the motion of a fluid through a slightly curved tube the dean problem
ON WEAK SOLUTIONS OF THE EQUATIONS OF MOTION OF A VISCOELASTIC MEDIUM WITH VARIABLE BOUNDARY V. G. pptx
... approximation of the equation in a weak sense and application of the topological theory of a degree that allows to establish the existence of solutions on the basis of a priori estimates and statements ... statements about passage to the limit Note that in the case of a not cylindrical domain (with respect to t) the necessary spaces of differentiable functions cannot be regarded as spaces of functions of ... prove a similar result for a domain with changing boundary The article is organized as follows We need a number of auxiliary results about functional spaces for the formulation of the basic results...
- 31
- 266
- 0
Báo cáo hóa học: " Research Article Hierarchical Convergence of a Double-Net Algorithm for Equilibrium Problems and Variational Inequality Problems" ppt
... problem and equilibrium problem 1.12 includes the variational inequality problem studied by Yamada and Ogura 10 , mathematical program studied by Luo et al 11 , hierarchical minimization problem ... S Al-Homidan, Q H Ansari, and J.-C Yao, “An iterative scheme for equilibrium problems and fixed point problems of strict pseudo-contraction mappings,” Journal of Computational and Applied Mathematics, ... , then 1.3 reduces to Find x ∈ Fix T such that Ax, x − x ≥ 0, ∀x ∈ Fix T , 1.7 a variational inequality studied by Yamada and Ogura 10 A Example 1.3 Let A be a maximal monotone operator Taking...
- 16
- 313
- 0
Báo cáo khoa học: "Evaluation of a Bacillus stearothermophilus tube test as a screening tool for anticoccidial residues in poultry" doc
... rebmun A la te sisylana DPAR aidnI ,ragantazI ,etutitsnI hcraeseR yranireteV naidnI ,yrotarobaL airetcabocyM eht ta muidem nesneJ-nietsnewoL no deniatniam dna ]62[ stset lacimehcoib dna )gniniats ... gniraeppa dnab AND a fo )0( ecnesba ro )1( ecneserp fo sisab eht no tliub saw dna slaremun eht fo desopmoc xirtam atad A hpargotohp a no deton erew DPAR yb deniatbo snrettap gnidnab ehT )ynamreG ... sisylana )DPAR( AND cihpromylop deifilpma modnar yb sniarts )CEPA( iloc E cinegohtap naiva fo noitaitnereffiD B S nosnevS ,J najayeerpisaS ,P atoosamaR ,N iahcnropirisnahC 49-58 ,3 ,1991 lppA sdohteM...
- 7
- 323
- 0
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx
... ịt ỵ A2 expkHX;2 ịt ỵ A3 where A1 , A2 , and A3 are the fractions of the fast, slow and stable amide protons and kHX,1 and kHX,2 are the apparent exchange rate constants for the fast and slow amide ... conjugates were independent of the size of the glycan (Tables and 5, [36]) The analysis revealed that the changes in these parameters statistically correlate for both the acylation and deacylation ... Structural dynamics and serine protease catalysis Table Global energetic parameters and DebyeWaller temperature factors calculated for the protein portion of a- CT and the various lactose -a- CT conjugate...
- 17
- 531
- 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... using forward primer 5¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACTTATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢ The forward primer incorporated an NdeI site and the reverse ... of lengths equivalent to each other and to Gambeta We amplified the cDNA for cB using forward primer 5¢-ACTTATACTACTCATATGGGGAAGATCACTTTTT ACG-3¢ and reverse primer 5¢-ACTTATACTATCCTCG AGATAAAAATCCATCACCCG-3¢, ... we also amplified the cDNA for bB2 using forward primer 5¢-ACTTATACTACTCATATGCTCAACCC CAAGATCATC-3¢ and reverse primer 5¢-ACTTATAC TATCCTCGAGCCACTGCATGTCCCGG-3¢, to produce an amplicon lacking the...
