the lim inf and lim sup of a sequence
Retrieval of the source location and mechanical descriptors of a hysteretically-damped solid occupying a half space by full wave inversion of the the response signal on its boundary doc
... when the values of all the parameters of the set P are strictly equal to their counterparts in the set p and the values of all the parameters of the set N are strictly equal to their counterparts ... physical/geometrical and numerical parameters to which the model appeals The physical/geometrical parameters of the SM form none other than the set p, whereas the numerical parameters of the SM can ... 1992), has a corollary (Wirgin, 2004): when the values of all the parameters, except PK of the set P are strictly equal to their counterparts in the set p and the values of all the parameters of the...
- 26
- 467
- 0
DELIVERING HEALTH EDUCATION VIA THE WEB: DESIGN AND FORMATIVE EVALUATION OF A DISCOURSE-BASED LEARNING ENVIRONMENT pot
... appropriateness of graphics and icons, clarity and quality of information, suitability of external links, and clarity and perceived motivating and discussion promoting characteristics of the learning ... interactivity; and, availability of Australian and international sources Annotations were provided for each link to inform the student about the topics and contents of the site The Activity Centre was designed ... Web learning environment These icons were replicated at the top left corner of the corresponding page and again in a navigational menu bar that appears at the bottom of each page allowing the student...
- 12
- 411
- 0
Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf
... immunoassays (ELISA, Dot Blot, Neurotoxicity assay) He participated in analyses and interpretation of data He drafted the manuscript AG has been involved in analyses and interpretation of data and ... mentored primary authors, helped to analyze the data and make conclusions, prepared final version of manuscript All authors read and approved the final manuscript Page 13 of 15 Declaration of competing ... laboratories Another important aspect of a dual vaccine is related to the safety issues Since the majority of people including children and elderly are vaccinated with influenza vaccine yearly and...
- 15
- 431
- 0
EQUALIZING DAYLIGHT DISTRIBUTION IN BUILDINGS OPTIMIZATION OF THE INNER REFLECTOR AND BOTTOM PANEL OF a LIGHT DUCT
... Ivan Sutherland’s PhD thesis in 1963, parametric change and the representation which could adapt to the change is one of the core functions (Sutherland, 1980) Nowadays, a parametric model can ... opening (b) Backward ray tracing of opening (c) Forward ray tracing of table (d) Backward ray tracing of table 118 xi List of Tables Table 4.1: Data types required for the ports of the RayTracer ... reasonably fast and thousands of generations are exploded and evaluated by evolution algorithm The details of the process including the modeling details, the evaluation method and evolution algorithm...
- 141
- 940
- 0
Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx
... observation, as well by the peasant as by the man of erudition The fact, that man, "made of one blood, can dwell" in all the varieties of climate, "on the face of the whole earth," and can sustain himself, ... gratification of appetites, regardless of others, is the strongest feature of barbarism We see then, even as a dictate of refinement, that the use of tobacco should be abandoned; and it has been abandoned ... charge of the patient She was much emaciated The discharge from the bowels continued unabated, and was often attended with severe pain and great prostration of strength The salivation was accompanied...
- 29
- 586
- 0
Tài liệu Báo cáo khoa học: Solution structure of hirsutellin A – new insights into the active site and interacting interfaces of ribotoxins docx
... hirsutellin A A Viegas et al involvement of a catalytic pair constituted by an acid and a base on each side of the hydrolyzed bond [16] E96 and H137 in a- sarcin and E58 and H92 in RNase T1 act as the base ... Pozo A & Gavilanes JG (2001) RNase U2 and alphasarcin: a study of relationships Meth Enzymol 341, 335–351 ´ Lacadena J, Alvarez-Garcı´ a E, Carreras-Sangra N, ´ Herrero-Galan E, Alegre-Cebollada ... accessible surface area of the corresponding side chains very low Desolvation of the charged groups should affect their pKa values, increasing the pKa of carboxylates and decreasing the pKa of...
- 10
- 607
- 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx
... more antibacterial than dermaseptin (34 amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and ... explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial activity against Gram-negative ... synthesized chemically and preliminary studies on antibacterial activity showed that the quality and biological activity of native and synthesized toxins were identical Due to a shortage of native...
- 12
- 598
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories The multiracial population of Malaysia ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges...
- 88
- 581
- 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx
... cycles of 94 °C for 20 s, 52 °C for 20 s and 70 °C for min; then a final extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) ... and sequenced as above The fulllength cDNA of lac1 was then generated by 3¢-RACE using the primer 5¢-TCTCAACCGTCGACAGCAG TGTTCGTG-3¢ designed from the sequence of the extreme 5¢ end of lac1 The ... developmental cycle: early, middle and late substrate colonization stages (4, and 12 days); pinhead stage (day 14), button stage (day 18), egg stage (day 21), elongation stage (day 22) and mature stage...
- 11
- 703
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... PP2500 and ANKHD1 variant In this study we focus on the biochemical and functional characterization of the novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S ... AAAGC-3¢ and reverse 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3¢ Cell survival and apoptosis...
