Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes Nabanita Nag1, G Krishnamoorthy1 and Basuthkar J Rao2 Department of Chemical Sciences, Tata Institute of Fundamental Research, Mumbai, India Department of Biological Sciences, Tata Institute of Fundamental Research, Mumbai, India Keywords ATP; hydrodynamic radius; mismatch; MMR; MutS Correspondence B.J Rao, Department of Biological Sciences, Tata Institute of Fundamental Research, Homi Bhabha Road, Mumbai 400005, India Fax: +91 22 2280 4610; 2280 4611 Tel: +91 22 2278 2606 E-mail: bjrao@tifr.res.in (Received 20 June 2005, revised 19 August 2005, accepted 28 September 2005) doi:10.1111/j.1742-4658.2005.04997.x Changes in the oligomeric status of MutS protein was probed in solution by dynamic light scattering (DLS), and corroborated by sedimentation analyses In the absence of any nucleotide cofactor, free MutS protein [hydrodynamic radius (Rh) of 10–12 nm] shows a small increment in size (Rh 14 nm) following the addition of homoduplex DNA (121 bp), whereas the same increases to about 18–20 nm with heteroduplex DNA containing a mismatch MutS forms large aggregates (Rh>500 nm) with ATP, but not in the presence of a poorly hydrolysable analogue of ATP (ATPcS) Addition of either homo- or heteroduplex DNA attenuates the same, due to protein recruitment to DNA However, the same protein ⁄ DNA complexes, at high concentration of ATP (10 mm), manifest an interesting property where the presence of a single mismatch provokes a much larger oligomerization of MutS on DNA (Rh>500 nm in the presence of MutL) as compared to the normal homoduplex (Rh % 100–200 nm) and such mismatch induced MutS aggregation is entirely sustained by the ongoing hydrolysis of ATP in the reaction We speculate that the surprising property of a single mismatch, in nucleating a massive aggregation of MutS encompassing the bound DNA might play an important role in mismatch repair system The DNA mismatch repair (MMR) system, an evolutionarily conserved biochemical pathway, plays an important role in regulating the genome by correcting base mismatches arising either from replication errors (error rate 10)8) or from homologous recombination preventing recombination between DNA molecules that have high sequence divergence (mismatches) [1–3] Inactivation of MMR genes results in a significant increase in the spontaneous mutation rate, thereby leading to microsatellite repeat instability, where cells become hyper-recombinogenic, which account for % 40–50% of hereditary nonpolypopsis colorectal cancers in humans [1,4–6] The most extensively studied adenine methyl directed MMR pathway of Escherichia coli implicates the participation of several gene products, including MutS, MutL, MutH, DNA helicase II, single-stranded DNA binding protein, exonuclease I, VII or RecJ exonuclease, DNA polymerase III holoenzyme and DNA ligase [1,7] In E coli, repair is initiated by dimeric MutS protein that recognizes a mismatch ⁄ insertion–deletion-loop with an affinity that is only several-fold higher than that of its binding to homoduplex [8,9] After mismatch recognition, MutS with the assistance of MutL initiates the mismatch repair by activating MutH that nicks the newly synthesized, unmethylated ‘GATC’ sequence strand [1,10], following which a concerted action of helicase ⁄ exonuclease ⁄ polymerase and ligase functions ensue, thereby restoring the correct complementary sequence in the DNA strand [1,2,7,11–13] Currently, most efforts in mismatch repair studies are focused on trying to reveal the finer mechanistic Abbreviations AFM, atomic force microscopy; DLS, dynamic light scattering; MMR, mismatch repair system; Rh, hydrodynamic radius 6228 FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS N Nag et al details of the pathway by using the E coli system as a paradigm and by applying the same for the newly discovered eukaryotic MMRs Several studies have tried to address two most important issues related to MutS: (a) how does the system achieve the specific recognition of mismatches and insertion–deletion-loops? (b) Following recognition of a mismatch, how does it communicate the signal of such a mismatch to a distant landmark, the GATC-tract such that the downstream components, namely MutH-UvrD proteins, act in highly mismatch-specific context? The former issue has been elegantly addressed in the studies that described the high-resolution structures of MutS bound to a mismatch [14,15] as well as atomic force microscopy (AFM) images of such complexes on mica surface in air [16] From these studies, one infers that MutS makes specific contacts with the DNA helix in the vicinity of a mismatch and generates a kink in the DNA that seems to play a crucial role in mismatch recognition process [14–16] The latter issue of how MutS cross talks with GATC tract has remained largely elusive Three models have been proposed to address the same: according to the first model, mismatch bound MutS undergoes a conformational change following ATP binding and hydrolysis that facilitates the recruitment of MutL, followed by bidirectional translocation along the DNA to encounter the downstream components, namely MutH-UvrD proteins, at GATC tracts [17,18] In the second model, the MutS–ADP binary complex undergoes an ADP to ATP exchange upon binding to mismatch and forms an ATP hydrolysis independent, but MutL dependent, sliding clamp along DNA that encounters downstream MMR components during its sliding action [9,19] In the third model MutS remains at the site of the mismatch following mismatch recognition and interacts with the MutH through space via MutL mediated crosstalk with MutH, thereby leading to a loop formation of the intervening DNA [20,21] Interestingly, additional studies from the proponents of this model hint at ATP binding in the absence of its hydrolysis as sufficient to trigger formation of a MutS sliding clamp [22] of the sort described in the second model [9,19] Using nuclease footprinting, gel-shift analyses, and surface plasmon resonance spectroscopy, it has been demonstrated that MutS, in an ATP hydrolysis dependent manner, establishes a near complete coverage of mismatch containing DNA, presumably through a putative ‘treadmilling action’ of protein [23,24] Essentially this model is a variation of the first one, where the action of protein translocation on both sides away from a mismatch, fuelled by the energy of ATP FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS Hydrodynamic analyses of MutS aggregates hydrolysis, obviates the need of looping of intervening DNA The in vivo data supporting the MutS–MutL foci formation suggests the possibility of extensive recruitment of protein molecules at the sites of mismatch repair, thereby achieving high enough local concentration of protein [25] Importantly, such models that implicate high local protein densities rely on the property of protein aggregation that is presumably coupled to its action of ATP hydrolysis The solution assays used so far to address this aspect of protein dynamics did not enable one to monitor the same in real time at its equilibrium conditions In order to achieve this, we have used an assay system that allowed us to monitor the size of the protein complex through its hydrodynamic properties, as a function of not only ATP hydrolysis but also its binding to a mismatch in the duplex DNA We have observed that MutS, which remains in dimer–tetramer equilibrium in physiological conditions [26], has the propensity to aggregate into dramatically large particles that show hydrodynamic radii of more than several hundred nanometers Interestingly, such a protein aggregation ensues specifically in the presence of an ongoing ATP hydrolysis, since it is effectively ‘poisoned’ by the addition of a poorly hydrolysable analogue of ATP (ATPcS) Moreover, additions of homo ⁄ heteroduplex templates suppress the same by the squelching action of DNA following protein binding However, interestingly, the protein regains a unique mode of aggregation even when bound to DNA following an enhancement in the concentration of ATP It is here that the MutS ⁄ MutL system acquires a special property of aggregation that is specific to the presence of a single