- 13
- 430
- 0
Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf
... EcoRI-T7-tccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaattt-BamHI EcoRI-T7-aaaaaatccaaaaaaaatct-BamHI EcoRI-T7-tctaaaaaaatcttttaaaaaacccc-BamHI EcoRI-T7-ccccaaaaaaatttacaaaaaatc-BamHI EcoRI-T7-ccccaaaaaaattt-BamHI ... EcoRI-T7-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaa-BamHI ¨ AARS-4 ¨ AARS-L ¨ AARS-C ¨ AARS-R ¨ AARS-S Poly (A) 50 FEBS Journal 273 (2006) 5678–5690 ª 2006 The Authors Journal compilation ... All plasmids were Table Primers used to create various ARS constructs Primer Sense sequence ARS EcoRI-T7-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaa ccccaaaaaaatttacaaaaaa-BamHI EcoRI-T7-tccaaaaaaaatctaaaaaaatcttttaaaaaa...
- 13
- 466
- 0
Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx
... topological insulators have an odd number of massless Dirac cones on the surface, ensured by the Z2 topological invariant of the bulk, while graphene has twofold massless Dirac cones at the K and K valleys ... participated in establishing the physical model and developing the numerical code All authors have participated in the interpretation of the numerical results All authors read and approved the final ... shown above can be examined by the measurable quantities, the conductance G, and Fano factor F [20, 21] The ballistic conductance and Fano factor for a given Fermi energy at zero temperature are...
- 18
- 404
- 0
Báo cáo hóa học: " The effects of hypertonic fluid administration on the gene expression of inflammatory mediators in circulating leucocytes in patients with septic shock: a preliminary study" pptx
... data and hence to allow the use of repeated measures analysis of variance (ANOVA) “Treatment-group” was the between-subject variable, and “time” was the withinsubject variable The “time×treatment-group” ... of Tris/Mn RNA buffer and μl of Promega DNase solution was added and the sample incubated, shaking at 37°C for 30 to digest any contaminating DNA A total of μl of Stop solution was added, heated, ... new tube and an equal volume of 100% Analar Isopropanol added and mixed by invertion, van Haren et al Annals of Intensive Care 2011, 1:44 http://www.annalsofintensivecare.com/content/1/1/44 Page...
- 8
- 515
- 0
Báo cáo khoa học: "Intrafraction motion of the prostate during an IMRT session: a fiducial-based 3D measurement with " pdf
... Prostate motion relatively to the pelvic bone structures was calculated on a patient-to-patient basis Overall mean value (mv) and overall standard deviation (SD) and median value of all translational ... intensity-modulated radiotherapy of the female breast and the parasternal lymph nodes Am J Clin Oncol 2003, 26:e136-143 Huang E, Dong L, Chandra A, Kuban DA, Rosen II, Evans A, Pollack A: Intrafraction ... have comprised a large extent of manual matching Qualitative evaluation, however, showed that the deformational component was minor in comparison to translation and tilt and the evaluation of...
- 8
- 384
- 0
Báo cáo y học: "Catheterization and embolization of a replaced left hepatic artery via the right gastric artery through the anastomosis: a case report" pdf
... article as: Miyazaki et al.: Catheterization and embolization of a replaced left hepatic artery via the right gastric artery through the anastomosis: a case report Journal of Medical Case Reports ... Tanaka T, Arai Y, Inaba Y, Matsueda K, Aramaki T, Takeuchi Y, Kichikawa K: Radiologic placement of side-hole catheter with tip fixation for hepatic arterial infusion chemotherapy J Vasc Interv Radiol ... mesenteric artery and a replaced LHA arising from an LGA are the most common hepatic artery variants [1] When a replaced LHA arising from an LGA is present, the proximal portion of the replaced LHA should...
- 4
- 291
- 1
Báo cáo y học: "Evolving the theory and praxis of knowledge translation through social interaction: a social phenomenological study" doc
... organizational change in health and social services Journal of Organizational Change Management 2006, 19(2):119-135 Argyris C: Reasoning, learning and action: Individual and organizational San ... observations of meeting contexts, group dynamics, or other details of nuances and subtleties that might facilitate interpretive analysis of the audio-taped transcriptions Data analysis All transcribed ... the PARiSH framework adds 'how to' to the 'what' of KT theory and praxis The PAKT model encapsulates a more sophisticated, active, and integrated notion of context [54] and a shared enactment of...
