Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin Divya Kapoor 1 , Balvinder Singh 2 , Karthikeyan Subramanian 1 and Purnananda Guptasarma 1 1 Division of Protein Science & Engineering, Institute of Microbial Technology, Chandigarh 160 036, Council of Scientific & Industrial Research, New Delhi, India 2 Division of Bioinformatics, Institute of Microbial Technology, Chandigarh 160 036, Council of Scientific & Industrial Research, New Delhi, India We have developed a novel protein engineering tech- nique that we hope will facilitate the rational dissecting out and independent re-assembly of the various struc- tural features and residue-packing schemes used in nat- ure to build the interiors and surfaces of various structurally homologous b sheet-based proteins. Recently, we provided a ‘proof-of-principle’ demon- stration of this technique [1], which we call ‘protein surface grafting’, by using it to notionally segregate and re-assort the structural stability features of one b sheet-based thermophile enzyme (a Cel12A cellulase) with the functional features of a structurally related mesophile enzyme (another Cel12A cellulase), to produce a variant enzyme bearing a still-functioning, transplanted active surface derived from the mesophile enzyme, but resembling the thermophile enzyme in most other respects [1]. The successful creation of such a meso-active, thermo-stable enzyme encouraged us to explore the workability of our surface grafting approach further, to extend it from grafting of ‘active surfaces’ to grafting of ‘whole-protein surfaces’ or ‘whole-protein interiors’. Keywords beta sheet remodeling; lens structural proteins; protein engineering; protein folding and stability; protein surface grafting Correspondence P. Guptasarma, Division of Protein Science & Engineering, Institute of Microbial Technology, Chandigarh 160 036, Council of Scientific & Industrial Research, New Delhi, India Fax: +91 172 2690585 Tel: +91 172 2636680, ext. 3301 E-mail: pg@imtech.res.in (Received 14 February 2009, revised 2 April 2009, accepted 14 April 2009) doi:10.1111/j.1742-4658.2009.07059.x The degree of conservation of three-dimensional folds in protein superfami- lies is greater than that of amino acid sequences. Therefore, very different groups of residues (and schemes of residue packing) can be found displayed upon similar structural scaffolds. We have previously demonstrated the workability of a protein engineering-based method for rational mixing of the interior features of an all-beta enzyme with the substrate-binding and catalytic (surface) features of another enzyme whose sequence is not similar but which is structurally homologous to the first enzyme. Here, we extend this method to whole-protein surfaces and interiors. We show how two all- beta Greek key proteins, bB2 crystallin and cB crystallin, can be recombined to produce a new protein through rational transplantation of the entire sur- face of bB2 crystallin upon the structure of cB crystallin, without altering the latter’s interior. This new protein, Gambeta, consists of 61 residues pos- sessing the same identity at structurally equivalent positions in bB2- and cB crystallin, 91 surface residues unique to bB2 crystallin, and 27 interior residues unique to cB crystallin. Gambeta displays a mixture of the struc- tural ⁄ biochemical characteristics, surface features and colligative properties of its progenitor crystallins. It also displays optical properties common to both progenitor crystallins (i.e. retention of transparency at high concentra- tions, as well as high refractivity). The folding of a protein with such a ‘patchwork’ residue ancestry suggests that interior ⁄ surface transplants involving all-beta proteins are a feasible engineering strategy. Abbreviation Gdm.HCl, guanidinium hydrochloride FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS 3341 Briefly, in our approach, candidate proteins that can be subjected to surface grafting are required to fulfil two structural criteria: firstly, the donor and recipient proteins must have polypeptide backbones that can be structurally superimposed (to within an RMSD £ 2.0 A ˚ ); secondly, the surface areas subjected to graft- ing must predominantly be b sheet-based structures, and associated loop structures, with very little or no helical content. The reason for the latter criterion is that, within any strand participating in a multi- stranded sheet on a protein’s surface, alternating resi- dues face away from the sheet in opposite directions. The sheet itself (described by the strand backbones and hydrogen bonds) thus acts like a separator that physically separates two distinct groups of mutually interacting residues that have already evolved to pack independently of each other – one facing the solvent, and the other facing the protein’s interior. It is our contention that when the backbone atoms of two structurally homologous all-beta proteins are superim- posable (despite poor sequence homology), the two proteins appear to have somehow evolved very differ- ent residue–residue packing schemes for ‘surface’ and ‘interior’ residues within the b sheet(s) under consider- ation, compatible with the same set of backbone atom coordinates. This compatibility automatically generates scope for the success of mutation-based replacement of one entire set of residues with a completely different set of analogous residues from a structurally homolo- gous protein. This is what we call grafting. It is necessary to note that, although the compatibil- ity of the ‘original’ and ‘replacement’ sets of residues with the same set of backbone atom coordinates defi- nitely presages, or even predicts, success in grafting, it does not automatically guarantee success because of uncertainties involved