contradicting the finite lenght of γ Therefore ... have Gξ = Gz ·( ), g is well defined d (independently of the (local) holomorphic coordinate) Moreover, if ds2 is the metric on M induced by the standard metric on Rm , we have G = Gz := (g0 ,...
- 24
- 372
- 0
Báo cáo y học: "Monocyte surface expression of Fcγ receptor RI (CD64), a biomarker reflecting type-I interferon levels in systemic lupus erythematosus" pptx
... 5'-GCA CTG GAG CTG GAA ATA GC-3'; CCR2 forward 5'-ATC TCC GCC TTC ACT TTC TG-3', reverse 5'-AAT GCG TCC TTG TTC AAT CC-3'; CCL2 forward 5'-CTG CTC ATA GCA GCC ACC TT-3', reverse 5'-TCC TGA ACC CAC ... paraformaldehyde PBS For dendritic cell characterization, cells were stained with Lin-FITC (a cocktail of anti-CD3, -CD14, -CD16, -CD19, -CD20, and -CD56), anti-CD123-PE (clone 9F5), antiHLA-DR-PerCP, ... CAC TTC TGC TT-3'; CX3CR1, forward 5'-GAC TGG CAG ATC CAG AGG TT-3', reverse 5'-ACC AAC AAA TTT CCC ACC AG-3'; CX3CL1, forward 5'-GGC TCC GAT ATC TCT GTC GT-3', reverse 5'-CTG CAC GTG ATG TTG CAT...
- 12
- 200
- 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
... using brominated fatty acid 15-bromopentadecanoic acid (BrC15-Ac) (Fluka, France) and palmitic acid (C1 6-Ac) BrC15-Ac and C1 6-Ac were weighed and dissolved in 100% EtOH as 10 mM stock solutions ... ASP 3c formed only the predicted pair of disulfide bonds, it is likely that the protein was properly folded as corroborated by circular dichroism study The ASP 3c CD spectrum and the secondary structure ... with those reported for other CSPs The deduced amino acid sequence of ASP 3c compared with those of other insect CSPs and related proteins clearly identified ASP 3c as a member of the CSP family (Fig...
- 11
- 642
- 0
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx
... Fall darf der Kurde allerdings trotz der Entscheidung der Bundesrichter nicht in die In the concrete case may the Kurd however despite the decision of the federal judges not to the T¨ rkei abgeschoben ... sentence can be (re)generated from the corresponding f-structure for only 62% of the sentences used, usually because of differences in punctuation Hence this exact match upper bound An upper bound ... abgeschoben werden, weil u ihm dort nach den Feststellungen der Vorinstanz Turkey deported be because him there according to the conclusions of the court of lower instance politische Verfolgung droht...
- 9
- 479
- 0
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx
... 5¢-TBACNCARTCNGCNTAYGTBGARAA-3¢ 5¢-GTTCTAAGCTTTTAAGGCGTCTGAGTGGC-3¢ 5¢-AGTTTCAGGGTCAACAACCCTG-3¢ 5¢-CTCGAATTCATGACAACGGTAGCTGCTTCTC-3¢ 5¢-CTCGGATCCATGGCTGATGATGGAAGCAG-3¢ 5¢-TCAGCGTCACCGTTATCCTC-3¢ ... 5¢-GTGAGAAATGGAGATGCTGC-3¢ 5¢-TGTTCCGGAGAGCCTCCTC-3¢ 5¢-CAACGGAAGCACGCATAGGAGCAC-3¢ 5¢-CACCGCATGCATAACTCTAGCTCCTTCTCTTG-3¢ 5¢-GTAAAACGACGGCCAGT-3¢ Ó FEBS 2002 4-Coumarate:CoA ligase gene family from Glycine ... 4CL13-EcoRI 4CL14-BamHI 4CL14-GSP1 4CL14-GSP2 4CL16-GSP1 4CL16-GSP2 4CL16-SphI Seq1 5¢-GTTGCGTAGGACGAGCAT-3¢ 5¢-CGGATGCCGATTTTGTGGAGG-3¢ 5¢-GCTGGTACCGCACCTTCTCCACAAG-3¢ 5¢-TCYGGRTCRTTNAGRTADCCTTTCAT-3¢...
