the osteoclast as a cell source of cytokines involved in osteoclastic resorption
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... patient-controlled analgesia pumps The OAAI ignores clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal ... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked increase in the cesarean delivery rate We propose a new workload-driven ... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data...
- 14
- 610
- 0
Báo cáo y học: "Genome-wide analysis of the diatom cell cycle unveils a novel type of cyclins involved in environmental signaling" pptx
... points, an increasing enrichment of 4C cells can be observed because of a blockage of the cells at metaphase Asterisk marks the apparently lower proportion of 2C cells after a 20-h dark treatment ... Cryptosporidium hominis; Crypa, Cryptosporidium parvum; Plafa, Plasmodium falciparum; Playo, Plasmodium yoelii yoelii; Thean, Theileria annulata; Thepa, Theileria parva; Parte, Paramecium tetraurelia, Tetth, ... images of a dark-arrested cell (upper panel) showing a single parietal chloroplast and a cell after 12 h illumination (lower panel) showing divided and translocated daughter chloroplasts Red, autofluorescence...
- 19
- 452
- 0
Báo cáo y học: "Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: a case report" pot
... type and extravasation of the mucinous Umbilical endometriosis: endometriotic glands with metaplasia of the mucinous type and extravasation of the mucinous secretion into the adjacent stroma Majority ... presence of endometriotic glands with mucinous type metaplasia and extravasation of the mucinous secretion into the adjacent stroma (Figure 1) No epithelial atypia was seen and the excision appeared ... concealed by adhesions excision and was involved in editing the manuscript All authors read and approved the final manuscript Histological findings are characterized by irregular glandular lumina embedded...
- 3
- 383
- 0
Báo cáo y học: " Tracheal agenesis as a rare cause of difficult intubation in a newborn with respiratory distress: a case report" pdf
... between the arytenoids, as well as associated congenital anomalies Good oxygenation may be maintained with bag-mask ventilation or esophageal intubation The diagnosis is made through neck exploration ... examination was performed to evaluate airway patency During the neck exploration, it was noted that the larynx ended blindly at the cricoid level (Figure 1), while the trachea was absent A laryngoscopic ... support was discontinued with the agreement of the parents, and the baby was allowed to die At the end of the surgical procedure, an endotracheal tube was inserted into the esophagus and effective...
- 3
- 399
- 0
Báo cáo y học: " Transcriptome profiling of primary murine monocytes, lung macrophages and lung dendritic cells reveals a distinct expression of genes involved in cell trafficking" pot
... 5'-CTG GAA CAC GTT TCT GAA AGA AT-3' (r); beta-actin, 5'-ACC CTA AGG CCA ACC GTG A- 3' (f), 5'CAG AGG CATA CAG GGA CAG CA-3' (r); GapDH, 5'TGG TGA AGG TCG GTG TGA AC-3' (f), 5'-TGA ATT TGC CGT GAG ... Itga4, 5'-TTC GGA AAA ATG GAA AGT GG-3' (f), 5'-AAC TTT TGG GTG TGG CTC TG-3' (r); Itgae, 5'-TGG CTC TCA ATT ATC CCA GAA3' (f), 5'-CAT GAC CAG GAC AGA AGC AA-3' (r); Adamts2, 5'-AGT GGG CCC TGA ... (interstitial macrophages, iMϕ) and in the alveolar airspace (resident alveolar macrophages, rAM), where they function as major sentinel and phagocytic population of the lung for invading pathogens...
- 16
- 320
- 0
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones
... [W/m3] The gas phase and the liquid phase are assumed to be in thermodynamic equilibrium, i.e., the liquid water and the gas phase are at the same temperature The potential distribution in the gas ... (quadratic) The values of the electrochemical transport parameters for the base case operating conditions are taken from ref [10] and are listed in Table The geometric and the base case operating ... temperature peak appears in the cathode catalyst layer, implying that major heat generation takes place in the region In general, the temperature at the cathode side is higher than that at the anode...
- 18
- 549
- 0
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
... complex and the initiation of intracellular signaling events regulating oxidase assembly and activation has been described [31,32] The NADPH oxidase The phagocytic NADPH oxidase plays an essential ... interaction of A with microglia and the assembly of the active microglial NADPH oxidase maybe largely responsible for the oxidative damage observed in the AD brain Astrocytes and the NADPH oxidase Astrocytes ... http://www.jneuroinflammation.com/content/3/1/30 kinases Lyn and Fyn as well as the tyrosine kinase Syk [30,32,52] Activation of these signaling cascades are linked to the synthesis and secretion of proinflammatory...
- 12
- 413
- 0
Food as a Source of Dioxin Exposure in the Residents of Bien Hoa City, Vietnam
... was collected in 2002 from the Bien Hoa market, the Bien Hung market, the Bien Hung Lake, and at the nearby air base where Agent Orange was stored All are within several kilometers of each other ... 0.95 68 Channa Striata—snakehead Anabas Testudineus— climbing perch Clarias Fuscus— catfish Clarias Fuscus— catfish Ostechilus Hasselti— carp TABLE Comparison of Highest Dioxin TEQ Levels in ppt, ... who assisted in these studies in a number of ways from being donors to assisting in hospitals, markets, and farms In addition, the authors thank and wish to honor the memory of the late professor...