with respect to the mechanisms of chain folding. A b sheet can bring together strands that are widely separated in the primary sequence. Therefore, residues constituting the solvent-exposed surface of a b sheet are generally non-contiguous and are sourced from all over the protein’s sequence. Large-scale mutagenic replacements of surface residues can conceivably affect the mechanisms by which chains achieve their folded three-dimensional (native) struc- tures; indeed, as is widely appreciated, sometimes even a single mutation can drastically affect folding, unless compensating mutations occur elsewhere in the pro- tein, and there is no gainsaying that sufficient numbers of mutually compensating mutations would be made in a surface grafting experiment involving tens or hun- dreds of residues undergoing replacement. Therefore, theoretical verification of packing compatibility does not prove that folding will lead to the desired structure(s). It is necessary to perform the experiment, and see whether this indeed occurs. Our grafting approach – successfully demonstrated here using the whole surfaces of two structurally homologous proteins – involves the performance of five systematic steps that combine structural (bioinformat- ics) analyses with genetic engineering and protein bio- chemistry: (a) superimposition of the polypeptide backbones of any two significantly structurally homolo- gous all-beta proteins; (b) identification of all pairs of residues located at structurally analogous positions in the two proteins; (c) segregation of such pairs of resi- dues into separate sets, i.e. those contributing atoms to the surface, and those contributing to the hydrophobic interior; (d) site-directed replacement of residues consti- tuting the surface of one protein by analogous residues occurring in the other protein; and (e) expression, purification and characterization of the mutant. For our ‘whole-surface’ grafting experiment, we selected two b sheet-rich proteins sharing extensive structural homology: the vertebrate bovine lens struc- tural proteins bB2 crystallin [2] and cB crystallin [3]. The proteins are of different lengths: cB crystallin is 174 residues long, while bB2 crystallin is 201 residues long in its full-length form, but only approximately 175 or 177 residues long in its truncated form, depending on exactly how its N- and C-terminal extensions have been removed, or truncated. In comparing the amino acid sequence of cB crystallin with that of the equivalent (truncated) form of bB2 crystallin consisting of only the core domain structures without the terminal extensions, 61 residues with the same identity (approximately 35%) are used at structurally equivalent positions in the two proteins, while another 22 residues of similar nature (approximately 12%) are used at other structurally equivalent positions, bringing the total homology to 47%. Thus, over half the residues used by the two pro- teins at structurally equivalent positions are different with respect to both their identity and their nature. Both bB2 (Protein Data Bank accession 2BB2) [2] and cB (Protein Data Bank accession 1AMM) [3] con- sist of two double Greek key domains. Each of these domains, approximately 80–85 residues long, consists of two interacting Greek key motifs, each approxi- mately 40 amino acids long. As already mentioned, bB2 has N- and C-terminal sequences that extend beyond the core two-domain motif. The inter-domain linkers joining the N- and C-terminal domains in the two proteins are very different from each other in structure, as well as sequence, with the linker in cB being bent into a V-shape that allows the two domains to interact intramolecularly (such that the protein is a monomer), while the linker in bB2 is extended (causing Creation of a new protein through ‘surface grafting’ D. Kapoor et al. 3342 FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS the protein to form a homodimer in which the N- and C-terminal domains of two different chains interact like the two domains of cB). Both proteins belong to a superfamily of proteins displaying limited sequence homology but high struc- tural homology [4]. Here, we show that a ‘recombined’ amino acid sequence created through residue altera- tions in cB crystallin, involving (a) substitution of some residues with analogous residues from bB2 crys- tallin, (b) insertion of certain bB2 residues with no analogs in cB, and (c) deletions of other cB residues, leads to formation of a soluble protein that displays many of the structural stability characteristics of cB crystallin and most of the surface characteristics of bB2 crystallin. In addition, this new protein, which we call Gambeta, displays certain characteristics that are not seen in either of its progenitors. Our results also shed some light on the evolution of monomeric versus multimeric structural arrangements in the bc crystallin superfamily. Results and discussion Using the cB crystallin sequence as a template, many substitution mutations were first made in silico to replace the surface residues of cB crystallin with struc- turally analogous bB2 residues. Certain bB2 surface res- idues, including those constituting the solvent-exposed inter-domain linker, have no counterparts in cB; conse- quently, these were inserted into the cB sequence. Fur- ther, certain cB surface residues were deleted, as these have no structurally analogous residues in bB2. Details of the above changes are given in Table S1. A new syn- thetic gene incorporating all the above changes was expressed in Escherichia coli. The amino acid sequence of the protein product of this gene, named ‘Gambeta’, is defined in column 9 of Table S1, and also shown in the top part of Fig. 1, which displays the amino acid sequence