Báo cáo khoa học: An engineered right-handed coiled coil domain imparts extreme thermostability to the KcsA channel docx

An engineered right-handed coiled coil domain imparts extreme thermostability to the KcsA channel Zhiguang Yuchi 1 , Victor P. T. Pau 2 , Bridget X. Lu 1 , Murray Junop 1 and Daniel S. C. Yang 1 1 Department of Biochemistry and Biomedical Sciences, Faculty of Health Sciences, McMaster University, Hamilton, Canada 2 Department of Biochemistry, Temple University School of Medicine, Philadelphia, PA, USA Introduction Tetrameric architecture is a common character shared by cation channels, including potassium, sodium, cal- cium, nonselective, glutamate gated, cyclic nucleotide gated (CNG), transient receptor potential channels, and other ion channels [1,2]. Although they differ from each other in terms of selectivity and physiological activator, they all have to organize to a tetrameric arrangement in order to be functional. The ion con- ducting function is fulfilled by a central ion conducting pore composed of selectivity filters and a-helices arranged in four-fold or pseudo four-fold symmetry. Most potassium channels form homo- or heterotet- ramers. Several different cytoplasmic tetramerization domains have been found to be important for proper channel assembly. For example, T1, an N-terminal tetramerization domain, is used by the Kv channel, whereas C-terminal tetramerization domains are used by ether-a-go-go (EAG) channels, potassium inwardly rectifying (Kir) channels, calcium activated channels and CNG channels [3–11]. Despite different families of potassium channels being structurally similar and often co-expressed in the Keywords chimeric channel; coiled coil; KcsA; RHCC; tetramerization domain Correspondence D. S. C. Yang, Department of Biochemistry and Biomedical Sciences, Faculty of Health Sciences, McMaster University, 1200 Main Street West, Hamilton, Ontario L8N 3Z5, Canada Fax: +1 905 522 9033 Tel: +1 905 525 9140 ext. 22455 E-mail: yang@mcmaster.ca (Received 10 June 2009, revised 14 July 2009, accepted 26 August 2009) doi:10.1111/j.1742-4658.2009.07327.x KcsA, a potassium channel from Streptomyces lividans, was the first ion channel to have its transmembrane domain structure determined by crystal- lography. Previously we have shown that its C-terminal cytoplasmic domain is crucial for the thermostability and the expression of the channel. Expression was almost abolished in its absence, but could be rescued by the presence of an artificial left-handed coiled coil tetramerization domain GCN4. In this study, we noticed that the handedness of GCN4 is not the same as the bundle crossing of KcsA. Therefore, a compatible right-handed coiled coil structure was identified from the Protein Data Bank and used to replace the C-terminal domain of KcsA. The hybrid channel exhibited a higher expression level than the wild-type and is extremely thermostable. Surprisingly, this stable hybrid channel is equally active as the wild-type channel in conducting potassium ions through a lipid bilayer at an acidic pH. We suggest that a similar engineering strategy could be applied to other ion channels for both functional and structural studies. Structured digital abstract l MINT-7260032: kcsA (uniprotkb:P0A334) and kcsA (uniprotkb:P0A334) bind (MI:0407)by molecular sieving ( MI:0071) l MINT-7260022: kcsA (uniprotkb:P0A334) and kcsA (uniprotkb:P0A334) bind (MI:0407)by circular dichroism ( MI:0016) Abbreviations cdKcsA, C-terminal deleted KcsA; CNG, cyclic nucleotide gated; EAG, ether-a-go-go; GFC, gel filtration chromatography; Kir, potassium inwardly rectifying; LDAO, N,N-dimethyldodecylamine-N-oxide; NPo, nominal open probability; RHCC, right-handed coiled coil; T m, temperature at which half the tetrameric channels dissociate into monomers; wtKcsA, wild-type KcsA; RMS, root mean square. 6236 FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS same cell type, they seldom mix with each other to form heterotetramers [12,13]. This important intra- family recognition is also carried out by the tetramer- ization domains. For example, the specificity of T1 determines the compatibility of channels from different families during Kv channel assembly [3,5,13–19]. It has also been shown that the replacement of the T1 domain of DRK1 channel with the corresponding domain from a distantly related Drosophila Shaker B channel allowed the hybrid DRK1 channel to co- assemble with the Shaker B channel [5]. KcsA, a potassium channel from Streptomyces livi- dans, is a good model for investigating the working mechanism of potassium channels, as it has a relatively simple structure, but contains many typical compo- nents of potassium channels, such as a selectivity filter, a pore-forming domain and a sensor domain. It has been proposed that the C-terminal domain of KcsA acts as a tetramerization domain [20–22]. This domain can self-associate to form a stable tetramer [20] and its presence is required for proper expression of tetrameric KcsA [21]. This domain could be replaced by an artifi- cial tetramerization domain GCN4-LI [23] without affecting the expression of the functional channel, but the thermostability of the hybrid channel is slightly diminished [22]. In order to determine the cause of the reduced thermostability, we inspected the crystal struc- ture of GCN4-LI and KcsA, and found that GCN4-LI forms a left-handed coiled coil, but the bundle crossing on KcsA is a