mismatch, thereby generating large protein ⁄ DNA complexes encompassing the mismatch Results MutS interaction with MutL and stoichiometry analyses In this study, we have investigated the changes associated with the molecular aggregates of mismatch repair proteins MutS, MutL in relation to their interaction with mismatch containing DNA and the ongoing ATP hydrolysis Here we have mainly used dynamic light scattering (DLS) to monitor the hydrodynamic radii (Rh) of the molecular complexes as a function of reaction time and corroborated the essential findings by protein fluorescence and other biochemical assays The principal players in the system namely, MutS and MutL proteins showed a reasonably narrow distribution of Rh values with a peak at 10 nm and nm, 6229 Hydrodynamic analyses of MutS aggregates respectively (Fig 1A, Table 1) At the concentration chosen (0.15 lm), the protein preparation exhibited hardly any large particulate aggregates Interestingly, when the two proteins were mixed at : molar ratio N Nag et al Table Hydrodynamic radii (Rh in nm) of MutS and MutL in the presence of Homo- or Hetero duplex DNA of different lengths (All in minus ATP conditions, see text) 6230 Rh (nm) MutS MutL MutS-MutL MutS-Homoduplex (121 bp) MutS-Heteroduplex (121 bp) MutS-Homoduplex (61 bp) MutS-Heteroduplex (61 bp) MutS-Homoduplex (16 bp) MutS-Heteroduplex (16 bp) MutS-MutL-Homoduplex (121 bp) MutS-MutL-Heteroduplex (121 bp) Fig Analyses of the Rh distribution of MutS as a function of its interaction with MutL (A) Analyses of the Rh distribution of MutS as a function of its interaction with MutL 0.15 lM MutL (I), 0.15 lM MutS (II) and a mixture of MutS and MutL (0.15 lM each) (III) The samples were incubated in buffer A for 10 at 22 °C, followed by DLS analyses as specified (B) MutS.MutL binding isotherm Fluorescamine-labelled MutS (0.25 lM) was taken in buffer C and titrated with MutL The steady-state fluorescence measurements were carried out with the excitation wavelength set at 380 nm monitoring the change in fluorescence intensity at 477 nm (maximum kem) The smooth line represents the theoretical fit with dissociation constant of 70 nM Species 10 25 14 20 14 18 10 10 30 35 (± (± (± (± (± (± (± (± (± (± (± 1) 1) 2) 1) 2) 1) 2) 1) 1) 3) 3) (0.15 lm each), we observed a distinct shift in the distribution of Rh values towards a larger size with a peak at 25 nm (Fig 1A, Table 1) Such a shift towards a size larger than that of the individual proteins is consistent with the model where the two proteins interact with each other, which we confirmed using fluorescence assay (see below) These measurements suggested that the proteins are amenable for studies by DLS MutS protein was surface labelled with minimal amount of fluorescamine (see Experimental procedures), a primary amine reactive fluorescent probe, such that the protein retained its biochemical activity and exhibited sufficiently high steady-state fluorescence emission at 477 nm, following excitation at 380 nm Fluorescamine labelled MutS was as active as unlabelled protein in gel shifting ) specifically the mismatch containing duplex rather than normal duplex ) thereby revealing that dye binding has not affected the activity of the protein measurably (data not shown) A fixed amount of MutS protein (0.25 lm dimer) was titrated with increasing concentrations of MutL protein and steady-state intensity of fluorescence emission was measured at each addition MutL addition led to a measurable drop in fluorescence intensity, based on which we could construct a binding isotherm for MutL interaction with MutS (Fig 1B) Interestingly, such an analyses revealed that the two proteins interact with each other at an almost : molecular ratio with an approximate Kd of 70 ± 20 nm Since the titration (Fig 1B) is close to a case of stoichiometric binding, the estimated value of Kd should be taken as the upper limit If one assumes that MutS exists largely as a stable dimer, this result suggests that MutS–L complex comprises of a dimer of each, which is entirely consistent with the data in the literature [20] This FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS N Nag et al experiment not only corroborated the qualitative conclusion drawn from DLS analyses, but provided an equilibrium analysis of MutS complexation with MutL Hydrodynamic analyses of MutS aggregates the appropriate changes in Rh as summarized in the Table 1, we studied the changes in protein aggregation in the presence of ATP hydrolysis ATP induced oligomerization of MutS Analysis of protein binding to DNA It is of note that the DNA duplex itself does not show sufficient scattering intensity in this concentration range, thus precluding the estimation of its Rh Hence all of the hydrodynamic radii in the following measurements are directly ascribable to the protein species in solution Addition of either a single mismatch (hetero) or no mismatch (homo) containing duplex DNA (0.15 lm of molecules) to MutS protein (0.15 lm) resulted in interesting changes, where the distribution of Rh (of MutS peak at 10 nm) shifted towards a larger size The particles in the presence of homoduplex showed a peak at 14 nm whereas that with heteroduplex DNA showed a peak at 20 nm (Table 1) As the duplex length in homo- vs heteroduplex is identical, this result is consistent with the model in which heteroduplex bound MutS appears to be a larger oligomer than that of the homoduplex bound form (see Discussion) Interestingly, the larger oligomeric state of MutS, as reflected by higher Rh, held true when the duplex target size was reduced to 61 bp from that of 121 bp, but not so at much shorter duplex size of 16 bp (Table 1) In fact, MutS Rh values obtained with 16 bp duplex (10 nm) were identical to that of free MutS itself, thereby suggesting that protein failed to stably bind the short duplex The trend of the higher oligomeric protein form associated with heteroduplex DNA was observed with the MutS–MutL sample as well, where addition of homo- and heteroduplex DNA led to a shift of Rh from 25 nm to 30 nm and 35 nm, respectively (Table 1) We studied the changes in DLS associated with DNA binding as a function of time Analysis of Rh distribution pattern as a function of time revealed that within about of DNA addition, MutS protein with heteroduplex DNA yielded particles distinctly larger than that with homoduplex DNA (data not shown) The observed difference in Rh (% 20 nm and 14 nm with hetero and homoduplex, respectively) remained constant throughout the time course, suggesting the formation of stable and distinct particles of bound MutS on these two DNA templates It is also important to note that the difference in Rh between MutS bound to hetero vs homoduplex was evident even at a : molar ratio of protein to DNA (0.15 lm each) After establishing the basic system of MutS and MutL and their interaction with DNA, as reflected by FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS Addition of ATP to MutS led to a time-dependent increase in the Rh values of MutS particles Moreover the extent of MutS aggregation was clearly ATP concentration dependent At the lowest concentration of ATP (0.3 mm) tested, the Rh values increased to % 17– 18 nm from that of 10 nm and the increase ensued within 2–3 of ATP addition (Fig 2A) At the next higher concentration of ATP (0.6 mm) the rise in Rh was much more dramatic resulting in 200 nm particles within the first and slowly increasing further beyond 400–500 nm, the limit of detection by DLS, as a function of time The width of distribution of Rh was in the range of % 50 nm in these samples Next, two higher concentrations of ATP (1 mm and 10 mm) brought about rapid aggregation of MutS, generating particles > 600 nm (Fig 2A) In fact, it appears that at these higher ATP concentrations, MutS aggregation continues to increase even after several minutes of ATP addition This experiment demonstrated the ATP concentration-dependent enhancement in MutS aggregation results in very large (perhaps sedimentable, see the next portion of the manuscript) particles whose Rh value exceeded 500–600 nm We tested whether ADP also exhibits a similar effect on MutS aggregation by analysing changes in Rh as a function