of Gambeta in a structure-based sequence alignment with the amino acid sequences of its progeni- tor crystallins, cB and bB2. Figure 1 also provides Fig. 1. The surface ⁄ interior transplant. (Top) The green font represents residues that are not present in the progenitors, Structure-based sequence alignment showing N- and C-terminally truncated bB2 crystallin (Protein Data Bank accession 2BB2) in blue, cB crystallin (Protein Data Bank accession 1AMM) in red ⁄ orange, and Gambeta crystallin in a combination of blue (for b B2-derived residues) and red ⁄ orange (for cB-derived residues). The inter-domain linker region separating the two double Greek key domains is marked. Residues presenting side chains to the aqueous solvent are highlighted by green shading of structurally equivalent positions in all three sequences. Of the surface regions sub- jected to transplantation, those involving contiguous residues are mainly from loops separating b strands, while single surface residues flanked by core ⁄ interior residues are from strands. (Bottom) Schematic diagram showing the relationship of Gambeta to its two progenitors. The surface is shown in green for all three proteins, and the notional boundary separating the surface from other regions is shown in white. Residues of bB2 are shown in blue, while those of cB are shown in red ⁄ orange. In Gambeta, colors denote the origins of the residues from the two progenitors. D. Kapoor et al. Creation of a new protein through ‘surface grafting’ FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS 3343 details about which residues occur upon the surfaces of bB2 and cB. Furthermore, the bottom part of Fig. 1 shows a schematic representation of the transplanta- tion. This part of the figure emphasizes the conceptual point that our construction of a new protein, using a synthetic gene encoding surface residues carefully selected from bB2, and interior residues sourced from cB, may be viewed as a ‘surface transplantation’ experi- ment or an ‘interior transplantation’ experiment, depending on one’s perspective. Expression of Gambeta and confirmation of its identity Gambeta was overexpressed from a synthetic gene cloned between the NdeI and XhoI restriction sites of the expression vector pET-23a, with a C-terminal 6xHis affinity tag, in E. coli strain BL21-DE3pLysS. The DNA sequence and sequencing chromatograms of the synthetic gene are shown in Fig. S1A,B. Figure S2A shows the overexpression levels of several Gambeta- expressing clones, showing similar yields of 100– 110 mgÆL )1 of culture. After confirmation of the sequence of the encoding gene by DNA sequencing, we selected the clone shown in lane 2 of Fig. S2A for pro- tein production. Gambeta was expressed and purified by Ni-nitrilotriacetic acid immobilised metal affinity chromatography (IMAC) chromatography under non- denaturing conditions. Figure S2B shows a representa- tive purification profile of Gambeta from a 1 L culture, involving elution of bound protein by 250 mm imidaz- ole, which was later removed by dialysis against 20 mm Tris pH 8.0. Figure S2C shows that the purified protein has an intact mass of 21 746 Da, which is only 148 Da less than the mass of 21 894 Da expected for the 188 amino acid residue Gambeta chain; this error is well within the permitted range of errors for mass measure- ments using MALDI-TOF mass spectrometry in the linear mode. The identity of the protein was further confirmed by MALDI-TOF-based peptide mass finger- printing, with 1–2 Da accuracy, involving detection of the masses of trypsinolytic peptides in the mass range of 500–5000 Da. Peptides detected by peptide mass finger- printing provided a very high coverage (83%) of the sequence of the C-terminally 6xHis-tagged form of Gambeta, as shown in Fig. S2D, confirming that the protein produced and purified was indeed Gambeta. Gambeta is a dimer like bB2 It is known that cB crystallin is a monomer whereas bB2 crystallin is a homodimer [5]. To determine the quaternary structural characteristics of Gambeta, the protein was subjected to gel filtration chromatography on an analytical Superdex-200 SMART column as shown in Fig. 2A (the column’s calibration profile is shown in Fig. S3). For comparison, control samples of bB2 and cB crystallin were also chromatographed under identical experimental conditions. Gambeta was found to elute predominantly at approximately 1.66 mL from this column of 2.4 mL bed volume, with a minor fraction of the population also seen to elute as a soluble aggregate at the void volume (0.9 mL). The elution of Gambeta at 1.66 mL indicates that it is a dimer, with a hydrodynamic volume similar to that of the bB2 control, which elutes at approximately 1.70 mL. The bB2 control and Gambeta were pro- duced in the truncated form, without the N- and C-terminal extensions that normally exist in bB2. Oth- ers who have similarly produced bB2 without exten- sions have also observed that bB2 exists in a predominantly dimeric state; however, reports suggest that there is usually an accompanying minority popu- lation of tetrameric bB2 present with the dimeric pop- ulation [4,5]. We did not find any evidence of a minority tetrameric population, either with the bB2 control or with Gambeta. This could be due to the fact that the C-terminal affinity tag used to produce Gamb- eta and its progenitor controls acts like bB2’s natural C-terminal extension, sterically inhibiting further asso- ciations once a dimeric state has formed. In this context, it is important to note that previous studies with truncated bB2 used no affinity tags, but instead used naturally occurring histidines in bB2’s sequence for metal affinity-based purification. In any case, the important point to note is that the control cB crystal- lin