stochastic modeling of a batch adsorber in the case of nonlinear isotherm
Focus - A simplicity manifesto in the Age of Distraction
... inspiration in what others have done, you get ideas, you gather the raw materials for creating But consuming and communicating aren’t creating They aid creating, they lay the groundwork, but at some point ... what are you afraid of? Then shine a light on these fears with actual facts — what harm has actually been caused so far? Try to a short test — an hour, a day, a few days, a week — and see what ... were insulted or indignant, either feeling like I was insulting their way of doing things, or that I was some kind of prima donna or “diva” for not wanting to be available through email Interesting:...
- 121
- 552
- 1
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
... 269) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre Sulfated and nonsulfated ... estimated by the Whiteman Alcian blue binding technique [28,29], using chondroitin sulfate as standard The assay was adapted to the estimation of GAG in more dilute samples by increasing the aliquot ... (6.5%) Thus, the alanine and glycine Fig Anion exchange-HPLC elution profiles of the water-soluble matrix (A) and the EDTA-soluble matrix (B) of Pinctada maxima nacre Samples (55 lL) containing 400...
- 10
- 731
- 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... When the assay contained valinomycin, the data reported in Fig 1B were obtained In this case, the ATP yield of both wild-type and mutant as a function of illumination time presented a lag phase ... RESULTS The single point mutation aE210K was introduced into the atp2 operon of Rb capsulatus, containing the F0 genes, cloned in an E coli strain The mutated operon was then transferred into a broad-host-range ... wild-type at every DpH tested Figure 3B is an enlarged view of Fig 3A showing only the rates obtained in the absence of a Du In this case, the impairment of the ATP synthesis rates in the mutant was...
- 9
- 580
- 0
Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc
... had acquired at Metz In the meantime we taught him, at the same place, the manual of arms and Infantry tactics which had been introduced into the army after he was graduated at the Military Academy ... necessary for the arrival of the captain commander in this city" Owing to casualties of service, I had almost continually commanded the company, its train, and the general engineer train of the army for ... several days, working on a mule path "cut-off" from the main road "January 14th The mule path was infamous No wagon had ever traveled that road the rancheros have a tradition of a bull cart that,...
- 48
- 504
- 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢...
- 16
- 397
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial ... [13] Quantification of the data indicated that the cross-linking efficiency of the mutant nascent chains was somewhat reduced (Fig 3B) In conclusion, our results show an increased affinity of the G-10C ... molecules may still rely on the SecB pathway, because of overloading of the SRP pathway The re-routing of (G-10L)prePhoE to the Sec translocon via the SRP instead of the SecB pathway could be explained...
- 8
- 546
- 0
Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines pdf
... cases It has been estimated to be under 1% in the USA, 4% in China, 6% in Italy, 7% in Japan, and 16% in Saudi Arabia [10] A Southeast Asian neighbor, Thailand, reported a 2.2% systemic TB involvement ... study in 2002 [8] Biswas and Badrinath examined 2,010 eyes of pulmonary TB patients and found a 1.39% ocular involvement [9] Other studies include data about ocular TB as a fraction of uveitis cases ... Patients and had combined findings in the anterior and posterior segments of the eye; VAi, best-corrected visual acuity (BCVA) prior to ATT; VAf, BCVA after weeks of ATT; GAU, granulomatous anterior...
- 4
- 517
- 0
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx
... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... revealed that the GT ⁄ AG rule was maintained in all cases (data not shown) The deduced protein primary structure of mouse and human fad49 The ORF of fad49 encodes a putative protein of 910 amino acids ... domains, suggesting that the PX domain could bind to an SH3 domain of FAD49 To test whether the PX domain could interact with an SH3 domain in FAD49, we performed in vitro binding assays using...
- 13
- 385
- 0
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB ... protein chain, acting as a flap, first opening and then closing the groove [45] The catalytic reaction presumably occurs when the ionized carboxyl group of PG approaches the guanidine side chain of ... several polar amino acid residues This part of the enzyme can be considered as its S1¢ binding subsite Substrate binding induces conformational changes involving the ArgA145PheA146 fragment of the...
- 8
- 438
- 0
Báo cáo "Developing a bilateral input-output table in the case of Thailand and Vietnam: Methodology and applications " doc
... particular industry In essence, there are two types of linkages, namely, backward linkages and forward linkages A backward linkage is a measure of the relative importance of an industry as a ... sustain unit changes in their respective final demands The inverse matrix is the most important table needed in inter-national input-output analysis as it unravels the inter-national, inter-industrial ... that 81.1% of the total GDP generated by the economies totaling US$160.1 billion was induced by Thailand’s final demand and the remaining 18.9% by Vietnam’s final demand Of the total labor income...