of time at two different concentrations of ADP (1 mm and 10 mm) The observed changes in Rh with ADP were significantly lower: at mm and 10 mm ADP the Rh increased to and stabilized at % 30 nm and % 150 nm, respectively (data not shown) The aggregation was also not due to the pyrophosphate anion (PPi) effect in ATP as shown by the lack of increase in Rh when PPi (1 mm and 10 mm) was added to MutS protein (data not shown) This experiment revealed that the observed effects of MutS aggregation were specific to ATP rather than to ADP or PPi conditions (see Discussion) ATPcS addition ‘poisons’ ATP mediated oligomerization of MutS We tested the role of ATPcS in ATP induced MutS aggregations by two different protocols In the first protocol increasing amounts of ATPcS were premixed with mm ATP, and then Rh changes in MutS were noted as a function of reaction time We observed that the presence of 0.5 mm ATPcS had only a marginal 6231 Hydrodynamic analyses of MutS aggregates N Nag et al effect on the changes in Rh induced by mm ATP (Fig 2B) where the Rh values sharply increased to more than 400 nm by about 10 In contrast when the concentration of ATPcS that was premixed with ATP increased to mm, the inhibitory effect on the increase in Rh was distinct and dramatic where the particle size dropped to about 150 nm even after prolonged incubation This experiment suggested that the presence of ATPcS effectively poisoned the ATP mediated aggregation of MutS In another protocol we tested whether the suppression of MutS aggregation by ATPcS could be reversed by the addition of ATP As expected, the control reaction where MutS was incubated with mm ATPcS alone exhibited no MutS aggregation throughout the incubation period of 30 where a particle with an Rh of 10 nm was observed Interestingly when mm ATP was added to this control at the midpoint of incubation, we observed the induction of MutS aggregation and the particle size gradually increased to about 70 nm, which suggested that addition of ATP tends to partially reverse the poisoning effect of ATPcS These controls taken together suggest that MutS aggregation critically depends on the level of ATP hydrolysis rather than ATP binding We studied this issue further in the following experiments ATP induced aggregation of MutS is protein concentration dependent ATP induced aggregation of MutS was measured at different concentrations of protein as a function of time after adding ATP The Rh values obtained from this study revealed that protein aggregation was least at the lowest concentration of MutS (0.05 lm) where Fig ATP hydrolysis induced aggregation of MutS (A) Time course of MutS aggregation as a function of ATP concentration Different concentrations of ATP were added to MutS protein (0.15 lM) in buffer A, followed by DLS analyses as a function of time.[0 mM (¯), 0.3 mM (n), 0.6 mM (h), mM (s), 10 mM (,) of ATP] (B) ATP induced aggregation of MutS is inhibited by ATPcS In four independent reactions, 0.15 lM of MutS was incubated with either mM ATP (h) or 0.5 mM ATPc S +1 mM ATP (premixed) (,) or mM ATPc S +1 mM ATP (premixed) (s) or mM ATPcS (n), followed by DLS analyses as a function of incubation time In a separate experiment, mM ATP was added to an ongoing reaction containing mM ATPcS at its 15th of incubation (d), followed by DLS analyses (C) Rate of ATP induced aggregation of MutS depends upon the protein concentration ATP (1 mM) was added to MutS taken at various concentrations [0.05 lM (,), 0.1 lM (h), 0.15 lM (n), 0.3 lM (e), 0.45 lM (s)], followed by DLS analyses as a function of incubation time 6232 FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS N Nag et al the particles exhibited an Rh of 100 nm that stayed constant throughout the time course (Fig 2C) At the next highest concentration of MutS (0.1 lm), there was an increase in the rate of MutS aggregation where the particles reached an Rh of 500 nm in about 30 It appears that in this reaction protein aggregation continued to occur even after 30 of incubation In the other samples where the protein concentrations were > 0.1 lm (0.15, 0.3 and 0.45 lm), aggregation was much more rapid resulting in particles of about 500 nm size within first 5–10 and then the particle size appeared to increase further with time (Fig 2C) In the next experiment we analysed the Mg2+ dependence of ATP induced MutS aggregation In four different samples that contained varying levels of Mg2+, Rh value was monitored as a function of time following ATP addition The sample that contained no Mg2+ showed the least protein aggregation reaching an Rh of about 100 nm By the addition of mm or more of Mg2+, ATP induced MutS aggregation was substantially increased generating particles of Rh that were larger than 400–500 nm (data not shown) The experiment suggested that the ATP induced aggregation was highly Mg2+ dependent After establishing the basic conditions that influence MutS aggregation, we studied the same in the presence of duplex DNA targets that contained or did not contain a mismatch (heteroduplex or homoduplex, respectively) MutS aggregation in the presence of duplex DNA senses a single mismatched base pair The role of ATP hydrolysis MutS–DNA complexes were formed at : ratio, ATP (1 mm) was added and then Rh was analysed as a function of time As shown earlier (Table 1), before the addition of ATP we recovered MutS–homoduplex and MutS–heteroduplex complexes of about 14 and 20 nm in size, respectively Following ATP addition there was only a marginal increase in Rh of both the complexes where the former reached a size of 24–25 nm and the latter 20–22 nm (Fig 3A) It is important to note that MutS had shown extensive aggregation reaching a particle size of about 500– 600 nm in the same conditions that contained no duplex DNA (Fig 2A) In contrast, the current experiment, in which DNA was present, MutS aggregation was significantly reduced suggesting that the protein was sequestered on DNA such that free protein aggregation induced by mm ATP was dramatically reduced Moreover, reduction in MutS aggregation was observed even with DNA targets (such as short FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS Hydrodynamic analyses of MutS aggregates 16-mer homo ⁄ heteroduplexes, or ssDNA 121-mer oligonucleotides) that are poor binders of the protein (data not given), implying that protein disaggregation must have been brought about by relatively weak protein–DNA contacts To test whether MutS aggregation in the presence of DNA is affected by high concentration of ATP, we repeated the same experiment at 10 mm ATP and observed a surprising effect of MutS aggregation that was significantly higher in the presence of heteroduplex DNA (Rh % 140 nm) as compared with that with homoduplex DNA (Rh ¼ 50–60 nm) (Fig 3B) The high ATP (10 mm) experiment was carried out under conditions in which the Mg2+ level (5 mm) appeared to be limiting To verify that the observed high ATP effect arose from the physiologically relevant Mg2+ bound form of ATP, and not from free ATP, we repeated the same experiment at excess Mg2+ (15 mm) as well The DLS result at high Mg2+ essentially reproduced (Fig 3C) the results obtained earlier (Fig 3B), confirming that the effect of high ATP concentration was genuine where ) specifically ) the presence of a mismatch induced a higher level of protein aggregation (see Discussion) To test whether mismatch specific enhanced aggregation of MutS requires the sustained presence of ongoing ATP hydrolysis, the following control experiments were carried out MutS–DNA (hetero ⁄ homo) reactions were initiated at 10 mm ATP, followed by poisoning of ATP hydrolysis by either EDTA or ATPcS (10 mm) at early (3 min) or late (20 min) time-points of DLStime-course and analysing further the changes in Rh We surmised that effective poisoning of ongoing ATP hydrolysis by EDTA or ATPcS might unravel its role in the maintenance of mismatch induced MutS aggregation, if any The Rh analyses as a function of time revealed that addition of EDTA or ATPcS had significantly lowered MutS aggregation specifically in a mismatch containing reaction The specificity of such an effect was evident when the relative change in Rh (hetero minus homo) was