protein elutes at 1.85 mL, as a monomer, despite being identical to bB2 and Gambeta with respect to its C-terminal affinity tag, indicating that Gambeta’s dimerization is due to its possessing the inter-domain linker peptide and surface features of bB2 crystallin. Gambeta’s structural ⁄ biochemical characteristics are derived partly from bB2 and partly from cB Figure 2B shows that the CD spectrum of Gambeta has a typical negative band maximum at 216–218 nm, with a mean residue ellipticity of about )9000 degressÆ cm 2 Ædmol )1 . The shape of Gambeta’s spectrum resem- bles that of the spectra of bB2 and cB, which are also shown in Fig. 2B. While this indicates that Gambeta is a folded all-beta protein like both of its progenitors, Gambeta also appears to have a higher b sheet content than both bB2 and cB, suggesting that it is somewhat more folded than its progenitors. Figure 2C,D shows Creation of a new protein through ‘surface grafting’ D. Kapoor et al. 3344 FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS the guanidinium hydrochloride (Gdm.HCl)-induced and urea-induced denaturation transition curves for Gambeta, bB2 and cB, as plots of changes in the mean residue ellipticity at 216 nm with increasing concentra- tions of denaturant. For Gambeta, data are omitted for concentrations between 0.3 and 1.75 m Gdm.HCl, because the protein showed precipitation at these dena- turant concentrations (this behavior is discussed below). Neither of the control progenitor proteins showed this behavior. Although different initial mean residue ellipticities are involved in all three cases, it is clear from these transitions that Gambeta’s unfolding closely parallels that of bB2, rather than that of cB crystallin. Although c B shows great resistance to urea- mediated unfolding (as reported previously [7]), at least over the time scale of an overnight incubation (approx- imately 12 h), both Gambeta and bB2 showed some unfolding in urea, with similar profiles of partial unfolding. The wavelengths of maximal fluorescence emission ( em k max ) and the emission intensities of tryptophan residues tend to be acutely sensitive to the polarity of their environment within a protein. The em k max of a solvent-exposed tryptophan is usually approximately 352–353 nm, while that of a buried tryptophan tends to be blue-shifted to a lower wavelength, to a degree that is dependent on the extent of burial [6]. There are four tryptophan residues in cB, all of which lie buried within its structural core [3]. In contrast, only three of these tryptophans are conserved at structurally equiva- lent positions in bB2, and there are two additional tryptophans on its surface [2]. As the core of Gambeta is derived from cB and its surface is derived from bB2, it inherits all four of the cB tryptophans together with both of the bB2 surface tryptophans, making six tryptophans in all. Figure 3A shows the fluorescence emission spectra of all three proteins, obtained at matched concentrations. Although Gambeta, bB2 and AB C D Fig. 2. Quaternary and secondary structure ⁄ stability of purified Gambeta and its progenitors. (A) Gel filtration elution profiles on an analytical Superdex-200 SMART column. (B) Far-UV CD spectra. (C) Changes in mean residue ellipticity at 216 nm following overnight incubation in various molarities of Gdm.HCl. (D) Changes in mean residue ellipticity at 216 nm following overnight incubation in various molarities of urea. D. Kapoor et al. Creation of a new protein through ‘surface grafting’ FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS 3345 cB have six, five and four tryptophans, respectively, cB shows the most intense emission, followed by Gambeta and bB2, in that order. This indicates that the tryptophans of Gambeta and bB2 are quenched by their local structural environments compared with the cB tryptophans. The em k max of bB2 is between the em k max values of Gambeta and cB, and the shape of its fluorescence emission envelope is quite distinct from those of Gambeta and cB. All three proteins display em k max values below 335 nm (Gambeta at appro- ximately 335 nm, bB2 at approximately 331 nm, and cB at approximately 325 nm), indicating that Gambeta has an extremely well-folded structure in which the six aromatic tryptophan residues are protected from the aqueous solvent as effectively as those in bB2 and cB. That the aromatic residues of all three proteins exist in largely immobile environments, in association with chiral structural elements, is also evident from the fact that they display near-UV CD spectra that show marked spectral features (Fig. 3B). Although near-UV CD spectra are merely spectral signatures that cannot be interpreted further, it is noteworthy that the spec- trum of Gambeta resembles that of bB2 much more than it resembles that of cB, at least in terms of inten- sity. The same spectral features are seen in all three proteins, indicating that Gambeta has folded into a structure that is similar to that of its progenitors. The reason that Gambeta’s spectrum is more like that of bB2 could be that Gambeta derives five of its six tryptophans from bB2 (including three that are buried at equivalent structural positions in bB2 and cB, and two that exist only in bB2), with only one tryptophan sourced solely from cB. We further examined the denaturant-induced unfolding transitions of Gambeta and its progenitor controls by monitoring changes in fluorescence emis- sion and plotting variations in both emission intensity and em k max values with denaturant concentration. We noted above that precipitation of Gambeta between 0.3 and 1.75 m Gdm.HCl interferes with CD-based monitoring of unfolding. Such precipitation does not interfere with fluorescence-based monitoring of em k max values