right-handed coiled coil (RHCC). We hypothesized that the splicing of two different handed coiled coil structures may be the culprit in the reduc- tion in thermostability. In this study, with the aim of pursuing a more stable hybrid channel of KcsA for structural studies, we chose to use a RHCC [24] to replace the C-terminal domain of wild-type KcsA (wtKcsA). The hybrid channel, KcsA–RHCC, was computationally designed to form a continuous RHCC at the bundle crossing. As expected, this hybrid channel was expressed at a higher level than the wild-type channel in Escherichia coli and exhibited extreme in vitro thermostability. It remained mainly as a tetramer, even after prolonged treatment at 100 °C in the presence of SDS. Surpris- ingly, this stable hybrid channel without the native pH sensor domain could still sense pH change and conduct potassium ions. One of the reasons for the scarcity of structural data on channels is their relatively low protein expression level. Because tetramer stabilities of Kv and KcsA had been found to correlate with their expression level [22,25], a better tetramerizing construct by protein engi- neering may assist channel expression. Apart from protein expression level, interdomain flexibility is another reason for the scarcity of structural data, because of their negative effects on the diffraction qual- ity of protein crystals. Therefore, replacement of the ori- ginal flexible interdomain linker by a rigid continuous coiled coil should facilitate structure determination of ion channels. We propose that similar engineering effort may be applicable to other ion channels to assist their expression, as well as structural and functional studies. Results Computational design of KcsA–RHCC The hybrid channel KcsA–GCN4 previously reported by our laboratory is composed of a transmembrane domain of KcsA (residues 1–120) linked to a left- handed coiled coil GCN4-LI (pdb code: 1GCL) [23] with a linker containing a TEV recognition sequence [22] (Fig. 1A,B). In this study, the effect of coiled coil handedness of the tetramerization domain on the sta- bility of KcsA was examined. Four tetrameric coiled coils were selected for this: NSP4(95–137) (pdb code: 1G1I) [26], RH4B (pdb code: 2O6N) [27], VASP TD (pdb code: 1USE) [28] and RHCC (pdb code: 1FE6) [24]. NSP4(95–137) is the coiled coil domain of a virally encoded receptor, and the metal-binding site identified in this domain is believed to play an impor- tant role in stabilizing the homotetrameric structure [26]. RH4B is a de novo designed 33-residue peptide comprising three 11-residue repeats, which can form a stable, right-handed parallel tetrameric coiled coil [27]. VASP TD is a 45-residue tetramerization domain from human vasodilator-stimulated phosphoprotein, a key regulator of actin dynamics. It is extremely thermosta- ble, with a melting temperature of 120 °C [28]. RHCC is a naturally occurring parallel right-handed coiled coil tetramer found in tetrabrachion, the surface layer protein from Staphylothermus marinus [24]. All of them display winding of the supercoil in a right-handed manner except NSP4(95–137), which forms a left- handed coiled coil. Simple replacement of the GCN4 fragment in KcsA– GCN4 with RH4 or RHCC without removal of the linker between the KcsA pore domain and the tetramer- ization domain did not improve the expression level and thermostability of the chimeric channels (data not shown). Because no obvious improvement was observed, we suspected that the linker between the transmembrane domain and the tetramerization domain may impair the co-operative effect on the assembly of these two domains. Thus, new attempts were made to Z. Yuchi et al. RHCC domain imparts extreme thermostability to the KcsA channel FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS 6237 build a continuous coiled coil structure without an intervening flexible linker. As the crystal structures of KcsA and all selected tetramerization domains are available, the inner helices of KcsA were structurally aligned with the foreign coiled coils. Among the four tetramerization domains, RHCC displayed the smallest root mean square (RMS) deviation when compared with the other three coiled coils (Table 1). The top ranking hybrid structures of KcsA–RHCC (Fig. 2) were modelled and Monte Carlo minimized using the pro- gram zmm-mvm. The result showed that RHCC (resi- dues 16–55) could be best spliced on to KcsA (residues 23–115) (Fig. 1A,B). This chimeric channel was cloned with N-terminal his-tag and named KcsA–RHCC. Expression and purification of KcsA–RHCC Recombinant KcsA–RHCC was expressed in E. coli. The yield of purified protein was  1.5 mgÆL )1 . Previ- ously it was found that deletion of the C-terminal domain (residues 121–160) almost completely abolished the expression of wtKcsA, but the addition of an artifi- cial tetramerization domain GCN4 rescued the expres- sion to wild-type level. KcsA–RHCC can reach a significantly higher total protein expression level than A B Fig. 1. (A) Partial sequence alignment of wtKcsA, KcsA–GCN4 and KcsA–RHCC. The alignment starts at the conserved selective filter sequence (in italic) and ends at the ends of C-terminal tetramerization domains. The different structural domains are indicated by the bars above the protein sequence. The linker between the KcsA pore domain and GCN4 is underlined. The tetramerization peptides GCN4 and RHCC are dotted underlined. (B) Models of