plotted as a fraction of maximum difference observed in Rh between hetero and homoduplex sample at the final time-point (40 min) of the reaction (Fig 3D) As expected, in the normal control experiment where neither EDTA nor ATPcS was added, the relative Rh difference (i.e Rh heteroduplex– Rh homoduplex) kept on increasing as a function of reaction time, thereby corroborating the specificity of mismatch induced MutS aggregation described earlier (Fig 3C) Interestingly such a differential increase in Rh in hetero- vs homoduplex was lost when ATP hydrolysis was poisoned by either EDTA or ATPcS This was evident when Rh associated with heteroduplex set decreased to background level close to that 6233 Hydrodynamic analyses of MutS aggregates N Nag et al Fig ATP induced aggregation of MutS in presence of hetero ⁄ homo- duplex DNA MutS-DNA complexes were formed by incubating 0.15 lM of MutS with either heteroduplex (n) or homoduplex (s) DNA (0.15 lM each) for 10 at 22 °C in buffer containing 50 mM Hepes pH 7.5, 50 mM KCl, mM MgCl2, followed by adding ATP at various final concentrations [1 mM (A), 10 mM (B)] and analysing the complexes by DLS as a function of incubation time High Mg2+ control of the same was done by forming MutS-DNA complexes with 0.15 lM of MutS and eitherheteroduplex (n) or homoduplex (s) DNA (0.15 lM each) for 10 at 22 °C in buffer containing 50 mM Hepes pH 7.5, 50 mM KCl, 15 mM MgCl2, followed by adding 10 mM ATP (C) and analysing the complexes by DLS as a function of incubation time (D) MutS-DNA complexes (homo- or heteroduplex containing) were formed as described (Fig 3B) to which either ATPcS or EDTA (10 mM each) was added at the third or 20th minute of the reaction time-course (arrows), followed by Rh measurement as a function of incubation time The Rh differences between hetero and homoduplex-containing reactions reached a maximum at the 40th with respect to which those at other timepoints [(nRh at xth min) ⁄ (nRh at 40th min); nRh ¼ Rh(het)–Rh(homo)] are expressed as a function of time Decrease in nRh observed following the addition of ATPcS (open triangles) or EDTA (open circles) was similarly expressed as a function of time of homoduplex reaction (Fig 3D), thereby revealing the critical requirement of ongoing ATP hydrolysis for sustained maintenance of mismatch specific MutS aggregation (see Discussion) 6234 The role of MutL We tested further whether such high ATP induced mismatch specific aggregation of MutS ensues even in the FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS N Nag et al Hydrodynamic analyses of MutS aggregates presence of MutL DNA (0.15 lm) was added to MutS–MutL complex (0.15 lm each) to facilitate a : complex, followed by the addition of ATP and measurement of Rh as a function of time Addition of mm ATP caused marginal increase in the Rh value of complexes where heteroduplex and homoduplex DNA samples showed a plateau at about 45 nm and 35 nm particles, respectively (Fig 4A) The marginal increase in the Rh value of protein–DNA complexes in the presence of MutL at mm ATP was qualitatively similar to that of minus MutL set (Fig 3A) The same experiment in the presence of MutL at high ATP (10 mm) revealed a dramatic enhancement in the aggregation of protein that was highly specific to the presence of a mismatch The reaction containing homoduplex DNA exhibited a slow rise in Rh reaching a limit of < 200 nm, whereas that of heteroduplex DNA revealed rapid growth in protein aggregation that appeared to go beyond an Rh value of 500 nm within 15 (Fig 4B) Again, the effect was clearly not due to Mg2+ limiting (5 mm) conditions, as a repeat experiment at high Mg2+ (15 mm) resulted in the same effect (Fig 4C), where a single mismatch provoked higher aggregation of MutS in the presence of high ATP These experiments suggested a surprising property of MutS where large protein aggregates form in a mismatch specific manner, selectively under high ATP (10 mm) conditions It should be stressed that the observation of particles with such large Rh values and the dramatic discrimination in the size of complexes in hetero vs homoduplex DNA in the presence of high (% 10 mm) concentrations of ATP was very robust and reproducibly seen in a large number of repeat experiments Effect of ADP and salt It is to be noted that the discrimination rendered by the presence of a single mismatch in the DNA on the Fig ATP induced aggregation of MutS-MutL in presence of homo ⁄ heteroduplex DNA MutS-MutL-DNA complexes were formed by incubating of MutS-MutL (preincubated for by mixing both at 0.15 lM each) with either heteroduplex (n) or homoduplex (s) DNA (0.15 lM each) for 10 at 22 °C in buffer containing 50 mM Hepes pH 7.5, 50 mM KCl, mM MgCl2, followed by adding ATP at various final concentrations [1 mM (A), 10 mM (B)] and analysing the complexes by DLS as a function of incubation time.MutS-MutL-DNA complexes were formed by incubating of MutS-MutL (preincubated for by mixing both at 0.15 lM each) with either heteroduplex (n) or homoduplex (s) DNA (0.15 lM each) for 10 at 22 °C in buffer containing 50 mM Hepes pH 7.5, 50 mM KCl, 15 mM MgCl2, followed by adding 10 mM ATP (C) and analysing the complexes by DLS as a function of incubation time FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS 6235 Hydrodynamic analyses of MutS aggregates 6236 concentration and DNA length is a separate study that is currently underway Mismatch-dependent MutS aggregation as revealed by centrifugation assays In the following sedimentation assays, we monitored MutS aggregation states in a variety of conditions, described earlier, and tried to establish the general validity of DLS results MutS protein incubated with increasing concentrations of either ATP or ATPcS was centrifuged followed by assaying the protein concentrations in the supernatant as well as the pellet In the set containing ATPcS, the entire protein sample was recovered in the supernatant (Fig 5A) and no protein was detected in the pellet fractions (data not shown) In the same conditions the ATP set exhibited nucleotide cofactor concentration dependent aggregation of MutS where at about mm ATP a significant fraction of MutS was recovered in the pellet fraction with a A Fraction of Muts in the supernatant level of MutS aggregation was lost when we substituted high ATP with high ADP (10 mm) (data not shown) In fact at high ADP, the changes in Rh as a function of time in homo- vs heteroduplex DNA reached about 100 nm, with essentially no difference between the two sets, again reiterating the specific role of ATP and its hydrolysis in MutS aggregations (see Discussion) We tested the effect of salt (150 mm KCl) on the formation as well as stability of mismatch induced MutS aggregation Normal MutS–DNA reaction contains 50 mm KCl (see Experimental procedures) to which an additional 100 mm KCl was added either at the start or at the 20-min time-point of the reaction Interestingly, addition of salt at the start of the reaction essentially abrogated mismatch induced discrimination of MutS aggregation, where hetero- as well as homoduplex reactions showed similar level of increase in Rh as a function of time (data not shown) On the other hand, the same level of salt added following mismatch induced aggregate formation (at 20 min) had barely any effect: Higher Rh attained by hetero- as compared to the homoduplex reaction was stable even in the presence of high salt (data not shown) This experiment suggests that the molecular interaction properties between MutS–MutS and MutS–DNA that govern the formation vs the sustenance of mismatch induced MutS aggregation are significantly different AFM imaging of the same samples suggested that DLS results was not due to aggregation of just a small subpopulation of MutS protein in the sample, but rather reflected the entire protein population generating large particles of about 200–300 nm size in the presence of mismatch as compared to smaller sized particles (of about 100 nm) with normal homoduplex DNA (data not shown) (DLS being more sensitive to larger particles can mask the presence of smaller particles even in situations where, in mixtures of both large and small particles, the major population is smaller in