this structure is composed by setting two microstrip lines of width w at a distance s the two lines can carry two fundamental quasi tem modes the even and the odd mo
Tunable ferroelectric thin film devices for microwave applications
... fields The remnant polarization Pr, is the polarization value of the material at zero bias, also known as the spontaneous polarization, the saturation polarization Ps, is the maximum polarization, ... shift properties Then, an analog microwave phase shifter, which consists of coupled microstrip line loaded with parallel plate BST varactors and two planar Marchand baluns, was demonstrated The ... ferroelectric state and (b) a paraelectric state In (a) , Ps is the saturation polarization, Pr is the remnant polarization, Ec is the coercive field The main attraction of ferroelectric materials is the strong...
- 150
- 478
- 0
Vector sum phase shifter using a quadrature magic t for application in polarization control
... polarizations or a pair of oppositely circular polarizations 1.1.2 Mathematical representation of polarization For the convenience of the discussion, let s assume that the wave is always propagating in the ... and Ansys HFSS was used for the detailed design A prototype was fabricated and tested Comparison of the measured results with the simulated results was performed to validate the design In Chapter ... [1] As such, it is necessary for the base station on earth to have the ability to adjust its polarization Polarization is also important in the transmission of radar pulses and reception of radar...
- 144
- 238
- 0
Tài liệu Category 6 and 5e Dynamic Angle Right/Left Patch Panels pptx
... Minneapolis, Minnesota USA 55440-1101 Specifications published here are current as of the date of publication of this document Because we are continuously improving our products, ADC reserves the ... to change specifications without prior notice At any time, you may verify product specifications by contacting our headquarters office in Minneapolis ADC Telecommunications, Inc views its patent ... patent portfolio as an important corporate asset and vigorously enforces its patents Products orfeatures contained herein may be covered by one or more U .S or foreign patents An Equal Opportunity...
- 2
- 288
- 0
Tài liệu Báo cáo khoa học: The Alzheimer b-peptide shows temperature-dependent transitions between left-handed 31-helix, b-strand and random coil secondary structures doc
... buffer at pH 7.4 at 10 lm peptide concentrations The pH was adjusted using phosphate buffer and was measured using a standard pH-meter The sample preparation was carried out at C and the samples were ... appeared at lower temperature These observations indicate that the transition towards b-strand occurs at lower temperatures in the variant peptide than in Ab(1228) This is also in agreement with ... study two shorter fragments, Ab(19) and Ab(1228) at varying temperatures at 500 lm concentration and pH Assignment was based on standard procedures The aim was to obtain information on the temperature...
- 12
- 287
- 0
transmission line matrix (tlm) in computational mechanics - d. de cogan, et al., (crc, 2006) ww
... impulses We can also approximate more complicated wave forms by means of a train of impulses as shown in Figure 3.6 3.4 Propagation of a Signal in Space (Maxwell s Equations) The behavior of these ... mentioned above, as well as other advantages to be seen later, and so is shown in Table 2.1 as the wave variable pair Figure 2.3 shows two counter-propagating TLM pulses, f and g, in a link transmission ... looks very much like a two- dimensional shunt TLM mesh There was a realization in the mid 197 0s that a capacitor was in fact a transmission line, and Catt 's work shows networks comprising lumped series...
- 275
- 514
- 0
Báo cáo hóa học: " Efficient implementation of 90° phase shifter in FPGA" pptx
... coefficients A comparison of the hardware cost for the convectional CSD and the proposed CSD implementation is shown in Table FPGA implementation The complete filter hardware was described in VHDL and synthesized ... other Hardware architecture The proposed hardware architecture is shown in Figure The architecture consists of two basic blocks: coefficient add/sub and tap adder The delays are modeled as Flip-Flop ... PC and visualized in MATLAB The phase shifted output for a 13-MHz sinusoidal input is shown in Figure 15 adding one Here, we use a NOT gate for complementing and the carry of the tap adder is set...
- 5
- 303
- 0
Báo cáo nghiên cứu khoa học: " FAST CALCULATING FORMULAS OF CURRENT PASSING THROUGH GROUNDING SYSTEM OF HIGH VOLTAGE SUBSTATION WHEN LIGHTNING STRIKES AT THE GROUNDING WIRE OF TRANSMISSION LINE" pps
... system grounding and transients, New York and Basel [4] L .W. Bewley, Traveling waves on Transmission Systems, Dover Publications, Inc., New York [5] J.P Bickford and Others, Computation of Power ... (seeing from the position that lightning strikes to the first substation) in case of open-ended grounding wire line at this substation (Ω) Z is the grounding system impedance of second substation ... ⎣ s 4Z sZ p 4Z 2Z p + Z p + Z 2Z p s s ⎤ ⎥ ⎥ ⎥ ⎥ ⎥ ⎦ If we transform n series two- terminals networks into one then this equivalent twoterminals network will have the characteristic matrix as...
- 8
- 451
- 0
Báo cáo y học: "Acute pressure overload of the right ventricle. Comparison of two models of right-left shunt. Pulmonary artery to left atrium and right atrium to left atrium: experimental study" doc
... Lifesciences) to measures parameters such as CCO, SVV/SV, SVR This sensor is achieving measurements by pulse contour analysis based on arterial pressure waveform In this way it is possible to avoid ... period between two groups was analyzed using the Mann-Whitney test because of violation of normality All tests are two- sided, statistical significance was set at p < 0.05 All analyses were carried ... measurements The same observations are made for the decrease of O % saturation of the pulmonary artery pCO2 of the left atrium increase is statistically significant between the two groups at...
- 10
- 337
- 0
Broadband phase shifter design for phased array radar systems
... changed while its insertion loss remains the same Assume the reference state has an insertion phase of 1, and the phase shifting state has an insertion phase of 2, the phase shift is the phase ... phase is -180º and Z0 is the characteristic impedance of the system The phase shift can be obtained by changing ω0 of two all-pass networks and a phase shift peak will be obtained for each setting ... setting The advantage of the all-pass network is that the insertion phase can be treated separately due to the very high return loss Therefore, when two stages are cascaded, two peaks in the phase...
- 199
- 297
- 0
Transmission line and and waveguide
... dependent, Laplace s Equation TEM Wave (Cont.) Electric field can be expressed as the gradient of a Scalar potential also satisfies Laplace s equation The voltage and current Wave Impedance 10 Procedure ... Resonant Technique 10 Wave Velocities and Dispersion Rectangular Waveguide 32 Earliest type of transmission line Use for couplers, detectors, isolators, attenuators, and slotted lines Wave ... plate waveguide is the simplest type of waveguide that can support TE, TM and TEM TEM Mode 20 TEM mode solution can be obtained by solving Laplace s equation: The boundary condition for : There...
- 67
- 226
- 0
Báo cáo hóa học: " Research Article Blind Deconvolution in Nonminimum Phase Systems Using Cascade Structure" pptx
... vector of mixing signals, s( k) is the vector of source signals, and v(k) is the Gaussian noise with zero mean and a covariance matrix 0.1I Using this ARMA model, we can generate minimum phase or ... analysis, we know that the demixing model can be constructed by two parts: a causal filter F(z) and an anticausal scalar filter a( z−1 ) The two subfilters can exchange their positions because the filter a( z−1 ... at time-lag p, which is called the impulse response at time p In this paper, we assume the number of sensor signals is equal to the number of source signals s( k) = [s1 (k), , sn (k)]T is an...
- 10
- 229
- 0
microwave circuit modeling using electromagnetic field simulation
... the workstation architecture was initially more sophisticated, personal computer hardware and software has grown steadily more elaborate Today, the choice between a workstation and a PC is largely ... lengths The software might use a Y-matrix, a cascade of ABCD parameter blocks, or a cascade of S- parameter blocks for the actual analysis At the ports, we typically ask for S- parameters referenced ... de-embedding, and visualization Part of this discussion focuses on validation structures and some simple “calibration elements” that stimulate our thinking and make us confident that we are using the tool...
- 488
- 730
- 0
Báo cáo sinh học: " Multivariate Bayesian analysis of Gaussian, right censored Gaussian, ordered categorical and binary traits using Gibbs sampling" pptx
... Bayesian analysis of Gaussian, right censored Gaussian, categorical and binary traits using the Gibbs sampler and data augmentation The methodology was applied to analyse a simulated dataset and the ... Simulated data The simulated data consist of records on five-thousand animals First the complete data consisting of a Gaussian, a right censored Gaussian, an ordered categorical, and a binary trait are ... Ui(aug) is associated with augmented data of observed, censored right censored Gaussian and observed ordered categorical and binary traits Ei(mis) is associated with residuals on the Gaussian scale...
- 25
- 166
- 0
Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 2
... Declaration I hereby declare that this thesis is my original work and it has been written by me in its entirety, under the supervision of Prof Stephan Jaenicke, (in the laboratory catalysis lab ... been used in the thesis This thesis has also not been submitted for any degree in any university previously The content of the thesis has been partly published in: H H Liu, G K Chuah, S Jaenicke*, ... lab in S5 -04-04 and S5 -02-02), Chemistry Department, National University of Singapore, between August 2008 and December 2012 I have duly acknowledged all the sources of information which have been...
- 2
- 324
- 1
Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 1
... impregnation step Depending on the nature of the catalyst, the pre-catalyst is then subjected to a calcination process This treatment consists of heating the catalysts in an oxidizing atmosphere at ... frequently carried out by palladium catalysts together with a copper co-catalyst using an amine as solvent [62] Besides copper as the co-catalysts, Ag also was used as the co-catalysts for this type of ... reversibility) Catalysis is a vital technology in today s world Approximately 90 % of our chemicals and materials are produced using catalysis at one stage or another The catalyst can either be dissolved...
- 221
- 658
- 0
Sự khác biệt giữa LEFT JOIN , RIGHT JOIN , INNERJOIN
... hàng máy in: SELECT Employees.Name FROM Employees, Orders WHERE Employees.Employee_ID = Orders.Employee_ID AND Orders.Product = ‘Printer’ kết trả về: Name Hansen, Ola S dụng JOIN Ta s dụng từ ... bảng thứ hai (Orders) Nếu có dòng bảng Employees không ứng với dòng bảng Orders dòng tính kết trả về: Name Hansen, Ola Svendson, Tove Svendson, Stephen Svendson, Stephen Pettersen, Kari Product ... (Employees) Nếu có dòng bảng Orders không ứng với dòng bảng Employees dòng tính kết trả về: Name Hansen, Ola Svendson, Stephen Svendson, Stephen Ví dụ: Ai đặt hàng máy in: SELECT Employees.Name FROM...
- 3
- 13,035
- 29
Báo cáo khoa học: An engineered right-handed coiled coil domain imparts extreme thermostability to the KcsA channel docx
... ACCGTTATCATCGACGACCGTTACGAATCTCTGAAAAACCTGATCACCCTGCGTGCGGACCGTCTGGAAATGATTATCAACGACAACGTTTCTACCATCCTGGCGTCAATT TGA GAATTCTCATTAAATTGACGCCAGGATGGT-3¢ (the recognition sites of BamHI and EcoRI are underlined) The two amplified fragments were joined by fusion ... very stable and displays properties of SDS resistance and heat resistance Thermostability in the presence of SDS is generally used to indicate the stability of ion channels [20–22,29,30] It is usually ... determination of KcsA constructs (A) Representative SDS ⁄ PAGE used in thermostability analyses (KcsA–RHCC at pH 8) The tetramer, dimer and monomer bands of KcsA–RHCC are indicated on the left-hand side...
- 11
- 395
- 0
Báo cáo khoa học: "Left-to-Right Target Generation for Hierarchical Phrase-based Translation" doc
... that a finite state transducer, or a phrase-based model, is a subclass of a synchronous-CFG Figure 1 (a) shows an example Japanese-toEnglish translation by a phrase-based model described in Section ... Thus, by controlling what types of phrase-based rules employed in a grammar, we will be able to simulate a phrasebased translation model with various constraints This reduction is rather natural ... mistakes that it is necessary to learn lessons from the history of criminal It is necessary to learn lessons from history so as not to repeat similar mistakes in the future The ministries will...
- 8
- 232
- 0
Báo cáo khoa học: "DETERMINISTIC LEFT TO RIGHT PARSING OF TREE ADJOINING LANGUAGES*" ppt
... that the moves of the two machines are dual of each other LR Parsing Algorithm An LR parser consists of an input, an output, a sequence of stacks, a driver program, and a parsing table that has ... (i.e the set of all paths from root to leaves in trees derived by a CFG) is a regular set On the other hand, the path set of a TAG is a CFL This follows from the nature of the adjoining operation ... spine of 8, star' consists of all the nodes in star that strictly dominate the dotted node When the dotted node is on the spine, stars' consists of all the nodes in star that strictly dominate the...
- 8
- 218
- 0
From business strategy to IT action right decisions for a better bottom line
... How I build a business case for the IT investments we need? IT Managers and Professionals: How we explain to the business what we are doing and why it costs what it does? How we cut costs and still ... Innovation Plans: Establish Business Requirements and IT Solutions based on business strategy Business Strategies Resource Decisions: Justify and prioritize Programs and Projects based on business ... questions and helpful tools to address this complex issue —Francisco A Figueroa, CFO and Vice President, Sandia National Laboratories This is a dynamite book of practical advice for companies...
- 354
- 577
- 0
Tìm thêm: khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008