Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

... Hydrodynamic analyses of MutS aggregates A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein -DNA complexes Nabanita Nag 1 , G. Krishnamoorthy 1 and Basuthkar ... underline). Name Size (nt) Sequence CLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCG ATTTCGACACAATTTATCAGGCGAG...

Ngày tải lên: 07/03/2014, 12:20

... important information in the knowledge of RNase II proteins. To date, there are no structural or mutational data available from any other proteins of the family. The SK4803 strain is par- ticularly ... indi- cating that the loss of activity in the mutant protein cannot be restored by increasing the Mg 2+ concentra- tion. RNA binding ability of RNase II and the D209N...

Ngày tải lên: 30/03/2014, 15:20

... from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domain that contains an essential Ca 2+ - binding site in the mammalian enzymes and are thermally Fig. ... quadrivirgata , E. climacophora and A. blomhoffii DNases I Total RNA was isolated from each snake pancreas by the acid guanidinium thiocyanate/phenol/chloroform method [24] and any...

Ngày tải lên: 20/02/2014, 23:20

... Ca 2+ signal change and the accompa- nying conformational change in the canonical EF-hand are probably relayed to the SAM domain via the paired ‘hidden’ EF-hand, resulting in the oligomeriza- tion of ... the insertion of the helix–loop–helix EF-hand domain from STIM1, the helical content of the engineered protein CD2.STIM1.EF increased, indicating that the insert...

Ngày tải lên: 07/03/2014, 00:20

... of the psbA mRNA is not affected in the mf2 strain The dramatic decrease in D1 synthesis in mf1 and mf2 strains did not correlate with any significant changes in the accumulation of psbA mRNA, as ... C-3¢, and Acod (reverse): 5¢-CGC GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA GT-3¢,andtheEcoRI restriction fragment of the chloroplast genome R14 [16] as a templa...

Ngày tải lên: 07/03/2014, 15:20

... of the crystal structures indicates that the side chain of K109 plays a dual role by forming a salt bridge to D137, as well as stabilizing a glycine-rich loop in the vicinity of the FMN cofactor. ... velocity measurements in the presence of NADPH as the electron donor and 2-hydroxy-p-naphthoquinone as electron acceptor. The family of parallel lines obtained f...

Ngày tải lên: 30/03/2014, 01:20

... [34]) as a standard. The amounts of chromatophores and standard protein in the different lanes of a single gel were kept in the linear range of the luminol assay response. Light-induced ATP synthesis Light-driven ... ates obtained in the absence of a Du. In this case, the impairment of the ATP synthesis rates in th e mutant was higher than twofold, es...

Ngày tải lên: 21/02/2014, 03:20

... restrictions gov- erning the combination of features and values in feature specifications; the definition of the value range of a feature can thus be regarded as another special case of cooccurrence ... recognition of the need for explicit characterizations of the properties that relate and distinguish similar grammar formalisms. The paper proposes a series...

Ngày tải lên: 22/02/2014, 10:20

... demon- strate a strong conservation in the binding of C-terminal binding protein- interacting domains despite great variability in their amino acid sequences. Finally, this L22 5A point mutation could also ... with the structural data and the universal conservation of this residue in all C-terminal binding pro- tein-interacting motifs, mutation of the central leucine re...

Ngày tải lên: 23/03/2014, 10:21

... For the detection of the unspliced pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used. Quantification ... mutagenesis (Stratagene, La Jolla, CA, USA) using the proofreading DNA polymerase KOD plus (Toyobo, Osaka, Japan). Deletion mutants are indicated by a ‘D’ prefix and substitut...

Ngày tải lên: 28/03/2014, 23:20