- 14
- 420
- 0
Báo cáo khoa hoc:" Successful removal of a telephone cable, a foreign body through the urethra into the bladder: a case report" pps
... Authors' contributions RT was involved in the case directly, performed the literature search and helped draft part of the manuscript AH was involved in the literature review and drafting of the ... Vareal Salgado M, Fernandez Garcia L: Urethral foreign bodies Apropos cases [Article inSpanish] Arch Esp Urol 1999, 52(1):74-6 Gonzalgo ML, Chan DY: Endoscopic basket extraction of a urethral ... of the manuscript SM was involved directly in the treatment of the patient and assisted in the preparation of the manuscript Consent The patient's informed written consent has been obtained for...
- 3
- 286
- 0
báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx
... ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat 781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaa 61 ... L Q L Q L E L E aagcatcttcatgatcaattagagatgcaaatgaatttacaaaagctgattgaggatcaa K H L H D Q L E M Q M N L Q K L I E D Q gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataatttgag G K Q V K M M ... F V E C V N cgccttggaggttctgagaaggcaacaccaaaggcgatactgaaactgatgaaatcgaaa R L G G S E K A T P K A I L K L M K S K gaattgagtatcctacaagtaaaaagtcatttgcagaaatatcgatccgagaagctcata E L S I L Q V K S...
- 14
- 400
- 0
Báo cáo y học: "The infectivity and pathogenicity of a foot-and-mouth disease virus persistent infection strain from oesophageal-pharyngeal fluid of a Chinese cattle in 2010" potx
... appeared clinic symptom The dose and quantity of the inoculated virus was the same These data demonstrated that the virulence of the persistent infection strain O/CHN/2010/33-OP was lower than ... Foot-and-Mouth Disease Reference Laboratory of China, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu 730046, China Aff2 Xinjiang Animal health supervision ... carrier of cattle [3] Therefore, persistent infected animals are a dangerous factor to cause FMD outbreak In recent years, Some Asian countries such as China, Mongolia, Korea, Japan populated FMD...
- 11
- 321
- 0
Báo cáo y học: "Recovery of fitness of a live attenuated simian immunodeficiency virus through compensation in both the coding and non-coding regions of the viral genome" pot
... RNA Figure 3B shows that the addition of the A4 23G mutation to the SD2 backbone increased vRNA encapsidation levels but appeared to have little impact on the amount of packaged, mature vRNA dimer ... cells) were transfected into 293T cells Mutant viral RNA was extracted from aliquots of the supernatants of these transfections and normalized on the basis of p27-CA To assess relative packaging efficiency, ... following standard protocols (Roche, Indianapolis, IN, USA) The denaturing Northern analysis of cellular RNA was also conducted in parallel RNA extraction was carried out in similar fashion to that described...
- 10
- 213
- 0
Báo cáo y học: "Propagation of kinetic uncertainties through a canonical topology of the TLR4 signaling" pps
... network) are also varied Total parameter variation The total parameter variation estimator provides a quantitative notion of the order of magnitude in the variation of a perturbed parameter configuration ... mRNA degradation rates (see Additional file for a detailed description of these parameters and their assigned range of values) According to the above mathematical expressions, the state space ... perturbations targeting individual parameters The KS test provides the means for evaluating the cumulative frequency of the observations (parameter values) as a function of class, and calculate the maximum...
- 32
- 141
- 0
Báo cáo y học: "Long-term outcome of a randomized controlled universal prevention trial through a positive parenting program: is it worth the effort" pot
... substantial contributions to the acquisition of data and supervision of data collection as well as to analyzing the behavior observation data All authors read and approved the final manuscript Acknowledgements ... two-parentand single-parent households Furthermore, this way of analyzing data allows for the direct comparison of the outcome for mothers and fathers in the same families Measures Procedure The assessments ... conduct problems and make these interventions broadly available to parents The Triple P system is widely spread internationally and has been well evaluated A Page of 14 recent meta-analysis by Nowak...
- 14
- 241
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25