- 13
- 562
- 0
Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx
... 8.5–11.0 Determination of the pKa value was performed by a curve fitting with the calculated curves of the fraction of alkaline form vs pH for given pKa values in the Henderson–Hasselbalch equation EPR ... was completed by monitoring the maximum loss of the Soret band (A4 02) and the formation of biliverdin (A7 30) In the experiments using NADPHreductase, the 14 equivalent of NADPH was added to the ... -), and 9.3 (– –), based on the Henderson–Hasselbalch equation The heavy dots are the fractions estimated from the experimentally obtained absorbance at 418 nm that is normalized against the value...
- 12
- 459
- 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A ... B1 A th aliana CaU GT1 C ro seu UG s T7 1C UG 1A T7 th UG alia 1D T8 na UG A 8A T7 th 2E ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A UG T76 C UGT7 A1 CAO69089 V vinifera...
- 11
- 661
- 0
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... diadenosine pentaphosphate, a blocker of adenylate kinase) was measured by exploiting the differential affinity of ADP and ATP for Mg2+ The rate of ATP appearance in the medium following addition of ADP ... species, including the deletions of four amino acids Finally, we show that the ADP–ATP exchange rate mediated by ANT expressed in mitochondria of A franciscana and Ca2+ uptake capacity are insensitive ... phenomenon in Artemia mitochondria, as the functional data deviated so significantly from the mammalian consensus As shown in Fig 4A, mitochondria from the crustacean incubated in the absence of adenine...
- 15
- 505
- 0
Báo cáo khoa học: Deviation of the neurosporaxanthin pathway towards b-carotene biosynthesis in Fusarium fujikuroi by a point mutation in the phytoene desaturase gene ppt
... upstream of the start codon and the first 957 bp of the carB coding sequence, and 5¢CGTTGAGGCACTGGTTAACG-3¢ and 5¢-CGAGAAT CATGGACATAGAC-3¢, covering the last coding 1048 and 88 bp downstream of the ... were isolated after transformation of the SF1 strain with a plasmid carrying carB36 In five of them, Southern blot analyses showed the incorporation of a single copy of the plasmid at the carB locus ... Carotenoid and retinal biosynthesis in Fusarium fujikuroi The pathway involves CarRA, CarB, the cleaving oxygenases CarX and CarT, and a postulated dehydrogenase CarD Desaturations introduced by the CarB...
- 16
- 440
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... splice variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, ... Supplementary material The following supplementary material is available online: Fig S1 Comparison of human and Rhesus monkey PKA Cb amino acid sequence This material is available as part of the online...
- 13
- 344
- 0
Báo cáo khoa học: Light regulation of CaS, a novel phosphoprotein in the thylakoid membrane of Arabidopsis thaliana doc
... 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and 5¢-CAGTCGGAGCTAGGAAGGAA-3¢ Isolation of plasma membrane, intact chloroplasts, stroma and thylakoids The plasma membrane fraction of Arabidopsis was isolated as ... GGCTTAAUATGGCTATGGCGGAAATGG CAACGA) and nt115 (reverse: GGTTTAAUTAAGGATC CTTAATTAAGCCTCAGCGGGTCGGAGCTAGGAAG GAACTT), where the underlined sequence was included for regeneration of a USER cloning cassette The PCR ... is a crucial component of the protein phosphorylation cascade involved in CaS phosphorylation Characterization of the CaS mutant lines The mutant Arabidopsis lines with T-DNA insertion in the intron...
- 11
- 446
- 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot
... substrate Therefore, the metal ion has a catalytic rather than just a substrate binding role Possible roles of the cation include the activation of water for the hydration reaction and ⁄ or the stabilization ... pathway [5] The binding of divalent cations by the decarboxylase precludes metal binding studies of the hydratase in that complex In this study, BphH, the hydratase in the PCBs degradation pathway ... Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada) All other chemicals were of analytical grade and were obtained from Sigma-Aldrich and Fisher Scientific (Nepean, Ontario, Canada)...
- 9
- 461
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... (Kirkegaard and Perry, Gaithersburgh, MD, USA) per well The plate was incubated in the dark for 20 and the reaction stopped by the addition of 50 lL of 0.5 M sulfuric acid The plate was read on a Labsystems ... confirms that IFN-c can increase the activity of an enzyme, LPCAT, that participates in the rapid turnover of PtdCho Lysophospholipid acyltransferases maintain membrane lipid composition and the asymmetrical ... and one for TNF -a The level of U 1A mRNA was similar in all samples as shown in Fig 4A This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription inhibitor There...
- 7
- 322
- 0
stochastic modeling of manufacturing systems advances in design, performance evaluation, and control issues - g. liberopoulos
... shipping and design the material handling systems in the plant in a U-shape layout Instrumental Issue (2 ):= If space is unavailable, clearly demarcate the receiving and shipping areas and the paths ... related probabilistic service level constraints are integrated in a deterministic mathematical program by adding a number of additional linear constraints They evaluate the performance of their methodology ... outlined in Table Especially damaging is the rst one, which practically precludes analytical investigation The other reasons lead to a combinatorially increasing number of cases to be investigated...
- 364
- 411
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008