- 12
- 448
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC CLAP_2:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC L N A V T ... R C 600 532 188 CLAP_1:TCCAGTTTTTTCTGATCTTGTGGAGCTCATTGATAGAGCAGGTCTTGATGAAGCTCTTCAAACCCATGGACCTATTACTTTCTTTGCCCCAAGCAATGAT CLAP_2:TCCAGTTTTTTCTGATCTTGTGGAGCTCATTGATAAAGCAGGTCTTGATGAAGCTCTTCAAACCCATGGACCTATTACTTTCTTTGCCCCAAGCAATGAT ... CLAP_1:GTCATAAGGAAACTCCCTCCTGATGTGATTAAACACCTTGTTGATGACCCAGCTCTCCTAAAAGAAGTTTTAACCTACCATGTCTTGTCTGGAACCTTCT CLAP_2:GTCATAAGGAAACTCCCTCCTGATGTGATTAAACACCTTGTTGATGACCCAGCTCTCCTAAAAGAAGTTTTAACCTACCATGTCTTGTCTGGAACCTTCT V I R K L P P D V I K H L V D D P A L L K E V...
- 12
- 772
- 0
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot
... hydroxybenzoic acids: 4-hydroxybenzoic acid (I) and 3,4,5-trihydroxybenzoic acid (gallic acid) (II), or the hydroxycinnamic acids: 4-hydroxycinnamic acid (p-coumaric acid) (III) and 3,4-dihydroxycinnamic ... hydroxybenzoic acid) (II), p-coumaric acid (4-hydroxycinnamic acid) (III) and caffeic acid (3,4-dihydroxycinnamic acid) (IV) were purchased from Merck, (Fig 1) Kaempferol (3,4¢,5,7-tetrahydroxyflavone) ... 4¢-O-methyltransferase activity Enzyme activity measured in the presence of the different added factors, and expressed as relative to that of controls that did not receive additions Additions Concentration...
- 10
- 624
- 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx
... BG1279 (5¢-GCGCG CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG1297 (5¢-GCGCGGGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in the sequences) In order to ... removal of EDTA, full enzyme activity could be recovered by the addition of mm ZnCl2 or CoCl2 Activity could be partially restored by the addition of MgCl2 (69%) and NiCl2 (27%) Metal analysis of ... the reduction reaction The activity of Pf-TDH was significantly increased by the addition of mm CoCl2 (relative activity to that of the standard reaction 170%) and not by the addition of mm ZnCl2...
- 8
- 415
- 0
Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot
... oxygenated product + H2O Oxygenation reaction (b) did not occur As detailed in the text, oxygenated products were detected by GC-MS and production of hydrogen peroxide was inferred from an increase ... the static cell with the MMOH-adsorbed electrode resulted in a catalase-dependent increase in reduction current that appeared to be diffusion controlled, as evidenced by the increase in current ... software The surface of the 4-mm diameter gold electrode (Oxford Electrodes) was modified by cycling the electrode at reducing potentials in the presence of the hexapeptide, as described previously...
- 6
- 464
- 0
Báo cáo " Research, design and fabrication of a high-power combiner using Wilkinson bridge of L-band " pptx
... loss and discontinuity effects, IEEE Trans MTT-27, Mar (1979) 239 [3] R Mehran, A method of analysis and design of microstrip directional couplers considering dispersion and discontinuity effects, ... moduls and Wilkinson bridge divider we have fabricated the high-power combination circuit as illustrated in figure5 26dBm Transmitter -10dBm 29dBm 53dBm Power Division Power Combining 56dBm 26dBm ... divider of port characteristic impedance Z0 is schematically shown in Figure Fig Schematic diagram of aWilkinson power divider [1] This is a such network that the lossless and resistive T-junction...
- 5
- 374
- 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... 5¢-ACTTATACTACTCATATGGGGAAGATCACTTTTT ACG-3¢ and reverse primer 5¢-ACTTATACTATCCTCG AGATAAAAATCCATCACCCG-3¢, and digested this with restriction enzymes NdeI and XhoI for subcloning into pET23a and production ... 5¢-ACTTATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢ The forward primer incorporated an NdeI site and the reverse primer incorporated an XhoI site (both underlined) to allow digestion and cloning of this amplicon ... 5¢-ACTTATAC TATCCTCGAGCCACTGCATGTCCCGG-3¢, to produce an amplicon lacking the N- and C- terminal extensions of the full-length protein but including restriction sites for NdeI and XhoI After digestion...
- 13
- 430
- 0
Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt
... Measured values of the vicinal coupling constants provided additional restraints for the corresponding dihedral angles, to be introduced in the restrained molecular mechanics and dynamics calculations ... (7446.63 Da) In the amino acid sequence (Fig 2), several characteristic regions could be identied, including 14 Cys residues and the consensus sequences CTR(K)SxPPTC and CxY(L R)SxPxQ(K )C for the ... Estimated accuracy of temperature coefcient is 0.1 p.p.b.ặK)1 Residue Dd DT (p.p.b.ặK)1) kex ã 103 (min)1) Residue Dd DT (p.p.b.ặK)1) kex ã 103 (min)1) D2 D3 V4 K5 S6 A7 C8 C9 D1 0 T11 C1 2 L13 C1 4...
