Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... lab works image acquisition and analysis software was used to quan- tify band intensities. Antibodies were purchased from Tian- jin Saier Biotech and Sigma-Aldrich. Statistical analysis Data are ... LA, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Lab- ourier E et al. (2006) The colorectal microRNAome. Proc Natl Acad Sci USA 103, 3687–3692. 14 Yanaihara N, Caplen N, Bowman E, Seike M, Kum...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx
... chromosomal DNA of M. mazei as template and the following primers: mm0632for, 5¢-ATGGTAGGTCTCAAATGATAGGAA ATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev, 5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA TTTTTTGC-3¢. The ... A molecular mass of 20 kDa was found by SDS ⁄ PAGE, consistent with the expected mass of 19.2 kDa of the protein monomer (not shown). The native enzyme had a molecular...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... 3353 Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin Divya Kapoor 1 , Balvinder ... plasmid. The gene was amplified from this plasmid by PCR using for- ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and re...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... (GE Healthcare, Anapolis, MD, USA) to the ICU but not on the gen- eral wards. The new system was introduced following a pro- gram of staff training and HWP was completely changed on a single day. The ... investigator illness. The ICU medical and nurs- ing staff were unaware that the study was being conducted. Ethical approval was not sought, because at the time audits we...
Ngày tải lên: 25/10/2012, 10:39
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... demonstrated that Asp129 of NirF could not be essential for any function similar to that in Asp141 of Met8P. The idea of NirF being a dehydrogenase is appealing because of the presence of a putative ... d 1 heme lacking iron and ⁄ or with the side chain satu- rated, but accessing these putative substrates is not trivial. An alternative approach would be to seek accu- mulat...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc
... red). Table 1. Average distances between CA atoms of the stefins and catalytic residues of cysteine proteases. Distance calculated d (A ˚ ) Papain–stefin B 23.93 Cathepsin H–stefin A 23.36 ± 0.23 Cathepsin ... that the occluding loop is rather flexible and will adapt to structural features of the inhibitors as well as to the packing constraints of the environment. The lar-...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... Petersburg, FL, USA) followed by PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG- 3¢. The cDNA was subcloned ... 275, 10995–11001. 40 Tanaka Hall TM, Porter JA, Beachy PA & Leahy DJ (1995) A potential catalytic site revealed by the 1.7- Angstrom crystal structure of the amino-...
Ngày tải lên: 18/02/2014, 16:20
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG 5 1028 A. Ray et al. ... variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation Alpana Ray 1 , Srijita Dhar 1 , Arvind Shakya 1 , Papiya Ray 1 , Yasunori Okada 2 and Bimal K. Ray 1 1 Department of Ve...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... (S1278b) the kanMX cassette from plasmid pUG6 [12] was amplified by polymerase chain reaction (PCR) using the primers disRAS2fwd 5¢-TAACCGT TTTCGAATTGAAAGGAGATATACAGAAAAAA AACAGCTGAAGCTTCGTACGC-3¢ and ... disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. YEp351-SUT...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
... for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT. All experimental protocols ... 14220–14225. 18 Ohto H, Kamada S, Tago K, Tominaga S, Ozaki H, Sato S & Kawakami K (1999) Cooperation of Six and Eya in activation of their target genes through nuclear translocation...
Ngày tải lên: 07/03/2014, 17:20