wtKcsA, KcsA–GCN4 and KcsA–RHCC. The PDB files used in these models were: 3EFF [33] for full-length wtKcsA; 1K4C [59] for the pore domain of KcsA in KcsA–GCN4 and KcsA–RHCC; 1GCL [23] for GCN4; 1FE6 [24] for RHCC. The model of KcsA–RHCC was generated by structural alignment and followed by iterative energy minimization (see Results for details). The pictures of the three models were generated by ZMM-MVM. Table 1. RMS deviations of overlapping atoms at splice junctions from structural alignments between KcsA inner helices and four coiled coil structures output by FITHELICES. The five constructs with the smallest RMS are listed for each coiled coil structures. The unit is in Angstrom. Coiled coils RMS ranking NSP4(95–137) RH4B VASP TD RHCC 1 1.859 1.143 0.862 0.619 2 1.929 1.202 0.891 0.709 3 2.032 1.221 0.894 0.774 4 2.095 1.259 0.898 0.838 5 2.12 1.274 0.911 0.871 Fig. 2. Splicing of KcsA and RHCC. The left picture shows the model of KcsA–RHCC. Only two subunits are shown for clarity. The area enclosed by the square is where different splicing motifs were tested in silico. It is displayed on the right in enlarged format showing overlaps of different spliced structures. RHCC domain imparts extreme thermostability to the KcsA channel Z. Yuchi et al. 6238 FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS that of wtKcsA (Fig. 3A). The protein was purified to homogeneity using a HisTrap TM HP column (Fig. 3B). Biophysical characterization The secondary and quaternary structures of KcsA– RHCC were characterized by CD and gel filtration chromatography (GFC), respectively. The CD data showed that KcsA–RHCC is slightly more a-helical than wtKcsA (64% versus 62%, respectively; Fig. 4A). This is not surprising because RHCC existed predomi- nantly as an a-helix in its crystallized form. The GFC data showed that the majority of KcsA–RHCC is in a tetrameric form, whereas a very small portion of it is in a higher oligomeric form. This is very similar to that of wtKcsA (Fig. 4B). Taken together, these two results indicate that the gross biophysical nature of KcsA is not altered by the addition of RHCC. Thermostability test The thermostability of wtKcsA, C-terminal deleted KcsA (cdKcsA), KcsA–GCN4, KcsA–RHCC and RHCC were compared by gel-shift assay (Fig. 5A). The derived melting temperatures are shown in Fig. 5D. Tetrameric KcsA is very stable and displays properties of SDS resistance and heat resistance. Ther- mostability in the presence of SDS is generally used to indicate the stability of ion channels [20–22,29,30]. It is usually reported as the temperature at which half the tetrameric channels dissociate into monomers (T m ). At pH 8, the order of thermostability of the various con- structs was KcsA–RHCC > wtKcsA > KcsA– GCN4 > cdKcsA  RHCC (Fig. 5B,D). Clearly, the continuous coiled coil in KcsA–RHCC provided a strong tetramerization force, as indicated by its ultra- high T m value, which was much higher than 100 °C. However, when two parts of KcsA–RHCC, namely, A kDa WT GCN4125 120 RHCC 80 60 50 40 30 20 B 0 mM Imidazole gradient 500 mM kDa 55 35 27 15 KcsA–RHCC Fig. 3. (A) Western blot analysis of KcsA constructs. The same number of E. coli cells (quantified by D 600 ) expressing different KcsA constructs were analysed using 15% SDS ⁄ PAGE. KcsA was then identified by immunoblotting using an anti-his-tag IgG. WT: KcsA 1–160; 125: KcsA 1–125; 120: KcsA 1–120; GCN4: KcsA– GCN4; RHCC: KcsA–RHCC. (B) Purification of KcsA–RHCC by HisTrap TM HP column. Proteins samples were run on a 4–12% SDS ⁄ PAGE and stained with Commassie Blue. There was an increasing amount of imidazole for the elution of protein samples from the column present in the lanes from left to right. The arrow indicates the position of purified KcsA–RHCC protein. 0 200 400 600 800 1000 1200 1400 1600 0.00 5.00 10.00 15.00 20.00 25.00 Absorbance at 280 nm (mAU) Elution volume (mL) KcsA–RHCC wtKcsA Tetramer Higher oligomer –5000 –10 000 –15 000 –20 000 0 5000 10 000 15 000 20 000 25 000 A B 198 218 238 258 Molar ellipticity (deg×cm 2 /decimole) Wavelength (nm) KcsA–RHCC wtkcsA Fig. 4. Biophysical characterization of KcsA–RHCC. (A) CD spectra of tetrameric wtKcsA and KcsA–RHCC in LDAO. Estimated a-heli- cal contents for wtKcsA and KcsA–RHCC are 62 and 64%, respec- tively. (B) Elution profile of wtKcsA and KcsA–RHCC from the GFC column. The estimated molecular mass of the tetrameric LDAO– wtKcsA and LDAO–KcsA–RHCC micelles are 114 and 149 kDa, respectively. Z. Yuchi et al. RHCC domain imparts extreme thermostability to the KcsA channel FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS 6239 cdKcsA and RHCC, were tested individually, both of them displayed relatively low T m , suggesting that the high stability of KcsA–RHCC is the result of a co-operative effect. At pH 4, the order of thermostability was KcsA–RHCC > cdKcsA > KcsA–GCN4 > wtKcsA > RHCC (Fig. 5C,D). All constructs except cdKcsA showed a decrease in T m upon pH change from 8 to 4, showing that all three tetramerization domains are somewhat sensitive to pH change. The pH effect on wtKcsA is well documented; however, the acid labile nature of wild-type RHCC has not been known until this investigation. The acid labilities of GCN4 and RHCC may be due to the weakening of intra- and⁄ or interhelical salt bridges that stabilize their respective coiled coil structures [23,24]. Electrophysiological test of KcsA–RHCC When designing the KcsA–RHCC hybrid