- 8
- 513
- 1
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... environment variables The Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with increase in risk of disability pension The SAS procedure ... 1990 as a continuous variable showed a clear trend of increase in disability pension risk with increase in absence days/yr A 10-day increase in absence days per annum (scale score ranging from ... on data from the Danish Ministry of Employment, the Ministry of Social Affairs and the Ministry of Education DWECS was conducted in 1990, and featured a random sample drawn from the Central Population...
- 6
- 578
- 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
... efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release glucoronic acids, acetyl xylan esterases that hydrolyze acetylester ... Trichoderma reesei are used to produce most commercial cellulase mixtures that also contain some β-glucosidase activity Cellulases consist of a catalytic domain and a cellulose binding domain (CBD) that ... separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital and operating costs and minimizes degradation reactions The residual phosphoric...
- 20
- 437
- 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt
... respiratory cilia in the rabbit and pig [185]; and hydrogen cyanide, acrolein, and acetaldehyde inhibited ciliary beating in the clam [182] Using an in vitro infundibular bioassay, the individual ... isoquinoline which had a picomolar LOAEL in the ciliary beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of ... femtomolar range (Table 1) In general, if a chemical were inhibitory, it acted in all three bioassays, although the potency and efficacy for a particular chemical varied among the assays Some of the...
- 17
- 733
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS The oligonucleotide ... GDP, across the nuclear envelope regulates the binding and release of cargo by transport factors RanGTP is abundant in the nucleus as a result of the activity of RCC1, a guanine nucleotide exchange...
- 12
- 454
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... and Site-3 binding activity in all fractions was monitored by the in vitro DNase I protection assay The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide ... experimental point was determined in triplicate The NF1 family of proteins plays a wide role in replication of several viral DNAs and in transcription of many cellular genes A significant role...
- 8
- 426
- 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx
... whereas the ACS was offered in a variety of languages Asians and Hispanics are the two groups that contribute most to racial and ethnic intermarriage in the US (Qian and Lichter 2007) Among Asians ... is the partnership rate of heterosexual women of a certain age a reasonable measure of the lack of availability of partners for single men of the same age group (and vice-versa)? Despite the ... Bossard 1932) Gale and Shapley originally imagined mate search as analogous to applying to college The weakness of the analogy is that the set of American colleges is relatively small and stable,...
- 50
- 470
- 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
... in ERK cascade O Maıga et al ¨ Introduction The mitogen-activated protein kinases (MAPKs) are a family of S ⁄ T-protein kinases, including p38, c-Jun N-terminal kinase and extracellular signal-responsive ... encoding the hDlg PDZ1 and PDZ2 domains as bait in a yeast two-hybrid screening assay of a human aorta cDNA library Interestingly, two independent clones were identified as containing the C-terminal ... of the primary antibody was carried out using an appropriate biotinylated secondary antibody (Vectastain ABC complex; Vector Laboratories, Inc., Burlingame, CA, USA) and staining was obtained...
- 11
- 419
- 0
Báo cáo khoa học: The consensus motif for N-myristoylation of plant proteins in a wheat germ cell-free translation system ppt
... yielding pTA2–AGG1 The coding region for mature AGG1 fused with a DNA fragment encoding the myristoylation motif Met-Gly-Ala-Ala-Ala-Ala-Ala-AlaAla-Ala or Met-Gly-Ala-Ala-Ala-Ser-Ala-Ala-Ala-Ala ... myristoylation motifs Met-Gly-Xaa-Ala-AlaAla-Ala-Ala-Ala-Ala (Myr–AGG1-3X 6A) or Met-Gly-Xaa-Ala-Ala-Ser-Ala-Ala-Ala-Ala (Myr–AGG1-3X6S) (B, C) Each of the 20 mRNAs corresponding to Myr–AGG1-3X 6A (B) ... tryptic N-terminal peptide ARF 1A1 c MGLSFGK GLSFGKa Myristate–GLSFGKb Myr–GFP MGAAASAAAAVSK GAAASAAAAVSKa Myristate–GAAASAAAAVSKb a Calculated mass (Da) Myristic acid (+) Myristic acid ()) 738.9...
- 12
- 473
- 0
A Portrait of the Artist as a Young Man ppt
... then the next term and then vacation again and then again another term and then again the vacation It was like a train going in and out of tunnels and that was like the noise of the boys eating in ... noise of curtain-rings running back along the rods, of water being splashed in the basins There was a noise of rising and dressing and washing in the dormitory: a noise of clapping of hands as the ... the smell of the old peasants who knelt at the back of the chapel at Sunday mass That was a smell of air and rain and turf and corduroy But they were very holy peasants They breathed behind him...
- 317
- 341
- 0
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx
... 2006 at both Binh Phuoc training centre and Dong Nai training centre The final training of the first year TOT training took place in May 2007 at both Dong Nai and Binh Phuoc training centres Trainees ... farmers who participated in this training Therefore, the course of training had already built up trainees’ confidence in using weaver ants as a major component of the cashew IPM program At the ... were the crematogaster ant, Crematogaster sp with large numbers occupying one third of the trees in the IPM plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining...
- 10
- 551
- 1
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf
... TOT training, and they include the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, the ... TOT training, and they includes the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, the ... large numbers occupying one third of the trees in the IPM plot, and the small black ant, Tapinoma melanocephalum, that was abundant on the remaining trees of the plot Baiting of competitive ant...
- 12
- 531
- 1
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25