during unfolding (which are independent of protein concentration), but can affect emission intensi- ties. This is because precipitation can affect protein concentrations and therefore intensities, whereas fluo- rescence emission wavelength maxima are not sensitive to scattering of light if the em k max is sufficiently dis- placed from the wavelength of excitation (in nm), as this prevents the Rayleigh and Raman scatter from contaminating the emission spectrum. The data for the Gdm.HCl- and urea-induced transitions are shown in Fig. 4A,B, which show actual protein emission intensities at 370 nm as a function of denaturant concentrations. At 370 nm, shifting of the protein’s emission spectrum towards longer wavelengths (accompanying exposure of buried tryptophan resi- dues) causes emission intensities to rise progressively with unfolding. All three proteins show changes in emission intensity at 370 nm with increasing denatur- ant concentration, although, as already mentioned, urea does not cause unfolding of cB. The unfolding of Gambeta by Gdm.HCl appears to be considerably less cooperative than that of its progenitors, whereas, with urea, unfolding of both Gambeta and bB2 appears not to be very cooperative. In Fig. 4A, no intensity data for Gambeta at 370 nm are presented for Gdm.HCl concentrations between 0.3 and 1.75 m; this is because of the precipitation of Gambeta seen at these concentrations of Gdm.HCl, which is reversed at higher concentrations of the denaturant. A B Fig. 3. Tertiary structural features of purified Gambeta and its two progenitors. (A) Fluorescence emission spectra. (B) Near-UV CD spectra. Creation of a new protein through ‘surface grafting’ D. Kapoor et al. 3346 FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS The data showing the changes in em k max with the two denaturants are shown in Fig. S4A,B. As for the changes in emission intensities, the unfolding transition of Gambeta is far less cooperative than the unfolding transitions of bB2 and cB, both of which show more or less cooperative unfolding transitions. The concen- tration at which half the population is unfolded (C m ) of Gdm.HCl is far lower for Gambeta than for cB, but considerably higher than the C m of unfolding of bB2. With urea, Gambeta unfolded entirely non- cooperatively over the entire range of urea concentra- tions used. Thus, although Gambeta unfolds to the same extent that bB2 unfolds (i.e. fully), bB2’s unfold- ing was completed in a sharp cooperative transition between 1.0 and 2.5 m urea, whereas Gambeta’s unfolding occurs slowly and in a monotonic fashion between 0 and 7.0 m urea. Gambeta appears to have derived its relative resistance to unfolding by urea from cB, which shows hardly any unfolding even upon overnight incubation in 7.0 m urea. We also monitored the unfolding transition by examining changes in the ratio of emission intensities at 320 and 370 nm with denaturant concentration, to see whether there is any inhomogeneity of behaviour with respect to the relative exposure of tryptophans in various parts of Gambeta and its control progenitors during denaturant-mediated unfolding. The data are presented in Fig. S4C,D. Gambeta’s unfolding is clearly seen to be biphasic in the presence of Gdm.HCl or urea. Although the same is not seen clearly in the Gdm.HCl-induced denaturation profiles of the two progenitors, the intensity ratio data in Fig. S4C indicate that cB shows very subtle unfolding. Such unfolding involves two phases spanning the same range of concentrations over which Gambeta shows this behavior in the urea-induced denaturation data in Fig. S4D. It is possible that the two phases of Gambeta unfolding seen in Fig. S4C,D relate to independent unfolding of the two domains, which could be related to the fact that the protein shows non-cooperativity of unfolding. To explore the reversibility of the unfolding transi- tions, far-UV CD spectra of all three proteins were obtained after removal of 6 m Gdm.HCl or 7 m urea by dialysis. The data are presented in Figs S5 and S6, together with spectra of protein unexposed to denatur- ant. The data show that both Gambeta and bB2 dis- play poor refolding, through dialysis, from the completely unfolded state achieved through overnight incubation in 7 m urea, while cB remains unaffected by the treatment. In contrast, all three proteins refold poorly from the completely unfolded states achieved through overnight incubation in 6 m Gdm.HCl. In summary, the far-UV CD transitions in Fig. 2C,D as well as the em k max value and intensity ratio transitions indicate that Gambeta is unfolded non-cooperatively by urea. It is interesting that all six tryptophans of Gambeta become exposed to the aque- ous solvent even though the secondary structure of Gambeta does not fully unravel in the presence of these denaturants. Binding of Gambeta to the calcium-mimic dye Stains-all is intermediate to that of bB2 and cB Figure 5A shows CD spectra induced in the otherwise achiral (and therefore non-dichroic) dye Stains-all in the presence of Gambeta, bB2 and cB crystallin. The dye Stains-all binding simulates calcium-binding in a A B Fig. 4. Chemical denaturation of Gambeta and its two progenitors. (A) Fluorescence emission intensities at 370 nm as a function of Gdm.HCl concentration. (B) Fluorescence emission intensities at 370 nm as a function of urea concentration. D. Kapoor et al. Creation of a new protein through ‘surface grafting’ FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS 3347 protein, and both bB2 and cB crystallin are reported to bind to this dye [8,9]. Figure 5A shows that, for equivalent concentrations of protein and Stains-all, the strength of the approximately 650 nm negative band (known as the J band) induced in Stains-all by its binding to Gambeta is intermediate to that of bB2 and cB crystallins. As with the other crystallins, Gambeta also shows a positive band in the region of 670– 700 nm at higher concentrations of dye to protein (Fig. S7); the control spectrum with the dye alone is close enough to the zero line to be indistinguishable. Although, in our experiment, all three proteins show the J band at approximately 650 nm, the reported wavelength for Stains-all bound to full-length bB2 is closer to 660 nm [8,9]. As our spectra in Fig. 5A are the first spectra ever reported for Stains-all binding to truncated bB2, the three spectra shown must be com- pared only with each other and not with other reports in the literature. Gambeta precipitates upon heating like cB does There have been no reports that bovine bB2 crystallin precipitates upon heating. In contrast, cB is reported to precipitate upon heating, and the nature of its thermal aggregates has also been studied [10]. It is known that there is a partial melting of structure that leads to aggregation in the temperature range 65–80 °C, with actual structural unfolding (as discerned by differential scanning calorimetry) occurring largely above 85 °C, when aggregation is prevented from occurring [7]. Figure 5B shows the responses of Gambeta and its con- trol progenitor proteins to heating. The behavior of Gambeta is entirely like that of cB, in that there is a dramatic change in mean residue ellipticity at 216 nm upon heating, which leads to the mean residue elliptic- ity quickly being reduced to zero because the protein precipitates and disappears from the light path. A B CD Fig. 5. Further characterization of Gambeta and its progenitors. (A) CD spectra of the 650 nm J band induced in the calcium-mimic dye, Stains-all upon protein binding. (B) Temperature-induced changes in mean residue ellipticity at 216 nm (owing to thermal unfolding, aggrega- tion or precipitation). (C) Changes in refractive index (n D ) with increasing protein concentration. (D) Scattering (turbidity) shown by a 0.1 mgÆmL )1 Gambeta solution at 600 nm as a function of increasing Gdm.HCl concentration. Creation of a new protein through ‘surface grafting’ D. Kapoor et al. 3348 FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS However, although the thermal precipitation is like that of cB, the temperature at which the thermal precipita- tion occurs is actually much closer to the temperature at which bB2 (which is quite thermostable) displays a very minor partial unfolding transition, without either undergoing complete thermal unfolding or thermal pre- cipitation. When the respective cuvettes were removed from the Peltier-controlled chamber of the CD spec- trometer after heating and cooling, all the protein was found to have formed visible aggregates in the case of Gambeta and the cB control, but no precipitates what- soever were visible in the case of the bB2 control. Gambeta shows cold precipitation like its progenitors Cold precipitation is defined as a tendency to precipi- tate out of solution at low temperatures in a concen- tration-dependent fashion. Cold precipitation is one of the most defining characteristics of cB crystallin. In a concentration-dependent manner, with greater precipi- tation seen at higher protein concentrations, cB precip- itates visibly out of aqueous solution upon cooling to temperatures below 10 °C [11,12]. What is especially interesting about this cold precipitation is that it is fully reversible, i.e. the solution clears when the tem- perature is returned room temperature, with no appar- ent change in the protein’s characteristics, suggesting that no profound structural change is involved in the phenomenon. In contrast to this behavior of cB (and all other c isoforms, which show reversible cold precipitation), mouse cN crystallin has been reported to show irreversible cold precipitation [13]. No other crystallin, including full-length bB2 crystallin, has been reported to show such precipitation. Gambeta was found to readily precipitate out of solution in the refrigerator, in a concentration-depen- dent manner, over a period of hours, for all concentra- tions exceeding 10–12 mgÆmL )1 . However, unlike the reversible cold precipitation shown by cB crystallin, the cold precipitation of Gambeta was found to be irreversible, in that no re-dissolution of the protein could be detected upon return to room temperature. Interestingly, whereas full-length bB2 has never been reported to show cold precipitation, our truncated bB2 control showed cold precipitation at these concentra- tions just like the cB control and Gambeta samples. Interestingly, the cold precipitation of N- and C-termi- nally truncated bB2 was also found to be irreversible, like that of Gambeta, explaining where this irrevers- ibility comes from. It is possible that others who have worked with truncated bB2 have not made this obser- vation previously because they have not used protein concentrations high enough for the phenomenon to manifest itself; even cB and the other c crystallins are known to show cold precipitation only at concentra- tions exceeding 10–15 mgÆmL )1 [11,12]. It is possible that the N- and C-terminal extensions of full-length bB2 (which protect it from associating beyond the dimeric state) somehow also protect it from cold pre- cipitation, and that we have removed this protection by truncating Gambeta and bB2. It may be recalled that we truncated these two proteins in order to allow proper comparison with cB, as cB lacks these terminal extensions. Gambeta is soluble at ultra-high concentrations like other lens crystallins The crystallins are special proteins, in that they exist in the fiber cells of the vertebrate ocular lens at concentra- tions in excess of 100 mgÆmL )1 ; in the center of a lens, crystallin concentrations can even reach 500– 600 mgÆmL )1 [14]. The crystallins in the lens remain soluble at such high concentrations, and form clear solutions of high refractive index that help the lens to focus light onto the retina [15]. There is a natural gradi- ent of crystallin concentrations in the lens, increasing from the periphery to the center. This is associated with a corresponding gradient of refractive index that helps the lens to correct for spherical aberration by bending light to lesser and lesser extents as the periphery is approached, to compensate for shape changes. As Gambeta is derived from two progenitor crystal- lins, we examined whether it is soluble at high concen- trations, and also whether it generates highly refractive solutions. We were able to concentrate Gambeta to approximately 280 mgÆmL )1 , with no evidence of pre- cipitation or aggregation. Figure 5C shows the mea- sured change in the refractive index for yellow light (n D ) against Gambeta concentration, together with similar plots for the control bB2 and cB crystallins, over the concentration range of 0–50 mgÆmL )1 . The plot shows that Gambeta possesses the most important properties of any crystallin, i.e. high solubility and the ability to form clear and transparent solutions of high refractive index. Furthermore, the slope of the increase in refractive index with protein concentration was highest for cB crystallin, followed by Gambeta and bB2 crystallin. Gambeta precipitates at intermediate concentrations of Gdm.HCl As noted above, far-UV CD data for Gambeta could not be collected between 0.3 and 1.75 m Gdm.HCl, D. Kapoor et al. Creation of a new protein through ‘surface grafting’ FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS 3349 because Gambeta shows a tendency to precipitate. This precipitation frustrates any attempts to examine whether or not the homodimeric form of Gambeta can be dissociated into folded monomers by low concentra- tions of the denaturant. The precipitation is visible within a few tens of minutes after addition of the Gdm.HCl. We wished to examine whether this precipitation is an equilibrium phenomenon, showing a specific concentration-dependent trend, or a non- equilibrium phenomenon like most forms of protein aggregation. We wish to point out what is a prima facie reason to believe that this may be an equilibrium phenomenon. In the CD data presented in Fig. 2C, the data points prior to 0.3 m Gdm.HCl and after 1.75 m Gdm.HCl show continuity; it may be argued that this would not have been the case if the precipitation were a non-equilibrium phenomenon. However, we wished to examine this further by monitoring the extent of precipitation in various concentrations of Gdm.HCl. Overnight incubation would allow sufficient time for a non-equilibrium phenomenon to precipitate most or all of the protein over the entire relevant range of Gdm.HCl concentrations, creating discontinuity in the data. To explore this further, we measured and plotted the turbidity (A 600 ) of solutions of 0.1 mgÆmL )1 Gambeta incubated overnight in the presence of various concentrations of Gdm.HCl, as shown in Fig. 5D. The data reveal a Gaussian distribution of turbidity with increasing Gdm.HCl concentration, with a peak at approximately 1 m Gdm.HCl and no discon- tinuity, indicating that phenomenon is an equilibrium one. A search of the biochemical literature showed that another protein, rusticyanin, also shows similar precipitation behavior in the presence of a certain range of concentrations of Gdm.HCl [16]. We have not yet characterized these precipitates further, but we describe this precipitation behavior to emphasize that this is one aspect of Gambeta that is not directly attributable to either of its progenitors. Experimental procedures Design of Gambeta As the geometries of the arrangement of domains are different in the two proteins, the N-terminal domains of bB2 and cB crystallin were superimposed separately from the C-terminal domains of the two proteins using LSQMAN software [17]. This showed that the backbone atoms of the N-terminal domains can be superimposed with an RMSD of 0.9 A ˚ , while those of the C-terminal domains can be superimposed with an RMSD of 1.05 A ˚ . The residues at structurally analogous positions in the two proteins identi- fied by LSQMAN are listed in columns 2 and 3 of Table S1. For the two domains, backbone atoms of a total of 150 residues can be seen to be superimposed with individual RMSD values £ 2.00 A ˚ , while eight more residues superim- pose with individual RMSD values of 2.00–3.00 A ˚ . Details of structurally analogous residues are given in column 4 of Table S1, with RMSD values in column 5. We used a combi- nation of visual and software analysis by AreaImol, as implemented in CCP4 [18], to assess the solvent accessibility of each residue, to identify residues contributing atoms to the formation of the surface in each protein. Details of specific residue pairs contributing to surface formation are given in column 6 of Table S1. Of these surface residues, some are conserved and so there was no need to alter these during surface grafting. Details of conserved residues are given in column 7 of Table S1. Column 8 in Table S1 list the action taken, i.e. whether the residue in cB was (a) mutated and replaced with the structurally analogous residue occur- ring in bB2, (b) left unaltered, or (c) deleted, or (d) whether a specific residue from bB2 had to be inserted to create a bB2-derived surface in Gambeta, while conserving the hydrophobic core of cB. Mutations were inserted in silico into a gene encoding the sequence of c crystallin, and the sequence of this gene was optimized for expression in E. coli using gene