size) AFM imaging of free protein, in the absence of ATP, revealed particle distribution consistent with dimeric ⁄ tetrameric forms [26], while the same in ATP (1 mm) resulted in massive particles with a concomitant loss of dimeric ⁄ tetrameric forms (data not shown), reiterating that DLS results stemmed from uniformly large-scale aggregation of MutS Moreover, due to large-scale aggregation of protein and the relatively short duplex (121 bp) used in the system, it was not possible to relate the status of aggregation in terms of the position of mismatch in the duplex AFM image analyses followed by computation of attendant volume changes in MutS particles as a function of ATP N Nag et al 1.2 1.0 0.8 0.6 0.4 0.2 0.0 10 12 Conc of ATP/ATPγS in mM ATP B Fig Effect of nucleotide cofactor (ATP or ATPcS) concentration on MutS aggregation as assessed by Centrifugation assay MutS (0.5 lM) protein was incubated in buffer A at 25 °C for 10 in the presence of varying concentrations of ATP (s) or ATPcS (n), followed by centrifugation assay (see Experimental procedures) to analyse MutS concentration in the supernatant fractions by Bradford Dye binding The fraction of total MutS recovered in the supernatant fractions is plotted as a function of ATP ⁄ ATPcS concentrations (A) Analyses of all the pellet fractions for MutS on 10% SDS ⁄ PAGE (B) (lane corresponds to the pellet-equivalent recovered from minus ATP control without centrifugation step; lanes 2–7 correspond to pellet fractions of 0, 1, 3, 5, 7, 10 mM ATP containing samples, respectively, following centrifugation assay) FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS N Nag et al Hydrodynamic analyses of MutS aggregates concomitant reduction of the same in the supernatant (Fig 5A and B) At higher ATP concentration, MutS aggregation was so severe that essentially all the protein was converted into a sedimentable fraction This experiment demonstrated that MutS aggregation is highly ATP concentration dependent and corroborated the DLS results described earlier in this study (Fig 2A) In order to verify whether ATP induced MutS aggregation encompasses the bound DNA in the complexes, we repeated the centrifugation assay on MutS-labelled DNA duplex samples In this experiment, we included MutL along with MutS (0.4 lm each) and incubated with an equimolar concentration of 5¢-32P-labelled 121-mer hetero ⁄ homoduplex DNA at increasing concentrations of ATP, followed by a centrifugation assay The pellet samples recovered in this assay were treated with EDTA-SDS followed by analysis in a native gel and the recovered labelled DNA was imaged on a PhosphorImager The result showed that hetero and homoduplex DNA was rendered sedimentable by MutS aggregation in an ATP dependent manner In this assay the samples without or a low amount of ATP showed hardly any sedimentable DNA while at a concentration of ATP higher than A B C D Fig Effect of ATP concentration on aggregation of MutS-MutL-DNA complexes as assessed by centrifugation assay MutS-MutL-DNA complexes were formed by incubating of MutS-MutL (preincubated for by mixing both at 0.4 lM each) with either heteroduplex or homoduplex DNA (0.4 lM each) for 10 at 25 °C in buffer A, followed by adding ATP at various final concentrations, incubating for another 10 and analysing the complexes by Centrifugation assay One set of the experiment contained radiolabelled duplex DNA where the common CLL strand (see Experimental procedures, Table 2) carried 32P at its 5¢-end and the other set the same DNA in unlabelled form Pellet fractions from the first set were denatured with 20 mM EDTA, 1% SDS, analysed on 8% native PAGE, followed by PhosphorImager scanning of the dried gel [(A) Heteroduplex DNA (B) Homoduplex DNA; lane 1, labeled CLL strand; lane 2, input duplex label; lane 3, pelletequivalent recovered from minus ATP control without centrifugation step; lanes 4–9, pellet fractions of 0, 1, 3, 5, 7, 10 mM ATP containing samples, respectively, following centrifugation assay] Pellet fractions from the second set (containing unlabeled duplex DNA) were heat denatured with SDS loading buffer, analysed by 10% SDS ⁄ PAGE, followed by silver staining to visualize both proteins and DNA [(C) Heteroduplex DNA (D) homoduplex DNA; lane 1, pellet-equivalent recovered from minus ATP control without centrifugation step; lanes 2–7, pellet fractions of 0, 1, 3, 5, 7, 10 mM ATP containing samples, respectively, following centrifugation assay] FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS 6237 Hydrodynamic analyses of MutS aggregates mm essentially all the DNA became sedimentable (Fig 6A,B) (PhosphorImager quantitative data not shown) This result mirrored the sedimentation property of the free protein observed in the earlier assay suggesting that the DNA sedimentation accompanied that of protein In order to verify whether all of the components of the complex ) namely MutS, MutL and DNA ) are rendered sedimentable by high ATP, we repeated the same experiment and analysed protein as well as DNA simultaneously in the same gel using the silver staining protocol As shown earlier (Fig 6A,B), the silver stained gel in this experiment revealed sedimentable DNA at a concentration of ATP higher than mm (Fig 6C,D) Both hetero- and homoduplex DNA were almost equally sedimentable In the same assay one could observe cosedimentation of both MutS and MutL protein at high ATP Silver staining, being more sensitive than Coomassie blue stainng, revealed some background retention of MutSL-DNA on the tubes even in the absence of centrifugation (lane 1, Fig 6C,D) Samples containing high ATP showed a signal for all these three components that were significantly higher than the background Taken together, all of these centrifugation experiments demonstrated high ATP induced aggregation of MutS– DNA complexes that are highly sedimentable It is important to point out that MutS–DNA complexes obtained with homo- vs heteroduplex DNA targets exhibited similar sedimentation properties in the centrifugation assay, although DLS analyses revealed larger complexes with heteroduplex DNA (Fig 4B), suggesting that centrifugation assay fails to discriminate the size differences associated with MutS–DNA complexes, but quantitatively scores essentially all complexes Discussion This study involves the analysis of the changes associated with MutS aggregation in response to ATP binding ⁄ hydrolysis and its mismatch recognition in duplex DNA The study aims primarily to understand large aggregational changes associated with MutS to help model how the protein might transduce the information of a single mismatch across a long physical distance in the duplex DNA In contrast with many biochemical techniques such as foot-printing and analytical centrifugation used by others, the DLS analyses presented here offers an equilibrium study of the complex changes brought about by MutS ATP hydrolysis and mismatch binding Therefore the current study addresses the dynamic changes of the system more comprehensively 6238 N Nag et al MutS and MutL interact with each other In the first part of this report we have shown that the system is highly amenable for studies by DLS where the distribution of Rh (hydrodynamic radius in nm), as a function of added components, revealed signatures of bonafide protein–protein interactions MutS protein showed hydrodynamic radius (Rh) of 10 nm, which is comparable to the MutS-dimer described in the crystal ˚ structure 125 · 90 · 70 A3 dimension [14,15] Addition of MutL (Rh nm) to MutS (Rh 10 nm) at an equimolar ratio yielded a particle with a significantly higher Rh value (25 nm) (Fig 1A) Indeed the complexation of MutL with MutS did lead to : stoichiometric complexes under these conditions, and was established by an independent experiment involving fluorescence titration (Fig 1B) It appears that the MutS–MutL complex with an Rh value of 25 nm does reflect a particle that is somewhat larger than a simple : complex of protein dimers [27,28] Binding of MutS–MutL to DNA: sensing of mismatch Similarly MutS binding to homoduplex DNA led to an increase in Rh (DRh nm) that was smaller than the increase observed with the heteroduplex DNA of the same size (DRh 10 nm) (Table 