the black circle symbol in the destination movie left imports the kungfumasterid shared symbol from the runtimesharesource swf at runtime as a result the shared symbol appears in the destination swf right
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... lm Taxol did not cause increase of acetylated tubulin (Fig 1E), indicating that the acetylation state of tubulin depends mainly on the relative activities of the acetylating and deacetylating...
- 14
- 416
- 0
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
... complex and the initiation of intracellular signaling events regulating oxidase assembly and activation has been described [31,32] The NADPH oxidase The phagocytic NADPH oxidase plays an essential ... surface receptors initiates a tyrosine kinase-based signaling cascade Tyrosine phosphorylation of the Vav-GEF results in the activation of downstream Rac1 GTPase Recently, we have demonstrated ... http://www.jneuroinflammation.com/content/3/1/30 kinases Lyn and Fyn as well as the tyrosine kinase Syk [30,32,52] Activation of these signaling cascades are linked to the synthesis and secretion of proinflammatory...
- 12
- 413
- 0
Báo cáo khoa học: "Bioavailability of the amino acid-attached prodrug as a new anti-HIV agent in rats" pdf
... htob erusaem ot desu saw )ASU ,tneligA( nevo nmuloc a dna ,)ASU ,tneligA( relpmasotua na ,)ASU ,tneligA( ressaged a ,)ASU ,tneligA( pmup a ,)ASU ,tneligA( rotceted VU yarra edoidotohp a gnidulcni ... erew selpmas laireS )%2.0 noitartnecnoc lanif( tnalugaocitna na sa ATDE gniniatnoc ebut citsalp a otni )ASU ,nosnikciD-notceB( reniatucav a gnisu niev liat eht morf detcelloc erew selpmas doolb ... gk/gm 02 fo noitartsinimda suonevartni retfa 2050-PV fo sretemarap citenikocamrahP elba T 562 star ni tnega VIH-itna wen a sa gurdorp dehcatta-dica onima eht fo ytilibaliavaoiB nwohs sah ,siht ot...
- 5
- 211
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
... was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an exploratory ... practice and could not accurately be attributed to individual primary care doctors Statistical analysis In all statistical analyses, the three targeted tests are reported and analysed separately ... between intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking...
- 9
- 367
- 0
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt
... 3’) Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT Annealing temperature (°C) 60 Reverse: GTGTGGATGGGGTACCTGAC COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and ... CCTGGCAGGTGAGTTTGCAT ADAMTS- Forward: CCTGGCAGGTGAGTTTGCAT 60 Reverse: GGAGAACATATGGTCCCAACGT GAPDH Forward: ACTCTGGCAAAGTGGATG 60 Reverse: TCCTGGAAGATGGTGATG expression of the Link N-treated ... performed the biochemical analysis and statistical analysis, and was involved in preparation of the manuscript RP, TY and AH performed data acquisition and statistical analysis PJR participated in the...
- 9
- 402
- 0
A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2
... i ABSTRACT Since the application of Communicative Language Teaching approach to EFL teaching, process writing and collaborative learning have been greatly emphasized as typical features of teaching ... collect the data needed in “quantitative form” The study was qualitative-oriented with the use of content analysis As it was remarked, “data obtained from qualitative research is usually detailed, ... objectives to be achieved there is a combination of both formative and summative assessment as in the following table: TASKS Formative Attendance & Participation Writing Portfolios - 22 - GRADE ALLOTMENT...
- 65
- 893
- 7
INTERLEUKIN 6 RELEASE FROM t98g HUMAN GLIAL CELL LINE AS a PREDICTIVE MARKER FOR CHRONIC PAIN, AND THE CHARACTERIZATION OF SUBSTANCE(S) INVOLVED IN PAIN
... important role in modulating chronic pain Amino acids and prostaglandins are two such examples 1.2.1.1 Amino Acids Glutamate is the main excitatory amino acid in the mammalian CNS Its interaction ... pain due to osteoarthritis (Sethuraman et al., 2007) Amino acids including aspartate, arginine, asparagine, tyrosine and valine were also demonstrated to be elevated in the CSF of chronic pain ... changing Pathological pain is classically viewed as being mediated solely by neurons, but there is mounting evidence that glial cells also play a part in exaggerated pain states created by inflammation...
- 136
- 600
- 0
Speaking in two tongues an ethnographic investigation of the literacy practices of english as a foreign
... language and Cambodian young adult learners’ identity List of Abbreviations ALA Australian Leadership Award ASEAN Association of Southeast Asian Nations CELT Cambodian English Language Training ... camps in Thailand were repatriated In the camps, English was a language for international communication The repatriation of the refugees was in a way an influx of English speaking Cambodians to Cambodia ... English as a singular form, and the view of teachers as masters and students as disciples In 2010, I left Cambodia for Australia as a recipient of a prestigious Australia Leadership Award (ALA) As an...
- 253
- 381
- 0
Itzhak Perlman: a citizen of the word, with his violin as a passport
... For a few moments, close your eyes and imagine you are in a theater In front of us is the stage To the left, Itzhak Perlman sits in his chair, near the conductor The orchestra has already played ... the first two movements of Beethoven's D Major Concerto The violin leads us to the third, and immediately announces the major theme Listen now as Itzhak Perlman performs with the Philharmonia ... Orchestra of London Carlo Maria Giulini is the conductor (MUSIC) Our program was written and produced by Paul Thompson I’m Steve Ember Join us again next week for the VOA Special English program THIS...