- 12
- 561
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... in the sequence of the C-terminal heptapeptide of NKA, another peptide of the tachykinin family that binds the NK-1 and NK-2 receptors [HGly8] NKA(4–10) is as potent as NKA and [Ala8]NKA on rabbit ... between [Ala9]SP and [Gly9]SP on the one hand, and [b2-HAla9]SP and [HGly9]SP on the other hand Indeed, the higher pharmacological potency of [b2-HAla9]SP compared to [HGly9]SP suggests that the methyl ... similar results All assays were done in parallel experiments with control at t ¼ for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact...
- 11
- 860
- 0
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf
... induced against the linear isoform of the HNE peptide Although the binding pattern may be somewhat blurred by these antibodies and by the polyclonal nature of the sera, the importance of residues ... bonds stabilizes a conformational epitope of the apical membrane antigen-1 of Plasmodium falciparum [27] Although the sequential epitope of VP1 of foot and mouth disease does not contain intramolecular ... microtiter plates increased at high pH (Fig 3A) Under the basic conditions optimal for coating, the HNE peptide was at least partially oxidized and the signal of the reduced species increased as a result...
- 13
- 492
- 0
The Do’s and Don’ts of Entering a Relationship
... attracting them, like I said that’s for another book There are certain do’s and don’ts that can make or break a relationship that many people just don’t realise The repercussions of actions and ... head all of the time is come clean ASAP You’re going to have to come clean as soon as you can and accept that whatever happens is always going to be your fault Your partner may leave you, and ... and starting again Arguments happen and you need to deal with that What makes the relationship work is how these arguments actually affect you both If you can accept them as arguments and get...
- 86
- 286
- 0
The Design and Implementation of a Sequence Database System * docx
... PIVceeding of the ACM SIGMOD Conference on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database.In Proceedings of the International Conference ... component) supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational ... up the dimensions) There are also severalopen researchissuesin the design of systemsbasedon the E-ADT paradigm, and in extensions of the paradigm to handle optimizations that spandata types Acknowledgements...
- 12
- 568
- 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf
... indicated that the b-aryl ether cleavage enzyme accumulated and was stable in the extracellular fraction The extracellular fraction of 2BW-1 generated abundant GG and 4MU from GOU by cleaving the ... radiolabeled water was not observed with guaiacol It was clear that the b-aryl ether cleavage enzyme catalyzed the addition of two molecules of H2O (at Ca and Cb positions) and cleavage the b-aryl ... 12 Masai, E., Katayama, Y., Nishikawa, S., Yamasaki, M., Morohoshi, N & Haraguchi, T (1989) Detection and localization of a new enzyme catalyzing the beta-aryl ether cleavage in the soil bacterium...
- 10
- 670
- 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... 5¢-RACE and the two alternate 3¢-ends of exon 12 were deduced by 3¢-RACE, and are delineated by the full-length cDNA clones, GT-cDNA1 and GT-cDNA The two putative polyadenylation sites (ATTAAA) are ... genomic sequence revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from the poly (A) of GT-cDNA2...
- 8
- 465
- 0
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt
... enzymes, such as xylanase and mannanase P hilaris cellulase was proposed to belong to GHF and the signature sequence of GHF was found in the aminoacid sequence (Fig 3) GHF is the largest GHF and includes ... the deduced amino-acid sequence The ORF consisted of a protein of 325 amino acids The molecular mass of P hilaris Fig Comparison of amino-acid sequences for potential catalytic proton donor and ... was conserved in the deduced amino-acid sequence of P hilaris cellulase (Fig 3) The conserved potential proton donor and Analysis of N-terminal amino-acid sequence, cDNA sequence and deduced amino-acid...
- 6
- 361
- 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx
... at the beginning of the chromatogram (peaks 1*, 2*, 3*, and in Fig 5A) For peaks and 2, molecular masses of 2025 and 2041 Da were obtained as before (Table 1) The molecular mass of peak 3* was ... additional 162 Da) in the material of peak (Fig 3A, B) and both galactose and fucose (the additional 146 Da) residues in peak (the data for the Ru strain are shown in Fig 4) These results correlated closely ... for films of the intact and trypsin-treated Ru PVX and the intact ST mutant preparations To compare the waterabsorbing capacity of the different PVX variants, we measured their FTIR spectra in dry...
- 10
- 398
- 0
Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt
... CCT were quantitated by the use of a phosphorimager and expressed as a fraction of the maximum amount of bound labeled tubulin and plotted as a function of the ratio of labeled : unlabeled tubulin ... immediately after dilution or after h of incubation at 30 °C b-T1 behaviour was similar to that of b5 tubulin [33] At early times, the bulk of the radioactivity migrates as a broad band with a slower ... nondenaturing PAGE; the ratios of labeled to unlabeled tubulins are indicated on the top of each lane and the arrow indicates the position of the b-tubulin/CCT complex (B) The amounts of the tubulin...
- 7
- 500
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