channel, we expected the continuous coiled coil structure to keep the inner helices and the channel permanently in the closed form. However, the observed pH-sensitive nature of the hybrid channel led us to speculate that KcsA–RHCC may be conducting at acidic pH. This speculation was confirmed by the measurement of its potassium con- ducting activity with a planar bilayer system. KcsA– RHCC can be opened at pH 4 and its apparent opening probability (NPo) is 0.13, which is similar to that of wtKcsA (NPo = 0.15) (Fig. 6A,B) [31]. However, its zero-voltage conductance (44 pS) is lower than that of wtKcsA (97 pS), and the outward rectifying property of wtKcsA was not obvious in KcsA–RHCC (Fig. 6C) [32]. When the buffer was changed to pH 8, channel activity could barely be observed (Fig. 6A,B). Discussion Chimeric channel KcsA–RHCC was designed with the aim of generating a more stable and robust channel for structural and functional studies. Tetramerization domains are present in many different families of ion 30 40 50 60 70 80 90 100 (°C) kDa 40 35 25 15 Tetramer A B C D Dimer Monomer 0 10 20 30 40 50 60 70 80 90 100 30 40 50 60 70 80 90 100 % of KcsA in tetrameric form Temperature (°C) pH8 wtKcsA cdKcsA KcsA–GCN4 KcsA–RHCC RHCC 0 10 20 30 40 50 60 70 80 90 100 30 40 50 60 70 80 90 100 % of KcsA in tetrameric form Temperature (°C) pH4 wtKcsA cdKcsA KcsA–GCN4 KcsA–RHCC RHCC 80.2 36.9 54.5 63.9 67.2 59.1 >100.0 78.9 52.9 0.0 0.0 10.0 20.0 30.0 40.0 50.0 60.0 70.0 80.0 90.0 100.0 pH8 pH4 Temperature (°C) Tm at different pH wtKcsA cdKcsA KcsA–GCN4 KcsA–RHCC RHCC Fig. 5. Thermostability determination of KcsA constructs. (A) Representative SDS ⁄ PAGE used in thermostability analyses (KcsA–RHCC at pH 8). The tetramer, dimer and monomer bands of KcsA–RHCC are indicated on the left-hand side of the gel. The specific temperatures for heat treatment are indicated above the gel. (B, C) Comparison of stability of wtKcsA, cdKcsA, KcsA–GCN4, KcsA–RHCC and RHCC at differ- ent temperatures at (B) pH 8 and (C) pH 4. The fractional tetramer content in each sample was determined from the densitometry scans of SDS ⁄ PAGE. The results shown in (B) and (C) are given as mean ± standard derivation (n = 3). (D) Comparison of T m values of three KcsA constructs at pH 8 and pH 4. Each curve in (B) and (C) was fitted into the sigmoidal dose responsive (variable slope) model with R 2 > 0.97 using GRAPHPAD PRISM software (La Jolla, CA, USA). The T m values were calculated from the corresponding equations of the models. RHCC domain imparts extreme thermostability to the KcsA channel Z. Yuchi et al. 6240 FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS channels. Our previous study established the impor- tance of the native tetramerization domain in KcsA and found that it can be replaced by an artificial tetra- merization domain GCN4 [22]. In this study, the effects of different non-native tet- ramerization domains and modes of linkage on the stability of a KcsA hybrid channel were investigated. It was found that whenever a flexible linker is present the contributions of the different tetramerization domains are very similar. However, a more stable con- struct was obtained when two structurally compatible domains were linked directly without a flexible linker. Although GCN4 itself can form a stable tetramer, its left-handed supercoil structure is not compatible with the right-handed inner helix of KcsA. The linking of these two structures could not be done without distort- ing one or both of the contributing structures, which would result in an unstable structure (Fig. 1B, middle). On the other hand, the C-terminal domain of wtKcsA was shown to adopt a right-handed four-helix bundle structure linked to the inner helix via a less helical structure [29,33] (Fig. 1B, left). The discontinuity in the coiled coil structure may allow for flexibility and suit its gating function; however, it will inevitably compromise stability. In contrast, the continuous RHCC design in KcsA–RHCC overcomes this prob- lem and dramatically improves the stability of the hybrid channel (Fig. 1B, right). Previously we proposed a model of in vivo channel assembly describing the correlation between channel stability and protein expression level [22]. The results reported in this study are consistent with this model. A B C Open Close 10 pA 15 sec pH 4 pH 8 pH 4 pH 4 pH 8 Current (pA) 0 2 4 6 8 10 Count (N) 0 100 000 200 000 Current (pA) 0 2 4 6 8 10 Count (N) 0 40 000 80 000 120 000 NPo = 0.014 ± 0.005 NPo = 0.129 ± 0.032 Close Open Close –2 –4 –6 –8 0 2 4 6 8 10 –200 –50–100–150 0 50 100 150 200 V, mV I, pA Fig. 6. Measurement of currents conducted by KcsA–RHCC. (A) Representative current traces from a lipid bilayer containing KcsA–RHCC at pH 4 (left panel) for a period of 1 min with an applied voltage of 200 mV followed by buffer exchange to pH 8 (middle panel) and back to pH 4 again (right panel). A high resolution detail of the measured current is shown at the top of the left panel, with the open and closed states indicated at the side. (B) All-points amplitude histogram of single channel recordings for KcsA–RHCC at pH 4 and 8, respectively. The open and closed states are indicated at the bottom of the chart. NPo values at pH 4 and 8 are indicated above the graphs. They are indicative of the mean levels of activity from three recordings. (C) I–V curve at pH 4. Each data point represents mean current (± standard error, n = 3). Z. Yuchi et al. RHCC domain imparts extreme thermostability to the KcsA channel FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS 6241 The stability order deduced from a gel-shift assay was: KcsA–RHCC > wtKcsA > KcsA–GCN4 > KcsA 1–125, which directly corresponds to the order of their respective protein expression levels (Fig. 3A). How- ever, it is puzzling that this correlation only holds well for total proteins encompassing all oligomeric forms, but not with the tetrameric form! The coiled coil motif is a commonly found structure in proteins. A statistical study from a genomic analysis suggested that 5–10% of all protein sequences are in coiled coils of various oligomeric states [34]. Typically two to six a-helices wind around each other to form a supercoil [35,36]. They are widely found in a diverse array of proteins, such as transcription factors and extracellular matrix proteins [37,38]. Because of its simple and predictable folding properties, coiled coils have been used as temperature regulators, antibody stabilizers, anticancer drugs, purification tags, hydro- gels and linker systems, etc [36]. In this study, we intended to fuse a right-handed tetrameric coiled coil to KcsA to form a continuous coiled coil. The multiplicity of coiled coil candidates and the multiple possible splice junctions render exhaustive experimental testing intractable. In silico selection was therefore used to identify the optimal splice variants. Both RHCC and left-handed coiled coils were used as target candidates and our algorithm easily identified the RHCC as better candidates. The robustness of our computational algorithm was later confirmed by the extreme thermostability of the selected hybrid channel. This selection algorithm is applicable to the design of other chimeric channels. Regulation of ion channels by non-native domains has been achieved in a large number of chimera experi- ments. Most of these experiments involved intrafamily sensor domain swapping, including the recent struc- tural studies on Kv1.2–Kv2.1 [39], Kir3.1–prokaryotic Kir [40], as well as many functional studies on a vari- ety of ion channels [41–44]. Several chimera experi- ments involved interfamily sensor swapping, including using sensor domains from the Shaker channel, IRK1 channel and CNG channel to control the gating of KcsA [45,46]. Meanwhile, utilization of a nonchannel module to assist channel expression has also been reported [25]. However, regulation of channel gating by a non- channel module has not yet been reported. The fact that KcsA–RHCC can conduct current opens up the possibility of using RHCC as an alternative sensor domain to the pore domain of other ion channels for functional assays and drug screening. The pH depen- dency of RHCC gating stems from its tetramerization property. Its tetramer completely dissociates at acidic pH (Fig. 5C,D), which is similar to the C-terminal domain of KcsA [20]. Structural flexibility is a major obstacle in the pro- duction of well-diffracting protein crystals due to its effect on ordered crystal packing. The presence of a flexible interdomain linker on wtKcsA reduced the dif- fraction quality of its crystals (V. P. T. Pau, unpub- lished results) [33]. Stiffening of KcsA by the addition of RHCC should make it more prone to the yielding of well-diffracting crystals. Currently, crystallization conditions for KcsA–RHCC are being screened. We propose that a similar engineering design may also be applied to other ion channels as they all proba- bly possess a RHCC structure at their respective bundle crossing [1,47–51]. Functional minimal ion con- ducting modules composed of S5–S6 helices from vari- ous channels have been produced [52–55]. We envisage that the expression of minimal channels may be facili- tated by appropriate tetramerization domains and the success of this effort will certainly open up the possi- bilities in structural and functional characterization of ion channels. Materials and methods Computational design of KcsA–RHCC A comprehensive search of the Protein Data Bank [56] for RHCC or parallel coiled coil structures that have four-fold rotational symmetry retrieved four candidates. The pro- gram fithelices (Doc. S1) was used to determine the optimal splicing positions for joining the coiled coil fusion candidate to KcsA. The indicator used by the program is the root mean square deviation of the overlapping atoms at the spliced site. The coordinates of the best spliced structure for each fusion candidate were then Monte Carlo minimized by program zmm-mvm (http://www. zmmsoft.com/). The PDB file of the best minimized structures can be found in Doc. S1. Molecular cloning The DNA sequence encoding residues Ala23-Val115 of KcsA was amplified from pET28–KcsA [22], which con- tains the wtKcsA gene of S. lividans, by PCR using Pfu DNA polymerase (Fermentas, Burlington, Canada) with a forward primer 5¢-GATTC GGATCCGCGCTGCACTGG AGGGC-3¢ and a reverse primer 5¢-TGATAACG GTGA CGAACCAGGTGGCCAGCG-3¢. A gene encoding resi- dues Thr16-Ile52 of RHCC (Table 2) was synthesized with optimal codon usage for E. coli [57] and PCR amplified with the following primers: forward: 5¢-CTGGTTCGT CACCGTTA TCATCGACGAC-3¢ and reverse: 5¢-GAC RHCC domain imparts extreme thermostability to the KcsA channel Z. Yuchi et al. 6242 FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS TGA GAATTCTCATTAAATTGACGCCAGGATGGT-3¢ (the recognition sites of BamHI and EcoRI are underlined). The two amplified fragments were joined by fusion PCR [58], digested with the corresponding restriction enzymes and cloned into pET28M, a modified pET28a expression vector [20]. The sequence of this N-terminal his-tagged con- struct, pET28M ⁄ kcsa-rhcc, was confirmed by dideoxynucle- otide sequencing. The cloning of wtKcsA and KcsA–GCN4 was as previously described [22]. RHCC cloned in pET15b was a gift from R. Kammerer (The University of Manchester, UK). Protein expression and purification E. coli BL21(DE3) cells were transformed with pET28M ⁄ kcsa-rhcc. A single colony was inoculated and grown in 100 mL Luria–Bertani broth with 100 lgÆmL )1 kanamycin (as the final concentration) at 37 °C overnight. The culture was then diluted into 1 L Luria–Bertani broth with 100 lgÆmL )1 kanamycin and further grown for 100 min. Protein expression was induced by the addition of isopropyl b-d-thiogalactopyranoside to a final concentra- tion of 1 mm. Cells were pelleted after 3 h of incubation at 37 °C, resuspended in lysis buffer (20 mm Tris, pH 8, 150 mm KCl and 1 mm phenylmethanesulfonyl fluoride) and subsequently lysed by French Press at 10 000 psi. The cell lysate was centrifuged at 100 000 g for 1 h and the pel- let was solubilized in 20 mL of 20 mm Tris, pH 8, 150 mm KCl, 1 mm phenylmethanesulfonyl fluoride and 1% v ⁄ v N,N-dimethyldodecylamine-N-oxide (LDAO) overnight at 4 °C. The resuspended mixture was centrifuged at 100 000 g for 1 h and the supernatant was loaded on to a HisTrap TM HP column (GE Healthcare, Piscataway, NJ, USA). Protein was purified using an FPLC system (Pharmacia, Uppsala, Sweden) with a linear gradient of 0–500 mm imidazole. Purified proteins were analysed using a NuPAGE Novex 4–12% Bistris midi gel (Invitrogen, Carlsbad, CA, USA) with Coomassie Blue staining. wtKcsA, KcsA–GCN4 and RHCC were expressed and purified in a similar manner except the absence of detergent during RHCC purification. cdKcsA was generated by chymotrypsin digestion of wtKcsA [22]. Thermal stability determination Protein of KcsA–RHCC was dialysed overnight against a solution containing 150 mm KCl, 0.1% v ⁄ v LDAO, 20 mm Tris, pH 8 (or 15 mm potassium citrate, pH 4) in dialysis bags with a molecular mass cut-off of 3500 Da. The dialy- sed sample was mixed with a loading solution containing 10% w ⁄ v SDS, 9.3% w ⁄ v dithiothreitol and 38% w ⁄ v glyc- erol, heated for 30 min at various temperatures ranging from 30 to 100 °C with a 10 °C increment, cooled to room temperature and analysed by SDS ⁄ PAGE. Three indepen- dent experiments were performed. Scanned images of the gels were analysed using imagej (http://rsb.info.nih.gov/ij/) in Integrated-Intensity-Mode to determine the amounts of tetramer and monomer in the samples. The fractional tetramer content was calculated by dividing the integrated density of tetramer by the combined integrated densities of tetramer and monomer. Model fitting of the thermal denaturation curves was carried out using prism 4.00 (GraphPad Software Inc., San Diego, CA, USA). GFC GFC was run on an FPLC system (Amersham Biosciences, Piscataway, NJ, USA) using a Superdex 200 column (Amersham Biosciences) equilibrated in 50 mm Tris buffer (pH 8), 150 mm KCl and 0.1% v ⁄ v LDAO. CD measurement Protein samples at a 10 lm monomeric protein concentra- tion were dissolved in 20 mm K 2 HPO 4 (pH 8), 150 mm KCl and 0.1% v ⁄ v LDAO. CD spectra of the samples were recorded in a 0.1 cm path length cell at 25 °C using a 410 CD spectrometer (AVIV Biomedical Inc., Lakewood, NJ, USA). The secondary structure content of each sample was quantified using the CD spectrum analysis program cdsstr of the cdpro suite (http://lamar.colostate.edu/sreeram/ CDPro ⁄ main.html). Electrophysiology Channel recordings were performed in a horizontal planar lipid bilayer of 1-palmitoyl-2-oleoyl-phosphatidylethanol- amine (POPE) and 1-palmitoyl-2-oleoyl-sn-phosphatidylgly- cerol (POPG) (15 and 5 mgÆmL )1 , respectively) at room temperature. Both cis and trans chambers were filled with solution at pH 4 (150 mm KCl, 20 mm potassium acetate) at the start, which was changed to pH 8 (150 mm KCl, 20 mm Tris) when needed. Current records were acquired at a sampling frequency >10 kHz and filtered to 1 kHz. Acknowledgements We thank Dr Richard Kammerer, University of Man- chester, for providing us with the plasmid, Table 2. DNA sequence of the synthesized rhcc gene. ACCGTTATCATCGACGACCGTTACGAATCTCTGAAAAACCTGATCACCCTGCGTGCGGACCGTCTGGAAATGATTATCAACGACAACGTTTCTACCATCCTGGCGTCAATT Z. Yuchi et al. RHCC domain imparts extreme thermostability to the KcsA channel FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS 6243 pET15b ⁄ RHCC. We also thank Drs Richard M. Epand, Raquel Epand and Vettai S. Ananthanarayanan, McMaster University, for usage of CD spectrometers; Dr Brad Rothberg, Temple University, for usage of electrophysiological equipment and critical reading of this manuscript. This work was supported by Microstar Biotech Inc. and NSERC (DY). References 1 Doyle DA, Morais Cabral J, Pfuetzner RA, Kuo A, Gulbis JM, Cohen SL, Chait BT & MacKinnon R (1998) The structure of the potassium channel: molecular basis of K+ conduction and selectivity. Science 280, 69–77. 2 Hille B (2001) Ion Channels of Excitable Membrane, 3rd edn. Sinauer Associates, Sunderland, MA. 3 Shen NV, Chen X, Boyer MM & Pfaffinger PJ (1993) Deletion analysis of K+ channel assembly. Neuron 11, 67–76. 