1) Such an enhanced increase in the Rh with heteroduplex DNA is highly consistent with the conversion of dimeric MutS to that of tetramer either during or following mismatch recognition [26] Interestingly, time course analysis of Rh changes following DNA addition seems to suggest that MutS interaction with heteroduplex DNA rapidly generates a particle size similar to that of homoduplex DNA (14 nm) following which the particle size increases further This again is consistent with the model where initial binding of MutS to the heteroduplex will be equivalent to that of homoduplex, following which mismatch recognition leads to tetramerization of the protein in the heteroduplex reaction Moreover the difference in Rh following hetero vs homoduplex binding by MutS was observed even in the presence of MutL where the Rh value suggested the involvement of MutS–MutL complex in the recognition of the mismatch, which is consistent with a large body of published literature on MutS–MutL system [24,27,28] Amplification of single mismatch by MutS–MutL The most important finding of the study relates to the massive aggregation of MutS in the presence of ATP where protein molecules with an initial Rh of about FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS N Nag et al 10 nm are converted into large particles (with an Rh of several hundred nanometers) within less than following ATP addition (Fig 2A) Surprisingly, the extent of aggregation was highly ATP concentration dependent in a range far above the micromolar binding affinity reported for ATP binding with MutS [29,30], possibly reflecting the role of additional putative low affinity ATP binding sites in this system Expectedly, the ATP mediated protein aggregation was inhibited by the poisoning action of ATPcS, implying the role of ATP hydrolysis in MutS aggregation (Fig 2B) Moreover, protein aggregation induced by ADP was significantly lower than that of ATP, revealing the specificity of the same with ATP This observation is highly consistent with earlier report where gel-filtration analysis revealed that higher order oligomerization of MutS was favoured specifically by ATP hydrolysis [31] Presence of homo- as well as heteroduplex DNA significantly reduced ATP induced aggregation of protein, suggesting the possibility that the binding of protein to DNA somehow interferes with the polymerization of free protein (Fig 3A,B) However, most intriguingly, protein aggregation reappeared even in the presence of DNA at a high concentration of ATP (Fig 3B) In this high ATP regime, protein aggregation was not related to limiting Mg2+, as the same was observed even at high concentration of Mg2+ (Fig 3B vs Fig 3C) Interestingly, formation as well as the sustenance of mismatch induced aggregation of MutS critically requires the presence of ongoing ATP hydrolysis: midway poisoning of the same by either EDTA (that chelates Mg2+ cofactor) or ATPcS (that competitively blocks hydrolysable form of ATP) attenuates mismatch specific MutS aggregation (Fig 3D), suggesting that the process is likely to be dynamic However, under the conditions of the current in vitro study, the aggregation process itself appears to be rather slow as revealed by several minutes of incubation required before the high Rh particles are evident (Fig 3C,D) Most likely this is due to the prevalent reaction conditions in vitro and may not reflect the physiological setting The effect of a single mismatch in the DNA provoking a distinctly higher level of MutS aggregation was further accentuated in the presence of MutL where high ATP regime resulted in the generation of massive particles with an Rh of several hundred nanometers (Fig 4B,C) The effect was highly specific to ATP as the discrimination of a single mismatch was lost when ATP was replaced by equal concentration of ADP, where similar Rh values (100 nm) were recovered for homo- vs heteroduplex samples with MutS It is surmised that the large MutS aggregates that are mismatch specific in ATP should encomFEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS Hydrodynamic analyses of MutS aggregates pass the mismatch DNA itself as an intrinsic part of the particle This indeed is so, was borne out by the sedimentation analyses of the complexes Centrifugation experiments showed that these particles were highly sedimentable only at high ATP (Fig 6A,B) and such sedimenting complexes encompass not only the protein but also the DNA (Fig 6C,D) Experiments performed with ADP (1 mm and 10 mm) revealed a much lower extent of MutS aggregation where the discrimination rendered by the mismatch was lost, as revealed by similar Rh values (100 nm) in homo- vs heteroduplex DNA samples We conjecture that the propensity of MutS to undergo ATP-induced aggregation even in the absence of DNA might form the basis of such massive MutS–MutL-heteroduplex DNA complexes The hydrodynamic size of such particles containing protein–DNA complexes seem to suggest that they may in fact represent assemblies that are connected by intermolecular interactions encompassing several rather than single DNA molecules However, the techniques used not allow us to distinguish the same In the current study we have uncovered a novel facet of the MutS–DNA interaction system that facilitates protein aggregation following mismatch recognition in the DNA, but surprisingly such an aggregation requires a high ATP concentration The effect is clearly ATP hydrolysis mediated since ATPcS can effectively abrogate the same We are currently trying to understand the importance of high ATP in such a phenomenon that might implicate the existence of putative low affinity ATP binding sites in the system The phenomenon of MutS aggregation in relation to DNA binding has been well described in the literature For example, a very early study by Su and Modrich [32] showed that the mismatch bound form of MutS was highly oligomeric in nature Subsequent footprinting studies further corroborated extensive coverage of heteroduplexes by MutS protein in ATP specific conditions [20,24] More recent AFM analysis by Hall et al [33] of Mlh1–Pms1 heterodimers from Saccharomyces cerevisiae bound to duplex targets showed the high propensity of the mismatch repair proteins to extensively coat the DNA by cooperative binding, sometimes interacting simultaneously with different DNA targets thereby generating large intermolecular complexes of the type described in the current study Mismatch induced aggregation of MutS in relation to current models of MMR All of these independent solution assays point to a novel property of the system where MutS ⁄ MutL exhibits a propensity to aggregate into large particles 6239 Hydrodynamic analyses of MutS aggregates selectively in the presence of a single mismatch and high ATP It is highly likely that such an intrinsic property of MutS to recognize and amplify mismatch signals could indeed be used by the cells in the context of MMR Current models of MMR are rather sketchy: it is unclear how the signal of a mismatch transduces to its adjacent hemimethylated GATC tract over a long distance The prevailing competing models based on a large body of biochemical data from E coli as well as eukaryotic MutS ⁄ MutL proteins invoke either ATP-hydrolysis dependent translocation of MutS ⁄ MutL [17,18] or ATP hydrolysis independent passive sliding clamp of MutS ⁄ MutL [9,19,22] or alternatively, MutS ⁄ MutL complex stationed at mismatch cross-talking through space with the GATC tract sites [20,21] A variation of the first model proposed by others and us invokes a near complete coverage of mismatch containing DNA by MutS through a ‘treadmilling action’ of the protein that is highly ATP hydrolysis dependent [23,24] The current study, demonstrating a mismatch specific highly aggregated state of MutS encompassing bound heteroduplex DNA, is strongly consistent with this model, where the presence of a mismatch can be relayed across large distances thereby cross-talking with GATC-specific excision steps In addition, the massively aggregated MutS-heteroduplex complexes might reflect the propensity of the system that finally culminate into MutS foci formation at the sites of DNA mismatch repair in the cells [25] We