0

the pragmatic equivalence in the translation with regards to pragmatic markers through a written discourse completion task

nghiên cứu tính tương đương ngữ dụng trong bản dịch anh-việt tác phẩm  lời thú tội của một sát thủ kinh tế  của john perkins

nghiên cứu tính tương đương ngữ dụng trong bản dịch anh-việt tác phẩm lời thú tội của một sát thủ kinh tế của john perkins

Khoa học xã hội

... as a translation principle according to which a translator seeks to translate the meaning of the original in such a way that the TL wording will trigger the same impact on the TC audience as the ... demonstrated in his way of dealing with translating pragmatic markers in the original utterances into Vietnamese ones To some extent, pragmatic markers are not as common in Vietnamese speech acts as ... study of the pragmatic equivalence in the translation with regards to pragmatic markers has shown that, although there is a high concentration of markers on action and evaluations segments in the...
  • 70
  • 488
  • 1
The application of games in teaching grammar with reference to tieng anh 10 textbook at ha trung high school, thanh hoa province

The application of games in teaching grammar with reference to tieng anh 10 textbook at ha trung high school, thanh hoa province

Thạc sĩ - Cao học

... easy to advance In general, grammar is acknowledged to be of importance in language study and in language teaching and learning in particular Grammar is acquired naturally from meaningful input and ... not only gain knowledge but be able to apply and use.that.learning Additionally, games have the advantage of allowing the students to "practice and internalize vocabulary, grammar and structures ... clear that achievement in a second language learning is influenced by attitudinal/motivational characteristics Postulating that achievement in a second language learning is promoted by an integrative...
  • 39
  • 1,577
  • 8
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Relationships between the parameters of aboveground parts and the parameters of root plates in Norway spruce with respect to soil drainage" docx

Báo cáo khoa học

... peaty fir-spruce 44 .A4 name nemoral bog Picea woods montane Alnus incana galleries Abies and Pinus woodland Abies and Pinus woodland According to the classification of the Commission of European ... viewpoint of stability against wind Acta Facultatis Forestalis Zvolen, 25: 111–127 (in Slovak) Kodrík J (1998): Knowledge gained from calamities in Slovakia – caused by mechanical abiotic factors In: ... (above the hinge point) was calculated according to the formula: Sv = (π(AWrp/2)2)/2 + Wrp × PRrp The mean values of all aboveground and belowground parameters were calculated Table Habitat classification...
  • 8
  • 326
  • 0
Báo cáo y học:

Báo cáo y học: "The short-term safety and efficacy of fluoxetine in depressed adolescents with alcohol and cannabis use disorders: a pilot randomized placebo-controlled trial" potx

Báo cáo khoa học

... superior to placebo in the amelioration of depressive symptomatology in this patient population Another hypothesis was that treatment with fluoxetine would be associated with a favorable safety and tolerability ... trained research assistants All research assistants were trained to reach an overall kappa equal to or greater than 0.85 at the item severity level In addition, diagnoses were confirmed by a ... prior to baseline Medication adherence Parents were asked to directly administer the fluoxetine to the teenagers each morning, rather than have the study medication self-administered Adherence to...
  • 13
  • 380
  • 0
A study on different types of verbal responses to questions in english conversations with reference to the vietnamese equivalents

A study on different types of verbal responses to questions in english conversations with reference to the vietnamese equivalents

Kinh tế - Quản lý

... related to each other in such a way they form a pair type They call them an adjacency pair The adjacency pair always consists of a first part and a second part The utterance of a first part immediately ... one kind of interaction Others include a boss talking to his assistant at the workplace, a doctor to patient in a clinic .The basic pattern “I speak – you speak – I speak – you speak” is what linguists ... the face – threatening act Therefore, there are some factors affecting to this calculation: speaker’s estimates of the social distance assumed to separate speaker and hearer, the relative social...
  • 68
  • 430
  • 3
Tài liệu In the know - Using information to make better decisions: a discussion paper docx

Tài liệu In the know - Using information to make better decisions: a discussion paper docx

Kế toán - Kiểm toán

... alone The seminar took place in March 2007, and the roles indicated are those occupied by the individuals at the time of the seminar Adrian Barker, IDeA Alan Meekings, Managing Director, Landmark ... question the quality of the analysis and make more informed decisions; and c) analysing data and presenting information to add value, instead of the majority of effort being spent on gathering data and ... it Sharing data and information 50 The Local Government and Public Involvement in Health Act 2007 is intended to usher in an increase in partnership working in local areas, through local strategic...
  • 52
  • 360
  • 0
The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc

The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc

Ngân hàng - Tín dụng

... thing as coin; and as, according to the mercantile theory, coin was the same thing as capital or wealth; to increase the capital of a country, it was only necessary to lend bank-notes freely to ... 18/Richard Hildreth non-speciepaying-bank; and the opinion gradually crept in among them, that bank-notes were the same thing as coin; and that it was in the power of the Bank to manufacture money at ... increasing Within the last two or three years, this increase has been really astonishing; and although several banks and private firms have since gone into the business, the increase of capital employed...
  • 78
  • 775
  • 0
báo cáo hóa học:

báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

Toán học

... Forward CAGACAACATAAACTGCGCCTT Reverse GATACACCTCTCCACCAATGACC IL- 1a Forward TACTCGTCGGGAGGAGACGACTCT 107 bp NM_010554.4 interleukin alpha Reverse TCCTTCAGCAACACGGGCTGGT IL-1b Forward CCTTCCAGGATGAGGACATGA ... necrosis factor alpha Reverse AAGTGCATCATCGTTGTTCATACA IL-12 P35 Forward GCATGCTGGTGGCCATCGATGA Reverse GCGTGAAGCAGGATGCAGAGCT IL-12/23 P40 Forward TGTGCTCGTGGCCTGATCCACT Reverse CGCAGCCCTGATTGAAGAGCTGT ... carried out the experiments and evaluated the data DJG, BTH, and WFH participated in the design and assisted with the preparation of the manuscript All authors have read and approved the final version...
  • 8
  • 447
  • 0
báo cáo hóa học:

báo cáo hóa học:" Cadaveric and three-dimensional computed tomography study of the morphology of the scapula with reference to reversed shoulder prosthesis" pptx

Hóa học - Dầu khí

... the study and analized CT scans and cadaveric specimens and drafted the manuscript MC analized cadaveric specimens and participate in Kappa study GG analized CT scans and participate in Kappa ... craneo-caudal axis until the glenoid surface appeared as a simple line and rotating then this image through the lateral to medial axis until the inferior part of the coracoid process reach the upper part ... fits in the lateral border of the scapula leading to a more bony coverage of the screw Taking into account the coronal plane, this study demonstrates that the center of the coracoid process and the...
  • 8
  • 389
  • 0
The text doesn’t stop at the end of the page (or does it)  an exploration of how the novel form responds to digital interactivity through the cross sited novel ‘once in a lifetime

The text doesn’t stop at the end of the page (or does it) an exploration of how the novel form responds to digital interactivity through the cross sited novel ‘once in a lifetime

Tổng hợp

... more, then, at almost exactly the same time you both remember that with a slab of beer in the fridge, a pizza on the way and the Preliminary Final about to start there’s no need to say anything other ... unwashed and unshaven with a can of creamy rice in one hand, a beer in the other and a bag of salt and vinegar chips clamped between his teeth, heading back to bed and to the TV to watch yet another ... head!” That’s hard That’s all hard But not the actual break-up, that’s easy It’s the day after the break-up that’s hard, and the next day and the next and however many days after that (perhaps...
  • 317
  • 311
  • 0
Tài liệu The Insider’s Guide to PR: Chapter 4 A PR LIFE – THE LADDER, THE PAY AND THE LIFESTYLE doc

Tài liệu The Insider’s Guide to PR: Chapter 4 A PR LIFE – THE LADDER, THE PAY AND THE LIFESTYLE doc

Tiếp thị - Bán hàng

... Setting up a photocall and then seeing it in the papers the next day is a great buzz.” Laura Manley Account Executive Text 100 English Literature and PR graduate “My main function as an account ... Communications Geography graduate The most rewarding experience recently has been a client calling up overcome with emotion because you have just managed to get them into six articles in the Financial ... medical examinations 4% Help with childcare Assistance with domestic costs 3% 1% Source: Frontline Survey 2001 While it may not be all champagne and caviar as the media would like to portray, the...
  • 2
  • 641
  • 1
Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc

Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc

Tiếp thị - Bán hàng

... relating to different market sectors for a product or service For example, you can promote a barcode printer in the printing media, packaging media and food retailing media • Viral campaign: a ... communications campaign which is designed to exploit the potential of the internet to spread messages rapidly The audience is encouraged to pass a message on to all their email contacts With special ... intended to arouse interest in the main campaign which follows It is usually used in media relations • Transcript: written outline of a radio or TV broadcast about a client • Vertical media: media relating...
  • 2
  • 490
  • 0
STUDENTS’ PERCEIVED DIFFICULTIES IN READING COMPREHENSION WITH REFERENCE TO NEW TIENG ANH 10 TEXTBOOK AT NGHI LOC IV HIGH SCHOOL a SURVEY INTERVIEW STUDY

STUDENTS’ PERCEIVED DIFFICULTIES IN READING COMPREHENSION WITH REFERENCE TO NEW TIENG ANH 10 TEXTBOOK AT NGHI LOC IV HIGH SCHOOL a SURVEY INTERVIEW STUDY

Khoa học xã hội

... their reading comprehension They only read again and again in order to give the answers to the teachers’ questions or reading tasks The least difficult of all was the reading tasks Most of the students ... thing for many people Learning English means learning four related skills: listening, speaking, reading and writing In teaching and learning English as a foreign language in Vietnam, reading has ... the reason the students can not read adequately in English is that they cannot read adequately in the native language The interaction between first language and second language reading ability...
  • 55
  • 1,014
  • 3
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

Báo cáo khoa học

... support the idea that Rac and Unkempt can translocate in the nuclear compartment and activate BAF60b ubiquitination; how these processes are co-ordinated remains to be analysed Discussion Although the ... activated Rac was also maintained in the mutant (Fig 3A) Analysis of UNK-fl ubiquitination led to similar observations, as shown in Fig 3B: UNK-fl ubiquitination was found to be inhibited by Rac1N17 ... Crabtree GR (2002) Nuclear actin and actin-related proteins in chromatin remodeling Annu Rev Biochem 71, 755–781 de la Serna IL, Ohkawa Y & Imbalzano AN (2006) Chromatin remodelling in mammalian...
  • 12
  • 432
  • 0
PRINCIPLES FOR EVALUATING HEALTH RISKS IN CHILDREN ASSOCIATED WITH EXPOSURE TO CHEMICALS doc

PRINCIPLES FOR EVALUATING HEALTH RISKS IN CHILDREN ASSOCIATED WITH EXPOSURE TO CHEMICALS doc

Sức khỏe trẻ em

... an increasing threat to children’s health These include exposure to natural or human-made toxic substances in air, water, soil, and the food-chain, inadequate toxic waste disposal, injuries and ... protein, and minerals than adult bones The chemical maturation of bone, as evidenced by a decrease in the percentage of water and an increase in calcification, takes place after one to two years ... urbanization, and intensified agriculture, along with increasing patterns of unsustainable consumption and environmental degradation, have released large amounts of toxic substances into the air, water,...
  • 351
  • 622
  • 0
The accidental creative  how to be brilliant at a moment s notice portfolio   todd henry

The accidental creative how to be brilliant at a moment s notice portfolio todd henry

Kỹ năng tư duy

... significantly affecting the overall value they created as a team They were allowing a few minor improvements at the last minute to affect their larger sense of engagement as a team, and their work was ... manager into her weekly rituals to ensure that the manager was staying in touch with her process, rather than just checking in at the beginning and the end of a project These simple checkpoints ... the day we’re stuck with dirty socks Adding to this lack of understanding is the rapidly accelerating pace of work Each day we are faced with escalating expectations and a continual squeeze to...
  • 208
  • 563
  • 1
Báo cáo y học:

Báo cáo y học: " Continuing or adding IL-2 in patients treated with antiretroviral therapy (ACTG Protocol A5051, a rollover trial of ACTG Protocol A3" pps

Báo cáo khoa học

... stavudine/ didanosine/indinavir (n = 5), zidovudine/didanosine/ indinavir (n = 1), stavudine/didanosine/indinavir/ nevirapine (n = 1), stavudine/didanosine/nelfinavir (n = 3), stavudine/lamivudine/nelfinavir ... study was approved by the institutional review boards of each participating site The primary objective was to determine the long-term safety and efficacy of IL-2 in maintaining or increasing CD4 ... phase and one after a change in antiretroviral regimen One patient admitted to not taking antiretrovirals during A3 28 and was excluded from efficacy analyses, but was included for the toxicity assessment...
  • 5
  • 392
  • 0
Báo cáo y học:

Báo cáo y học: " Renal cell carcinoma metastasis to the ciliary body responds to proton beam radiotherapy: a case report" pptx

Báo cáo khoa học

... RCC: renal cell carcinoma Authors’ contributions TA analyzed and interpreted the patient data and wrote the manuscript BK helped to gather the data and write the manuscript LL was the radiation ... nucleoli Pathology findings are consistent with clear cell carcinoma, Fuhrman grade III (renal cell carcinoma metastasis) our patient underwent an uneventful cataract extraction and an intraocular lens ... presentation of metastatic renal cell carcinoma (RCC) to the ciliary body and an interesting response to proton beam radiotherapy Case presentation: We encountered a case of angle-closure glaucoma as...
  • 5
  • 440
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25