4 Kreusch A, Pfaffinger PJ, Stevens CF & Choe S (1998) Crystal structure of the tetramerization domain of the Shaker potassium channel. Nature 392, 945–948. 5 Li M, Jan YN & Jan LY (1992) Specification of subunit assembly by the hydrophilic amino-terminal domain of the Shaker potassium channel. Science 257, 1225– 1230. 6 Jenke M, Sanchez A, Monje F, Stuhmer W, Weseloh RM & Pardo LA (2003) C-terminal domains implicated in the functional surface expression of potassium channels. EMBO J 22, 395–403. 7 Tinker A, Jan YN & Jan LY (1996) Regions responsi- ble for the assembly of inwardly rectifying potassium channels. Cell 87, 857–868. 8 Jiang Y, Pico A, Cadene M, Chait BT & MacKinnon R (2001) Structure of the RCK domain from the E. coli K+ channel and demonstration of its presence in the human BK channel. Neuron 29, 593–601. 9 Quirk JC & Reinhart PH (2001) Identification of a novel tetramerization domain in large conductance K(ca) channels. Neuron 32, 13–23. 10 Schmalhofer WA, Sanchez M, Dai G, Dewan A, Secades L, Hanner M, Knaus HG, McManus OB, Kohler M, Kaczorowski GJ et al. (2005) Role of the C-terminus of the high-conductance calcium-activated potassium channel in channel structure and function. Biochemistry 44, 10135–10144. 11 Zhou L, Olivier NB, Yao H, Young EC & Siegelbaum SA (2004) A conserved tripeptide in CNG and HCN channels regulates ligand gating by controlling C-termi- nal oligomerization. Neuron 44, 823–834. 12 Wei A, Jegla T & Salkoff L (1996) Eight potassium channel families revealed by the C. elegans genome project. Neuropharmacology 35, 805–829. 13 Covarrubias M, Wei AA & Salkoff L (1991) Shaker, Shal, Shab, and Shaw express independent K+ current systems. Neuron 7, 763–773. 14 VanDongen AM, Frech GC, Drewe JA, Joho RH & Brown AM (1990) Alteration and restoration of K+ channel function by deletions at the N- and C-termini. Neuron 5, 433–443. 15 Schulteis CT, Nagaya N & Papazian DM (1998) Subunit folding and assembly steps are interspersed during Shaker potassium channel biogenesis. J Biol Chem 273 , 26210–26217. 16 Hopkins WF, Demas V & Tempel BL (1994) Both N-and C-terminal regions contribute to the assembly and functional expression of homo- and heteromulti- meric voltage-gated K+ channels. J Neurosci 14, 1385–1393. 17 Deal KK, Lovinger DM & Tamkun MM (1994) The brain Kv1.1 potassium channel: in vitro and in vivo studies on subunit assembly and posttranslational processing. J Neurosci 14, 1666–1676. 18 Xu J, Yu W, Jan YN, Jan LY & Li M (1995) Assembly of voltage-gated potassium channels. Conserved hydro- philic motifs determine subfamily-specific interactions between the alpha-subunits. J Biol Chem 270, 24761– 24768. 19 Shen NV & Pfaffinger PJ (1995) Molecular recognition and assembly sequences involved in the subfamily- specific assembly of voltage-gated K+ channel subunit proteins. Neuron 14, 625–633. 20 Pau VP, Zhu Y, Yuchi Z, Hoang QQ & Yang DS (2007) Characterization of the C-terminal domain of a potassium channel from Streptomyces lividans (KcsA). J Biol Chem 282, 29163–29169. 21 Molina ML, Encinar JA, Barrera FN, Fernandez- Ballester G, Riquelme G & Gonzalez-Ros JM (2004) Influence of C-terminal protein domains and protein– lipid interactions on tetramerization and stability of the potassium channel KcsA. Biochemistry 43, 14924– 14931. 22 Yuchi Z, Pau VP & Yang DS (2008) GCN4 enhances the stability of the pore domain of potassium channel KcsA. FEBS J 275, 6228–6236. 23 Harbury PB, Zhang T, Kim PS & Alber T (1993) A switch between two-, three-, and four-stranded coiled coils in GCN4 leucine zipper mutants. Science 262, 1401–1407. 24 Stetefeld J, Jenny M, Schulthess T, Landwehr R, Engel J & Kammerer RA (2000) Crystal structure of a naturally occurring parallel right-handed coiled coil tetramer. Nat Struct Biol 7, 772–776. 25 Zerangue N, Jan YN & Jan LY (2000) An artificial tetramerization domain restores efficient assembly of functional Shaker channels lacking T1. Proc Natl Acad Sci USA 97, 3591–3595. RHCC domain imparts extreme thermostability to the KcsA channel Z. Yuchi et al. 6244 FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS 26 Bowman GD, Nodelman IM, Levy O, Lin SL, Tian P, Zamb TJ, Udem SA, Venkataraghavan B & Schutt CE (2000) Crystal structure of the oligomerization domain of NSP4 from rotavirus reveals a core metal-binding site. J Mol Biol 304, 861–871. 27 Sales M, Plecs JJ, Holton JM & Alber T (2007) Struc- ture of a designed, right-handed coiled-coil tetramer containing all biological amino acids. Protein Sci 16, 2224–2232. 28 Kuhnel K, Jarchau T, Wolf E, Schlichting I, Walter U, Wittinghofer A & Strelkov SV (2004) The VASP tetra- merization domain is a right-handed coiled coil based on a 15-residue repeat. Proc Natl Acad Sci USA 101, 17027–17032. 29 Cortes DM, Cuello LG & Perozo E (2001) Molecular architecture of full-length KcsA: role of cytoplasmic domains in ion permeation and activation gating. J Gen Physiol 117, 165–180. 30 Perozo E, Cortes DM & Cuello LG (1999) Structural rearrangements underlying K+-channel activation gating. Science 285, 73–78. 31 Cordero-Morales JF, Cuello LG, Zhao Y, Jogini V, Cortes DM, Roux B & Perozo E (2006) Molecular determinants of gating at the potassium-channel selectivity filter. Nat Struct Mol Biol 13, 311–318. 32 LeMasurier M, Heginbotham L & Miller C (2001) KcsA: it’s a potassium channel. J Gen Physiol 118, 303–314. 33 Uysal S, Vasquez V, Tereshko V, Esaki K, Fellouse FA, Sidhu SS, Koide S, Perozo E & Kossiakoff A (2009) Crystal structure of full-length KcsA in its closed conformation. Proc Natl Acad Sci USA 106, 6644–6649. 34 Mewes HW, Frishman D, Gruber C, Geier B, Haase D, Kaps A, Lemcke K, Mannhaupt G, Pfeiffer F, Schuller C et al. (2000) MIPS: a database for genomes and protein sequences. Nucleic Acids Res 28, 37– 40. 35 Wolf E, Kim PS & Berger B (1997) MultiCoil: a pro- gram for predicting two- and three-stranded coiled coils. Protein Sci 6, 1179–1189. 36 Mason JM & Arndt KM (2004) Coiled coil domains: stability, specificity, and biological implications. ChemBioChem 5, 170–176. 37 Glover JN & Harrison SC (1995) Crystal structure of the heterodimeric bZIP transcription factor c-Fos-c-Jun bound to DNA. Nature 373, 257–261. 38 Frank S, Schulthess T, Landwehr R, Lustig A, Mini T, Jeno P, Engel J & Kammerer RA (2002) Characteri- zation of the matrilin coiled-coil domains reveals seven novel isoforms. J Biol Chem 277, 19071–19079. 39 Long SB, Tao X, Campbell EB & MacKinnon R (2007) Atomic structure of a voltage-dependent K+channel in a lipid membrane-like environment. Nature 450, 376–382. 40 Nishida M, Cadene M, Chait BT & MacKinnon R (2007) Crystal structure of a Kir3.1-prokaryotic Kir channel chimera. EMBO J 26, 4005–4015. 41 Zhao X, Bucchi A, Oren RV, Kryukova Y, Dun W, Clancy CE & Robinson RB (2009) In vitro character- ization of HCN channel kinetics and frequency dependence in myocytes predicts biological pacemaker functionality. J Physiol 587, 1513–1525. 42 Urquhart W, Gunawardena AH, Moeder W, Ali R, Berkowitz GA & Yoshioka K (2007) The chimeric cyc- lic nucleotide-gated ion channel ATCNGC11 ⁄ 12 consti- tutively induces programmed cell death in a Ca2+ dependent manner. Plant Mol Biol 65 , 747–761. 43 Varshney A & Mathew MK (2003) Inward and outward potassium currents through the same chimeric human Kv channel. Eur Biophys J 32, 113–121. 44 Cao Y, Crawford NM & Schroeder JI (1995) Amino terminus and the first four membrane-spanning segments of the Arabidopsis K+ channel KAT1 confer inward-rectification property of plant–animal chimeric channels. J Biol Chem 270, 17697–17701. 45 Lu Z, Klem AM & Ramu Y (2001) Ion conduction pore is conserved among potassium channels. Nature 413, 809–813. 46 Ohndorf UM & MacKinnon R (2005) Construction of a cyclic nucleotide-gated KcsA K+ channel. J Mol Biol 350, 857–865. 47 Jiang Y, Lee A, Chen J, Ruta V, Cadene M, Chait BT & MacKinnon R (2003) X-ray structure of a voltage- dependent K+ channel. Nature 423 , 33–41. 48 Long SB, Campbell EB & Mackinnon R (2005) Crystal structure of a mammalian voltage-dependent Shaker family K+ channel. Science 309, 897–903. 49 Jiang Y, Lee A, Chen J, Cadene M, Chait BT & MacK- innon R (2002) Crystal structure and mechanism of a calcium-gated potassium channel. Nature 417, 515–522. 50 Shi N, Ye S, Alam A, Chen L & Jiang Y (2006) Atomic structure of a Na+- and K+-conducting channel. Nature 440, 570–574. 51 Kuo A, Gulbis JM, Antcliff JF, Rahman T, Lowe ED, Zimmer J, Cuthbertson J, Ashcroft FM, Ezaki T & Doyle DA (2003) Crystal structure of the potassium channel KirBac1.1 in the closed state. Science 300, 1922–1926. 52 Pincin C, Ferrera L & Moran O (2005) Minimal sodium channel pore consisting of S5-P-S6 segments preserves intracellular pharmacology. Biochem Biophys Res Commun 334, 140–144. 53 Kang GB, Song HE, Song DW, Kim MK, Rho SH, Kim do H & Eom SH (2007) Overexpression and purifi- cation of the RyR1 pore-forming region. Protein Pept Lett 14, 742–746. 54 Chen Z, Alcayaga C, Suarez-Isla BA, O’Rourke B, Tomaselli G & Marban E (2002) A ‘‘minimal’’ sodium channel construct consisting of ligated S5-P-S6 segments Z. Yuchi et al. RHCC domain imparts extreme thermostability to the KcsA channel FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal compilation ª 2009 FEBS 6245 [...]...RHCC domain imparts extreme thermostability to the KcsA channel 55 56 57 58 59 forms a toxin-activatable ionophore J Biol Chem 277, 24653–24658 Santos JS, Grigoriev SM & Montal M (2008) Molecular template for a voltage sensor in a novel K+ channel III Functional reconstitution of a sensorless pore module from a prokaryotic Kv channel J Gen Physiol 132, 651–666 Berman HM, Westbrook J, Feng Z, Gilliland... Morais-Cabral JH, Kaufman A & MacKinnon R (2001) Chemistry of ion coordination and hydration 6246 Z Yuchi et al revealed by a K+ channel- Fab complex at 2.0 A resolution Nature 414, 43–48 Supporting information The following supplementary material is available: Doc S1 Program fithelices (in FORTRAN) and the PDB coordinates of KcsA RHCC This supplementary material can be found in the online version of... note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors FEBS Journal 276 (2009) 6236–6246 ª 2009 The Authors Journal... PE (2000) The Protein Data Bank Nucleic Acids Res 28, 235–242 Dong H, Nilsson L & Kurland CG (1996) Co-variation of tRNA abundance and codon usage in Escherichia coli at different growth rates J Mol Biol 260, 649–663 Shevchuk NA, Bryksin AV, Nusinovich YA, Cabello FC, Sutherland M & Ladisch S (2004) Construction of long DNA molecules using long PCR-based fusion of several fragments simultaneously Nucleic . An engineered right-handed coiled coil domain imparts extreme thermostability to the KcsA channel Zhiguang Yuchi 1 , Victor P. T. Pau 2 ,. left-handed coiled coil, but the bundle crossing on KcsA is a right-handed coiled coil (RHCC). We hypothesized that the splicing of two different handed coiled coil