conjecture that a requirement of high ATP for such massive aggregation of MutS in vitro might reflect how this property of MutS might elegantly couple MMR to the regions of the replication fork, when a high local concentration of dNTPs force a\high level of basemismatch incorporations by DNA polymerase, especially when the exonucleolytic proof-reading function of N Nag et al the polymerase is compromised [34,35] Future studies encompassing AFM imaging will address the mechanistic basis of how high ATP induces MutS aggregation on DNA that is so specific of a single mismatch on a long duplex tract, and map the long distance propagation of mismatch-specific MutS cues, an important aspect of MMR pathway Experimental procedures Materials ATP was from Sigma-Aldrich (Munich, Germany) ATPcS was from Roche Diagnostics (Penzberg, Germany), Bradford reagent was from Bio-Rad (Hercules, CA), Fluorescamine was from Molecular Probes (Eugene, OR) Oligonucleotides were from DNA technology (Aarhus C, Denmark) Sep-Pak C-18 cartridge was from Waters Corporation (Milford, MA, USA), and 0.02 lm 13 mm Anodisc filter was from Whatman International Ltd (Maidstone, Middlesex, UK) DNA substrate All oligonucleotides used in this study were purified by electrophoresis on a 10% denaturing polyacrylamide gel containing m urea The full-length oligonucleotide was excised from the gel and eluted into autoclaved buffer (10 mm Tris ⁄ HCl pH 8.0, mm EDTA) by diffusion, followed by desalting through a Sep-pak C-18 cartridge [36] Final concentration of purified DNA was determined by measuring the absorbance of an aliquot at 260 nm The concentrations expressed pertain to that of molecules DNA substrates used in all assays were a single G.T-mismatched duplex (121 bp) (Heteroduplex) and its corresponding G.C-matched duplex (Homoduplex), the names and their corresponding sequences are given in Table Table Names and lengths of the oligonucleotide sequences used for preparing either heteroduplexs (G.T mismatch at the centre) or the corresponding homoduplexes (the position of mismatch and the corresponding normal match are highlighted by bold and underline) Name Size (nt) Sequence CLL 121 GTL 121 GCL 121 CLE GTE GCE CLS GTS GCS 61 61 61 16 16 16 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TAGGTACGGTCCATGC-3¢ 5¢-GCATGGATCGTACCTA-3¢ 5¢-GCATGGACCGTACCTA-3¢ 6240 FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS N Nag et al Annealing between CLL and GTL strands forms a 121mer duplex with G.T mismatch at the 61st base from 5¢ end of CLL and the corresponding Watson–Crick matched homoduplex is formed by annealing the CLL with the GCL strand Similarly, annealing between the and GTE strands forms a 61-mer duplex with a G.T mismatch at the 31st base from the 5¢ end of CLE, whereas a corresponding homoduplex is formed by annealing CLE with GCE Annealing between CLS and GTS strands forms a 16-mer duplex with G.T mismatch at the ninth base from the 5¢ end of CLS and the corresponding homoduplex is formed by annealing CLS and GCS Protein purification The MutS clone was from L Worth, NIEHS The mutS gene is in His-tag expression vector pQE30 The protocol followed to purify MutS is as described [37] The His-tag was not cleaved from the protein, as it does not seem to alter the biochemical properties of MutS [29] The MutL clone was obtained from M Winkler, and the His-tagged MutL was purified as described [37] Protein concentrations were measured using Bradford Reagent All protein concentrations expressed pertain to protein dimers DNA labelling and annealing Labelling of DNA with 32P at 5¢ end was performed as described [38] Complementary strands (see Table 2) were annealed at a : ratio (10 lm of each strand in a total volume of 20 lL) in 20 mm Tris ⁄ HCl pH 7.5 and 10 mm MgCl2 by heating the sample for at 90 °C, followed by slow cooling to room temperature Analysis of an aliquot of annealed sample on native polyacrylamide gel revealed that the annealed duplex was well resolved from the single-stranded controls and annealing was achieved with > 90% of efficiency MutS–DNA complex formation MutS–DNA complexes are formed by adding duplex DNA (homo- or heteroduplex) to MutS in buffer (50 mm Hepes pH 7.5, 50 mm KCl, mm MgCl2, mm dithiothreitol), followed by incubation of the sample for 10 at room temperature (% 22 °C) Similarly, MutS–MutL-DNA complexes are formed by adding duplex DNA to a mixture containing MutS and MutL In experiments involving nucleotide cofactors such as ATP or ATPcS, MutS-DNA (or MutS–MutL-DNA) complexes were first formed, followed by the addition of nucleotide cofactors In experiments involving only MutL, the protein was analysed in the same buffer Concentrations and time ⁄ temperature of incubations are as specified FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS Hydrodynamic analyses of MutS aggregates Fluorescence labelling of MutS with fluorescamine Fluorescamine is nonfluorescent until its coupling to primary amines [39] MutS was labelled with fluorescamine in the molar ratio of 10 : with respect to the protein in buffer C (20 mm Na-phosphate pH 8.0, 50 mm KCl and mm MgCl2), incubated for 15 in the dark at °C The unreacted fluorophore reacts with water giving rise to nonfluorescent product and thus eliminating the need for removal [36] Steady-state fluorescence measurements were carried out using a SPEX fluorolog FL111 Fluorimeter in T-format, with the excitation wavelength set at 380 nm monitoring the changes in fluorescence intensity at 477 nm The binding isotherm was fitted to the following equation: Fobs ẳ ỵ ẵMutL2 Fmax 1ị ẵMutL2 ỵ Kd 1ị where Fobs is fluorescence intensity, Fmax is fluorescence intensity at the end of the reaction, [MutL2]0 is total concentration of MutL dimer (Free and MutS-MutL complex) present and Kd is dissociation constant During the titration of fluorescamine-labelled MutS with MutL (Fig 1B), it was ensured that the observed decrease in fluorescence intensity is not due to any bleaching effect by minimizing the exposure time and by checking with control samples DLS: measurement of hydrodynamic radius DLS experiments were performed at 22 °C on a DynaProMS800 dynamic light scattering instrument (Protein Solutions Inc., VA) with an inbuilt Laser at 820 nm, by monitoring the scattered light at 90° with respect to irradiation direction Buffer solutions were filtered carefully through 20 nm filters (Whatman Anodisc 13) to remove dust particles The particulate matter, if any, in the DNA and protein samples was removed by centrifugation (13 800 g) in a tabletop Eppendorf Centrifuge at °C for 10 For particles undergoing simple Brownian motion, the autocorrelation function G(s) associated with the scattered light intensity is given as: Gsị ẳ < Itị:It ỵ sị > ẳ ỵ expDq2 sị < I >2 2ị where I(t) and I(t+s) are the intensity of scattered light at any time t and t+s, respectively, with s being the delay time The angle bracket represents averaging over various times t is the time-averaged scattered intensity D, the translational diffusion constant, is given by StokesEinstein relationship: kT Dẳ 3ị 6pgRh where k is Boltzman constant, g is the viscosity and Rh is the hydrodynamic radius of the diffusing particle at 6241 Hydrodynamic analyses of MutS aggregates N Nag et al temperature T q, the modulus of the wave vector is given by:  4pg qẳ sinh 2ị 4ị k where g, k and h are the refractive index, wavelength of the irradiation source and the scattering angle, respectively When the system is polydisperse in size, G(s) is given by: Gsị ẳ ỵ k X Cj expDj q2 sị 5ị jẳ1 where Dj is the translational diffusion constant of the jth j species with hydrodynamic radius Rh Cj gives the fractional th contribution of the j species to the scattered intensity The observed autocorrelation curves (at least 10 collections each collected for 10 s) were analysed either by ‘Regularization’ software or ‘DynaLS’ software provided by the manufacturer of the instrument to generate a distribution of Rh The quality of each individual autocorrelation curve was scrutinized by monomodel analysis before being subjected to either ‘Regularization’ or DynaLS analysis of the entire set (¼ 10) of curves The goodness of the fit by DynaLS software was evaluated by visual inspection of residual distribution (random and featureless residual distribution represents acceptable fit) and residual value (ResSTD < 0.001) Synthetic beads of nm diameter (provided by Protein Solutions Inc., Charlottesville, VA, USA) and BSA (3 nm) were used as standards In these cases, the recovered distributions were single narrow Gaussian distributions with peak value of Rh at 6.0 or 3.0 nm, respectively In these monodisperse samples, the width associated with distribution of Rh values could be taken as limiting widths controlled mainly by the S ⁄ N of measurement Widths significantly higher than these values could then be taken to represent the actual polydispersity of the sample Furthermore, analysis of G(s) by Eqn (5) assumes the particles as hard spheres Hence the recovered Rh value could be interpreted as follows: the translational dynamics of the particle being studied is similar to that of a hard sphere of radius Rh A typical DLS experiment involves the addition of reaction buffer (50 lL; 50 mm Hepes pH 7.5, 50 mm KCl, mm MgCl2, mm dithiothreitol or other buffers as specified in the respective figure legends)to the quartz cuvette, followed by ascertaining that the buffer system is free of particles as reflected by very low Rh (0.1–0.2 nm) values associated with it A small aliquot (1–2 lL) of stock protein sample (MutS ⁄ MutS–MutL), that is cleared of particles by prior centrifugation (as described above), is added to the buffer (the final concentration of protein dimer was 0.15 lm or as specified in the legend), followed by collection of light scattering autocorrelation curves to obtain distribution of Rh In experiments involving MutS interaction with DNA, the change in protein Rh was monitored, in real time, following the addition of either hetero or homoduplex 6242 DNA (1–2 lL) with either ATP or ATPcS (1–2 lL) (see legends for details) Centrifugation assay Samples (typically 25 lL) containing either free MutS protein or MutS-DNA complexes (prepared as described in the respective Legends) were centrifuged at 13 800 g in a tabletop Eppendorf Centrifuge at °C for 20 A fixed volume of sample retrieved from the supernatant and the pellet retrieved after complete removal of the supernatant were denatured in buffers containing SDS, followed by analyses of protein and DNA on either SDS ⁄ PAGE or native PAGE (see legends for details) References Modrich P & Lahue R (1996) Mismatch repair in replication fidelity, genetic recombination and cancer biology Annu Rev Biochem 65, 101–133 Harfe BD & Jinks-Robertson S (2000) DNA mismatch repair and genetic instability Annu Rev Genet 34, 359–399 Minnick DT & Kunkel TA (1996) DNA synthesis error, mutator and cancer Cancer Survey 28, 3–20 Kolodner R (1996) Biochemistry and genetics of eukaryotic mismatch repair Genes Dev 10, 1433–1442 Umar A & Kunkel TA (1996) DNA replication fidelity, genetic recombination and cancer cell Eur Biochem 238, 297–307 Jiricny J & Marra G (2003) DNA repair defects in colon cancer Curr Opin Genet Dev 13, 61–69 Schofield MJ & Hsieh P (2003) DNA Mismatch Repair: Molecular Mechanisms and Biological Function Annu Rev Microbiol 57, 579–608 Su SS, Lahuae RS, Au KG & Modrich P (1988) Mispair specificity of methyl directed DNA mismatch correction in vitro J Biol Chem 263, 6829–6835 Gradia S, Acharya S & Fishel R (1997) The human mismatch recognition complex hMSH2-hMSH6 functions as a novel molecular switch Cell 91, 995–1005 10 Cooper DL, Lahue RS & Modrich P (1993) Methyl directed mismatch repair is bidirectional J Biol Chem 268, 11823–11829 11 Buermeyer AB, Deschenes SM, Baker SM & Liskay RM (1999) Mammalian DNA mismatch repair Annu Rev Genet 33, 533–564 12 Yang W (2000) Structure and function of mismatch repair proteins Mutat Res 460, 245–256 13 Hopfner KP & Tainer JA (2000) DNA mismatch repair: the hands of a genome guardian Struct Folding Design 8, R237–R241 14 Lamers MH, Perrakis A, Enzlin JH, Winterwerp HHK, Wind N & Sixma TK (2000) The crystal structure of DNA mismatch repair protein MutS binding to G.T mismatch Nature 407, 711–717 FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS N Nag et al 15 Obmolova G, Ban C, Hsieh P & Yang W (2000) Crystal structures of mismatch repair protein MutS and its complex with a substrate DNA Nature 407, 703–710 16 Wang H, Yang Y, Schofield MJ, Du C, Fridman Y, Lee SD, Larson ED, Drummond JT, Alani E, Hsieh P & Erie D (2003) DNA bending and unbending by MutS govern mismatch recognition and specificity Proc Natl Acad Sci USA 100, 14822–14827 17 Allen DJ, Makhov A, Grilley M, Taylor J, Thresher R, Modrich P & Griffith JD (1997) MutS mediates heteroduplex loop formation by a translocation mechanism EMBO J 16, 4467–4476 18 Blackwell LJ, Martik D, Bjornson KP, Bjornson ES & Modrich P (1998) Nucleotide-promoted release of hMutSalpha from heteroduplex DNA is consistent with an ATP-dependent translocation mechanism J Biol Chem 273, 32055–32062 19 Gradia S, Acharya S & Fishel R (2000) The role of mismatched nucleotides in activating the hMSH2-hMSH6 molecular switch J Biol Chem 275, 3922–3930 20 Schofield MJ, Nayak S, Du Scott TH, C & Hsieh P (2001) Interaction of Escherichia coli MutS and MutL at a DNA Mismatch J Biol Chem 276, 28291–28299 21 Junop MS, Obmolova G, Rausch K, Hsieh P & Yang W (2001) Composite active site of an ABC ATPase: MutS uses ATP to verify mismatch recognition and authorize DNA repair Mol Cell 7, 1–12 22 Selmane T, Schofield MJ, Du Nayak S, C & Hsieh P (2003) Formation of a DNA mismatch repair complex mediated by ATP J Mol Biol 334, 949–965 23 Blackwell LJ, Wang S & Modrich P (2001) DNA chain length dependence of formation and dynamics of hMutSalpha.hMutLalpha.heteroduplex complex J Biol Chem 276, 33233–33240 24 Joshi A & Rao BJ (2002) ATP hydrolysis induces expansion of MutS contacts on heteroduplex: a case for MutS treadmilling? Biochemistry 41, 3654–3666 25 Smith BT, Grossman AD & Walker GC (2001) Visualization of mismatch repair in bacterial cells Mol Cell 8, 1197–1206 26 Bjornson KP, Blackwell LJ, Harvey S, Batinger C, Allen D & Modrich P (2003) Assembly and molecular activities of MutS tetramer J Biol Chem 278, 34667– 34673 FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS Hydrodynamic analyses of MutS aggregates 27 Wu H-T & Marinus MG (1999) Deletion mutation analysis of the mutS gene in Escherichia coli J Biol Chem 274, 5948–5952 28 Grilley M, Welsh KM, Su S-S & Modrich P (1989) Isolation an Characterisation of Escherichia coli mutL J Biol Chem 264, 1000–1004 29 Worth L Jr, Bader T, Yang J & Clark S (1998) Role of MutS ATPase activity in MutS,1-dependent block of in vitro strand transfer J Biol Chem 273, 23176–23182 30 Antony E & Hingorani MM (2003) Mismatch recognition-coupled stabilisation of Msh2-Msh6 in an ATPbound state at the initiation of DNA Repair Biochemistry 42, 7682–7693 31 Bjornson KP, Allen DJ & Modrich P (2000) Modulation of MutS ATP Hydrolysis by DNA Cofactors Biochemistry 39, 3176–3183 32 Su S-S & Modrich P (1986) Escherichia coli mutSencoded protein binds to mismatched DNA base pairs Proc Nati Acad Sci USA 83, 5057–5061 33 Hall MC, Wang H, Erie DA & Kunkel TA (2001) High affinity cooperative DNA binding by the yeast Mlh1Pms1 heterodimer J Mol Biol 312, 637–647 34 Bebenek K, Matsuda T, Masutani C, Hanaoka F & Kunkel TA (2001) Proofreading of DNA polymerase g-dependent replication errors J Biol Chem 276, 2317– 2320 35 Baker RO & Hall JD (1998) Impaired mismatch extension by a herpes simplex DNA Polymerase mutant with an editing nuclease defect J Biol Chem 273, 24075– 24082 36 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 11.39 37 Feng G & Winkler M (1995) Single step purification of Hi66-MutH, Hi66-MutL and Hi66-MutS repair proteins of Escherichia coli Biotechniques 19, 956–965 38 Joshi A, Sen S & Rao BJ (2000) ATP-hydrolysis-dependent conformational switch modulates the stability of MutS–mismatch complexes Nucl Acids Res 28, 53–861 39 Nakaya K, Yabuta M, Iinuma F, Kinoshita T & Nakumara Y (1975) luorescent labelling of the surface proteins of Erythrocyte membranes using cycloheptaamylose-fluorescamine complex Bioc Biop Res Com 67, 760–766 6243 ... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