designer dna 2.0 software. This approach differs considerably from another very interesting approach that also uses cB crystallin’s structural scaffold to generate libraries of crystallins with novel binding properties [19], as our approach is rational while the library approach is combinatorial, and our approach also results in a folded structure despite making a much larger number of changes. Gene synthesis and cloning A gene with a sequence designed as described above (shown in Fig. S1) was produced through contract synthesis by Ocimum Biosolutions (Hyderabad, India) in a pUC-19 (https://www.dna20.com/tools/genedesigner.php) plasmid. The gene was amplified from this plasmid by PCR using for- ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT- TATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢. The forward primer incorporated an NdeI site and the reverse primer incorporated an XhoI site (both underlined) to allow digestion and cloning of this amplicon between the NdeI and XhoI sites of the expression vector pET-23a, enabling expression with an N-terminal methionine and a C-terminal extension incorporating 6xHis residues and two other residues (Leu and Glu) from the XhoI site placed immediately upstream of the stop codon. The pET-23a plasmid incorporating the clone was transformed into the XL1-Blue strain for making of plasmid stocks and sequenc- ing, and into the BL21(DE3)pLysS strain for expression. Creation of a new protein through ‘surface grafting’ D. Kapoor et al. 3350 FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS [...]... We amplified the cDNA for cB using forward primer 5¢-ACTTATACTACTCATATGGGGAAGATCACTTTTT ACG-3¢ and reverse primer 5¢-ACTTATACTATCCTCG AGATAAAAATCCATCACCCG-3¢, and digested this with restriction enzymes NdeI and XhoI for subcloning into pET2 3a and production in BL21DE3pLysS The product has a methionine at the N-terminus, derived from the NdeI restriction site It also has a C-terminal 6xHis tag with the. .. thio-b-d-galactoside at an absorbance of the culture at 600 nm of 0.6 Cells were harvested after 4 h and lysed under non-denaturing conditions in 50 mm NaH2PO4 containing 300 mm NaCl and 10 mm imidazole, with sonication in the presence of lysozyme The lysate was centrifuged at 12 000 g Creation of a new protein through surface grafting for 1 h, and the supernatant was loaded onto an Ni-nitrilotriacetic acid... India) for grants to research protein folding, aggregation, stability and engineering We thank Dr Y Sharma (CCMB, Hyderabad, India) for kindly providing us with clones of bovine bB2 and cB cDNA for further modification and use in our laboratory References 1 Kapoor D, Kumar V, Chandrayan SK, Ahmed S, Sharma S, Datt M, Singh B, Karthikeyan S & Guptasarma P (2008) Replacement of the active surface of a thermophile... structure [3] Although we have retained the C-terminal residues Q and W from bB2 in the truncated bB2, as well as in Gambeta, we did not incorporate the N-terminal residues L and N at the N-terminus of Gambeta This was because we made Gambeta first, and omitted these two residues by an oversight; when we later made the bB2 control, we decided to put these in also and see whether they make any significant difference,... sub-Dalton accuracy for determination of the masses of tryptic peptides A total of 13 out of 20 expected tryptic peptides were FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS 3351 Creation of a new protein through surface grafting D Kapoor et al detected, covering more than 80% of the sequence of Gambeta The diagnostic masses detected were all within 1 Da of the. .. calcium-mimic dye Stains-all upon binding to Gambeta Table S1 Details of the whole -surface transplant involving bB2 crystallin and cB crystallin This supplementary material can be found in the online version of this article Please note: Wiley-Blackwell is not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be... to Gambeta, a scan was performed between 700 and 500 nm at a rate of 50 nmÆ min)1, after Gambeta (0.08, 0.13 and 0.16 mgÆmL)1) had been incubated for 1 h with Stains-all (16 lm) in the presence of 2 mm Mops pH 7.2 and 30% ethylene glycol Gel filtration chromatography Gel filtration chromatography was performed on a SMART chromatographic workstation (Pharmacia, GE Healthcare Biosciences AB, Uppsala, Sweden),... Kapoor et al Production of C-terminally affinity-tagged cB and truncated bB2 controls Clones of bovine cB cDNA in pET-17b and bovine bB2 cDNA in pET-2 1a were kindly provided by Dr Yogendra Sharma [Centre for Cellular and Molecular Biology (CCMB), Hyderabad, India], and these were modified as described below to produce affinity-tagged cB and bB2 clones of lengths equivalent to each other and to Gambeta... difference, with the intention of adding these to Gambeta later if a great variation in behavior was seen between bB2 and Gambeta However, as this was not the case, the Gambeta variant incorporating L and N at the N-terminus was not produced Protein expression and purification Gambeta was expressed by growing transformed BL21DE3pLysS cells in LB medium, using induction with a final concentration of 1 mm isopropyl... from the vector, with the residues L and E deriving from the XhoI restriction site Likewise, we also amplified the cDNA for bB2 using forward primer 5¢-ACTTATACTACTCATATGCTCAACCC CAAGATCATC-3¢ and reverse primer 5¢-ACTTATAC TATCCTCGAGCCACTGCATGTCCCGG-3¢, to produce an amplicon lacking the N- and C-terminal extensions of the full-length protein but including restriction sites for NdeI and XhoI After . Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core. ¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT- TATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢. The forward primer incorporated