- 16
- 518
- 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx
... methylate, and ethanol by distillation over calcium oxide Pyridine was distilled twice over sodium hydroxide and once over barium oxide HCl and trifluoroacetic acid were additionally purified by distillation ... Identification of carbohydrates in tryptic peptides The method for determining the monosaccharide composition of glycoconjugates (glycopeptides and glycoproteins) involved derivatization of the monosaccharides, ... AMC-sugars were prepared by reductive N-alkylation of 7-amino-4-methylcoumarin with the following monosaccharides in the presence of NaCNBH3: D- Glc, D- Gal, D- Man, L-Fuc, D- GlcNAc, D- GalNAc, D- ManNAc...
- 10
- 398
- 0
Báo cáo khoa học: "Correlating Human and Automatic Evaluation of a German Surface Realiser" doc
... dependencies produced by the parser into sets of triples as used in the evaluation software of Crouch et al (2002) where each dependency is represented as deprel(head,word) and each word is indexed ... strings chosen by the log-linear and language models The standard evaluation procedure relies on both strings being identical to calculate (un-)labelled dependency accuracy, and so we map the dependencies ... unweighted f-score is calculated by taking the average of the scores for each dependency type, while the weighted fscore weighs each average score by its frequency in the test corpus We calculate...
- 4
- 285
- 0
Báo cáo khoa học: A DNA-binding surface of SPO11-1, an Arabidopsis SPO11 orthologue required for normal meiosis docx
... al DNA-binding surface of Arabidopsis SPO11 protein A B C D Fig DNA-binding activities of TF-SPO11-1 (A) Binding to pUC18 negatively supercoiled closed-circular dsDNA pUC18 closed-circular dsDNA ... replacement of a basic amino acid residue with an acidic amino acid residue, we constructed a series of coding DNAs in which the non-conserved basic amino acid residues surrounding the putative DNA-binding ... with defects in meiosis that specifically correlate with the defects in DNA binding at an identified DNAbinding surface on SPO11-1 Materials and methods Nucleic acids A 180 bp dsDNA cation of pUC18...
- 15
- 393
- 0
Báo cáo Y học: A single charged surface residue modifies the activity of ikitoxin, a beta-type Na+ channel toxin from Parabuthus transvaalicus doc
... reduced and carboxymethylated by incubating in M guanidine hydrochloride, 0.1 M Tris/HCl (pH 8.3), mM EDTA and 20 mM dithiothreitol for h at 37 C Iodoacetic acid was then added to a final concentration ... Application of increased toxin concentrations did not reduce the current amplitude further The complete blockade of the remaining current by TTX (second arrow in both A ,C) shows that the reduction ... second arrows in A and C The current traces recorded at ÔaÕ, ÔbÕ, c and d in A are superimposed in B, lower traces; those recorded at ÔaÕ, ÔbÕ, c and d in C are superimposed in D, lower...
- 8
- 425
- 0
improving near field confinement of a bowtie aperture using surface plasmon polaritons
... the dimension in the x-direction is essentially not affected due to the lack of SPPs In summary, we proposed a method for reducing the near-field divergence of the subdiffraction-limited spot created ... near-field confinement is different from diffraction in far-field collimation For farfield collimation, the relative phase difference of waves produced by each groove is 2 to achieve constructive ... optimized periodicity of about SPP / differs from the results of far-field collimation by grooves for which the optimized grooves spacing is close to SPP.9–13 This is because the mechanism of reducing...
- 3
- 347
- 0
Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx
... Sciences, P.O Box 912, Beijing 100083, China CAE Team, Semiconductor R &D Center, Samsung Electronics Co., Ltd., Gyeonggi-Do, Korea Department of Physics, Semiconductor Photonics Research Center, ... incident angles, and thus lead to vanished conductances The conductance increases as the Fermi energy since the magnetic field is not strong enough to confine the electrons For a pure electric ... the conductance unit The dependence of the conductance G and the Fano factor F on the incident energy EF are plotted in Figure In low-energy region, the magnetic barrier can suppress the electron...
- 18
- 404
- 0
Báo cáo hóa học: " Research Article Convergence Analysis of a Mixed Controlled l2 − l p Adaptive Algorithm" potx
... describes the crosscorrelation between the received signal (xn ) and the desired data (dn ) p = E[xn dn ] The error function can be more conveniently expressed as follows: Jn = σx − 2cT p + cT ... zero-mean independent and identically distributed process and is independent of the input signal and having zero odd moments (A3) The step-size is small enough for the independence assumption ... (wn ) and ge (wn ) are, respectively, the first-order and second-order derivatives of g(en ) with respect to en evaluated around wn , and O(ean ) denotes the third, and higher-order terms of ean...
- 10
- 426
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25