- 2
- 400
- 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
... provide an attractive explanation for many of the features of aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the ... implying that either cells autophagocytose defective mitochondria at a lower rate than normal mitochondria, or that these damaged mitochondria have a replicative advantage Decreased autophagocytosis ... (2000) Autophagy as a regulated pathway of cellular degradation Science 290, 1717–1721 23 Marzella, L., Ahlberg, J & Glaumann, H (1981) Autophagy, heterophagy, microautophagy and crinophagy as the...
- 7
- 444
- 0
Evaluating the Executive Director Your Role As a Board Member doc
... out a self-evaluation form that contains goals from the previous year’s evaluation The goals are a combination of organizational performance and individual improvement goals The chair then contacts ... managing the organization to produce the results the board desires It can be very easy explain away performance problems that are genuinely hindering the organization In organizations with a ... performance, identify both the incentives and the criteria for measuring successful attainment of goals many months ahead of the evaluation Take care that the total compensation (including incentives)...
- 31
- 284
- 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... heart failure found that the waltz was just as good as traditional aerobic exercise and that people were happier, which was demonstrated by increases in a measure of quality of life, and greater ... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... questionnaire what they liked best and least about the program They greatly appreciated the camaraderie and socialization engendered by the program Being able to meet others with PD and their caregivers...
- 19
- 648
- 0
The leg-to-body ratio as a human aesthetic criterion pdf
... suggesting that both male and female participants were rating the images in the same manner Discussion The results of this investigation are consistent with the idea that the LBR plays a role in ... Results A Â Â repeated measure analysis of variance (ANOVA) with 71 participants was computed The sex of the stimuli and LBR were treated as within subjects factors, and participant gender was ... such things as the mass media In addition, some evolutionary psychological theories predict local variation in aesthetic preferences as a result of calibration to locally prevailing ranges or...
- 7
- 408
- 0
Báo cáo khoa học: "Evaluation of the fullerene compound DF-1 as a radiation protector" doc
... and mice were irradiated with the indicated total body doses A 137Cs Gamma Cell 40 (Nordion International, Kanata, Ontario, Canada) was used as the ionizing radiation source The irradiator was ... molecular work, and assisted in the animal studies AS and AT performed the animal work and assisted in drafting the manuscript EC, MU, and WS participated in the design of the study and assisted in ... the total number of γH2AX foci per cell was determined in at least 50 cells Cell Lines and Treatment Mice The MiaPaCa2 (pancreatic adenocarcinoma) and DU145 (prostatic adenocarcinoma) cell lines...
- 9
- 384
- 0
báo cáo khoa học: "Vulval elephantiasis as a result of tubercular lymphadenitis: two case reports and a review of the literature" pptx
... seroma formation under the skin flaps that was managed by aspiration and pressure bandaging She also experienced episodes of serous discharge from the site that was self limiting and was managed ... cases was the extensive destruction of the inguinal lymph nodes and their channels as a result of past tuberculosis, leading to a blockage of lymphatic drainage and resulting in vulval elephantiasis ... physical examination was normal and there was no lower limb edema She had a 15 × cm labial swelling on the left side and a × cm labial swelling on the right side (Figure 6) The skin overlying the...
- 5
- 457
- 0
Báo cáo y học: "Acute small bowel obstruction as a result of a Meckel''''s diverticulum encircling the terminal ileum: A case report" pdf
... resuscitation, nasogastric tube insertion, catheterisation, routine bloods and erect chest and supine abdominal x-rays Significant elevations in blood concentrations of urea, creatinine and C-reactive ... Hospital with a 3-day history of abdominal pain, vomiting, absolute constipation and abdominal distension The abdominal pain initially started as a dull generalised discomfort, but later became ... acute bowel obstruction is made initially on clinical judgement based on the history and physical examination of the patient The cardinal symptoms and signs are colicky abdominal pain, vomiting,...
- 5
- 311
- 0
Báo cáo y học: "The self-organizing fractal theory as a universal discovery method: the phenomenon of life" pptx
... means and ends, at one and the same time Notice that, since the Earth’s biomass has been continuously increasing over macroevolutionary time at an accelerating pace [1], it appears that living matter ... infer that the circulating lactate, glucose, succinate, fumarate, and malate act as electron acceptors, donors, and shuttles that integrate metabolism within and across multiple organizational ... matter as a whole grows by extracting and assimilating electrons and protons from nonliving matter at an accelerating rate If we assume that the main difference between living matter and nonliving...
- 66
- 320
- 0
The thai yellow shirts movement as a struggle for class recognition
... material aspect However, I maintain that emotions remain an important indicator of class and social position because it allows us to better determine the actual status of an individual in a particular ... us a more nuanced understanding of social class and position Again, this thesis is not arguing for a stance that negates a material understanding and definition of class Rather, it aims to broaden ... for the coup, as Hewison (1996) notes, was an attack on the Chatichai government that was seen as threatening the balance constituting the state and the political space More importantly, the...
- 139
- 279
- 0
The thai yellow shirts movement as a struggle for class recognition
... material aspect However, I maintain that emotions remain an important indicator of class and social position because it allows us to better determine the actual status of an individual in a particular ... us a more nuanced understanding of social class and position Again, this thesis is not arguing for a stance that negates a material understanding and definition of class Rather, it aims to broaden ... for the coup, as Hewison (1996) notes, was an attack on the Chatichai government that was seen as threatening the balance constituting the state and the political space More importantly, the...
- 139
- 480
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose