Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx

A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP Nicolas Stankovic-Valentin 1, *, Alexis Verger 2 , Sophie Deltour-Balerdi 1,† , Kate G. R. Quinlan 2 , Merlin Crossley 2 and Dominique Leprince 1, * 1 CNRS UMR 8526, Institut de Biologie de Lille, Institut Pasteur de Lille, France 2 School of Molecular and Microbial Biosciences, University of Sydney, New South Wales, Australia HIC1 (hypermethylated in cancer 1) encodes a tran- scriptional repressor and is located in 17p13.3 in a region frequently hypermethylated or deleted in many types of prevalent human tumour [1]. HIC1 is a tumour suppressor gene, since heterozygous HIC1 + ⁄ – mice develop, after 70 weeks, a gender-dependent spec- trum of spontaneous malignant tumours [2]. HIC1 is a direct target gene of P53 [1,3,4]. Moreover, elegant animal models using Hic1 and p53 double heterozy- gous knockout mice have shown that the epigenetically silenced gene, Hic1, cooperates with the mutated tumour suppressor gene Trp53 in determining cancer Keywords 17p13.3; CtBP; HIC1; Miller–Dieker syndrome; transcriptional repression Correspondence D. Leprince, CNRS UMR 8161, Institut de Biologie de Lille, Institut Pasteur de Lille, 1 Rue Calmette, 59017 Lille Cedex, France Fax: +33 3 20 87 1111 Tel: +33 3 20 87 1119 E-mail: dominique.leprince@ibl.fr Present address *CNRS UMR 8161, Institut de Biologie de Lille, Institut Pasteur de Lille, France †Wellcome Trust, University of Cambridge, UK (Received 3 March 2006, revised 27 April 2006, accepted 2 May 2006) doi:10.1111/j.1742-4658.2006.05301.x HIC1 (hypermethylated in cancer) is a tumour suppressor gene located in 17p13.3, a region frequently hypermethylated or deleted in many types of prevalent human tumour. HIC1 is also a candidate for a contiguous-gene syndrome, the Miller–Dieker syndrome, a severe form of lissencephaly accompanied by developmental anomalies. HIC1 encodes a BTB ⁄ POZ-zinc finger transcriptional repressor. HIC1 represses transcription via two auton- omous repression domains, an N-terminal BTB ⁄ POZ and a central region, by trichostatin A-insensitive and trichostatin A-sensitive mechanisms, respectively. The HIC1 central region recruits the corepressor CtBP (C-ter- minal binding protein) through a conserved GLDLSKK motif, a variant of the consensus C-terminal binding protein interaction domain PxDLSxK ⁄ R. Here, we show that HIC1 interacts with both CtBP1 and CtBP2 and that this interaction is stimulated by agents increasing NADH levels. Further- more, point mutation of two CtBP2 residues forming part of the structure of the recognition cleft for a PxDLS motif also ablates the interaction with a GxDLS motif. Conversely, in perfect agreement with the structural data and the universal conservation of this residue in all C-terminal binding pro- tein-interacting motifs, mutation of the central leucine residue (leucine 225 in HIC1) abolishes the interaction between HIC1 and CtBP1 or CtBP2. As expected from the corepressor activity of CtBP, this mutation also impairs the HIC1-mediated transcriptional repression. These results thus demon- strate a strong conservation in the binding of C-terminal binding protein- interacting domains despite great variability in their amino acid sequences. Finally, this L225A point mutation could also provide useful knock-in ani- mal models to study the role of the HIC1–CtBP interaction in tumorigenesis and in development. Abbreviations AD, activation domain; CID, CtBP-interacting domain; CR, central region; CtBP, C-terminal binding protein; DBD, DNA-binding domain; EMT, epithelial-to-mesenchymal transition; HDAC, histone deacetylase; HPE, holoprosencephaly; KI, knock-in; MDS, Miller–Dieker syndrome; TSA, trichostatin A. FEBS Journal 273 (2006) 2879–2890 ª 2006 The Authors Journal compilation ª 2006 FEBS 2879 progression and spectrum [5]. Finally, a circular regu- latory loop has been proposed for HIC1, SIRT1 and p53, since HIC1 represses the transcription of SIRT1, SIRT1 deacetylates P53, thus negatively modulating its DNA-binding properties, and P53 transactivates HIC1 [6]. Besides its role in tumorigenesis, HIC1 is essential during development and is also a candidate for a conti- guous-gene syndrome, the Miller–Dieker syndrome (MDS), a severe form of lissencephaly accompanied by developmental anomalies [7]. HIC1 is located within the critical 350 kbp region deleted in most patients [8], and together with perinatal death and a reduction in overall size, Hic1 – ⁄ – mouse embryos have many developmental defects resembling those found in MDS patients [9]. In addition, parts of Hic1 expression territories in mice embryos and in zebrafish strikingly overlap with regions that exhibit abnormalities in MDS patients, e.g. cranio- facial and limb mesenchymes [10,11]. The HIC1 protein is a sequence-specific transcrip- tional repressor containing three main functional domains: a conserved protein–protein interaction domain called BTB⁄ POZ at the N-terminus, five Kru ¨ ppel-like C 2 H 2 zinc fingers near its C-terminus, and a central region, which is not well-conserved among the HIC1 and the paralogous HRG22 proteins from various species (Fig. 1) [12–14]. HIC1 binds specifically to DNA through its zinc finger domain, which recogni- zes the recently defined consensus sequence 5¢- C ⁄ G NG C ⁄ G GGGCA C ⁄ A CC-3¢ [15]. The BTB ⁄ POZ domain is a conserved structural motif found mainly in transcription factors, actin-binding proteins and substrate-specific adapters of CUL-3-based ubiquitin ligases [16]. The BTB ⁄ POZ domain is essential for the function of transcriptional repressors by directly recruiting nuclear corepressor (SMRT, N-CoR or B-CoR)–histone deacetylase complexes (HDACs), as shown for the human PLZF and BCL6 proteins [17,18]. Previously, we have shown that the HIC1 and HRG22 BTB ⁄ POZ domains are autonomous trans- criptional repression domains, unable to recruit class I or II HDACs, since they are insensitive to the specific inhibitor trichostatin A (TSA) [12,13]. The HIC1 central region is also an autonomous transcriptional repression domain, which recruits the corepressor C-terminal binding protein 1 (CtBP1) [19,20] and represses transcription in a TSA-sensitive manner [14]. Notably, HIC1 recruits CtBP1 through a short phylo- genetically conserved sequence, GLDLSKK, slightly divergent from the canonical CtBP-interacting domain (CID) containing a PxDLSxK ⁄ R motif found in virtu- ally all CtBP-interacting proteins [11,14,20]. The vertebrate genomes contain two different genes, CtBP1 and CtBP2, widely expressed in normal human tissues and cancer cell lines as well as throughout development in mice [21]. These genes encode at least four protein isoforms, including the corepressors CtBP1 and CtBP2. These two proteins have partially redundant functions. For example, during murine development, Ctbp1 is poorly detectable in the extra- embryonic structures that express Ctbp2. Furthermore, mouse Ctbp2 – ⁄ – embryos die between E9 and E10.5 due to defects, notably in formation of the placenta and neural ectoderm [21]. In contrast, Ctbp1 – ⁄ – mice are viable although they exhibit reduced fitness and fertility [21]. CtBP1 is both cytoplasmic and nuc- lear, and this subcellular localization is regulated by interplay between post-transcriptional modifications (SUMOylation and phosphorylation) and binding to neural nitric oxide synthase, a PDZ domain-containing protein [22,23]. In contrast, CtBP2 is mainly nuclear, due to a specific N-terminal 20 amino acid region containing Lys residues acetylated by P300 [24,24a]. Finally, CtBP1 is SUMOylated by PIAS1 and PIASxb on Lys428, which is not conserved in CtBP2 [23], whereas SUMOylation of CtBP2 on a nonconsensus targeting motif requires the presence of Pc2 as an E3 ligase [25]. In this article, we demonstrate that HIC1 can inter- act with both CtBP1 and CtBP2. This interaction relies on a GxDLS motif that is slightly divergent from the PxDLS consensus motif found in most CtBP-interact- ing proteins. Furthermore, point mutation of two CtBP2 residues forming part of the structure of the recognition cleft for a PxDLS motif also ablates the PLCGLDLSKKSPPGSAAP PLCGLDLSKKSPPGSSVP PPCGLDLSKKSPTGPSAQ SVYGLDLSKKSPNSQSQL PNYGLDLSKKSPSPNSQT ********* Hu HIC1 714 BTB/POZ Hu HIC1 Mu HIC1 Ck FBPB Zf HIC1b Fu HIC1 Cons 1 Zinc Fingers 225 CID 135 422 Fig. 1. Schematic drawing of the human HIC1 protein. The BTB ⁄ POZ domain and the five C 2 H 2 zinc fingers are represented as dotted and grey boxes, respectively. The evolutionarily conserved CtBP interaction domain (CID) [14] is represented as a dotted line, and its sequence in the various HIC1 proteins is shown. The central Leu (residue 225 in human HIC1), which is the sole invariant resi- due in all the CID motifs described so far, is highlighted in bold. In the consensus lane (Cons), identical residues are indicated by * under the aligned sequences. Hu, Human; Mu, Murine; Ck, Chicken; Zf, zebrafish (Danio rerio); Fu, Fugu rubipres. HIC1 interacts with CtBP N. Stankovic-Valentin et al. 2880 FEBS Journal 273 (2006) 2879–2890 ª 2006 The Authors Journal compilation ª 2006 FEBS interaction with a GxDLS motif. Conversely, mutation of the central Leu residue (Leu225 in HIC1), which is the sole invariant residue in all CtBP-interacting motifs known so far, also abolishes the interaction between HIC1 and CtBP1 or CtBP2. In close agreement with the corepressor activity of CtBPs, this mutation impairs the HIC1-mediated transcriptional repression. These results thus demonstrate a strong conservation in the recognition of the CtBP-interacting motifs despite great divergence in their amino acid sequences. Results HIC1 can interact with both CtBP1 and CtBP2 in vivo The vertebrate genomes contain two different genes, CtBP1 and CtBP2, that encode two highly related corepressors, CtBP1 and CtBP2, but with only parti- ally redundant functions. It is thus important to deter- mine if a given transcription factor can interact with both corepressors. The interaction between HIC1 and CtBP1 was first demonstrated through transient trans- fection assays and in a stably tranfected HIC1 cell line with inducible HIC1 expression [14]. We have recently shown that endogenous HIC1 proteins can be detected in a human medulloblastoma cell line, DAOY [15]. To fully validate the interaction between endogenous HIC1 and CtBPs, we performed coimmunoprecipita- tion experiments using DAOY total cell extracts and either normal rabbit immunoglobulins or the anti- HIC1 antibody. The immunoprecipitated proteins were divided into two equal parts, separated by SDS ⁄ PAGE and then immunoblotted with monoclonal antibodies to CtBP1 or CtBP2. CtBP1 was detected with the spe- cific CtBP1 monoclonal antibodies in the anti-HIC1 immunoprecipitates (Fig. 2A, top panel, lane 3) but not in control IgG immunoprecipitates (lane 2). In contrast, analyses of equal amounts from the same immunoprecipitates with the CtBP2 monoclonal anti- bodies yield only nonspecific bands, presumably due to the quality of the antibodies used (Fig. 2A, middle panel, lanes 2 and 3). Coimmunoprecipitation of DAOY nuclear extracts with the monoclonal or another commercial polyclonal CtBP2 antibody fol- lowed by western blotting with an anti-HIC1 antibody did not give better results, probably because CtBP2 is associated with numerous partners (data not shown). As control, HIC1 is detected in the anti-HIC1 immu- noprecipitates but not in control IgG immunoprecipi- tates (Fig. 2A, bottom panel). To confirm the interaction observed between endog- enous HIC1 and CtBP1 (Fig. 2A, top panel), we per- formed another coimmunoprecipitation experiment using a similar amount of DAOY total cell extracts and another HIC1 antibody, the polyclonal 325 anti- body directed against a C-terminal peptide of HIC1 or normal rabbit immunoglobulins. The total immunopre- cipitated proteins were separated by SDS ⁄ PAGE. After transfer, the membrane was separated into two parts. The upper part (proteins above 60 kDa) and the lower part were directly immunoblotted, respectively, with the HIC1 antibody and with the CtBP1 monoclo- nal antibody. CtBP1 was detected with the specific CtBP1 monoclonal antibodies in the anti-HIC1 immu- noprecipitates (Fig. 2B, lane 6) but not in control IgG immunoprecipitates (lane 5). As a further control, pro- teins immunoprecipitated from DAOY total extracts in stringent conditions (RIPA buffer) with anti-CtBP1, normal rabbit immunoglobulins or HIC1 polyclonal antibodies were loaded on the same gel (Fig. 2B, lanes 1–3). To determine if HIC1 can also interact with CtBP2 in vivo, we thus performed coimmunoprecipitation assays in COS7 cells transiently transfected with expression vectors encoding a FLAG version of human HIC1 and CtBP1 or CtBP2, alone or in combination. First, western blot analyses of total cell lysates with monoclonal antibodies directed against CtBP1 or CtBP2 demonstrated the specificity and the reactivity of these antibodies (Fig. 2C, top and middle panels; compare lanes 3 and 4). Immunoprecipitation of total cell extracts with the FLAG monoclonal antibody fol- lowed by immunoblot with the CtBP1 or CtBP2 monoclonal antibodies detected specific binding of HIC1 not only to CtBP1 as previously described (Fig. 2C, lane 11) but also to CtBP2 (Fig. 2C, lane 12) in cotransfected cells. CtBP has been proposed to be a redox sensor link- ing gene expression and metabolism. Indeed, CtBP binding to some, but not all, of its partners is potenti- ated by hypoxia or treatment with agents such as CoCl 2 , both of which increase the level of free NADH [26,27]. We therefore investigated the effect of CoCl 2 treatment on the interaction between HIC1 and CtBP1. COS7 cells were transfected with expression vectors for HIC1 and CtBP1 and treated with 200 lm CoCl 2 for 3 h before lysis. After immunoprecipitation with the HIC1 antibody, a significant increase in the amount of CtBP1 coimmunoprecipitated was observed in the presence of CoCl 2 (Fig. 2D; compare lanes 6 and 8), indicating that the interaction between HIC1 and CtBP1 is favoured in the presence of higher NADH levels. Thus, HIC1 can interact in vivo with both the CtBP1 and CtBP2 corepressors. N. Stankovic-Valentin et al. HIC1 interacts with CtBP FEBS Journal 273 (2006) 2879–2890 ª 2006 The Authors Journal compilation ª 2006 FEBS 2881 The integrity of the substrate-binding domain of CtBP2 is required for recognition of the GLDLSKK motif Crystal structure analyses of the substrate-binding domain of CtBP1 have highlighted crucial residues involved in the interaction with a PIDLSKK-like peptide. Notably, point mutations A41E or V55R, involving two residues that directly contact the PID- LSKK peptide, are sufficient to abolish the interaction between the E1A C-terminus and CtBP1 [28]. HIC1 is the first transcriptional factor known to recruit CtBP via a divergent GLDLSKK motif in which the Pro, which was considered to be an invariant A IP HIC1 (2563) Input 2% IgG WB: CtBP2 WB: CtBP1 CtBP1 * 1 2 3 HIC1 WB: HIC1 (325) B GgI IH ) 5 2 3 ( 1 C %2 tu p nI )523( 1CIH )8 21 1( 1P B tC G gI IP (RIPA Buffer) Co-IP (IPH Buffer) HIC1 CtBP1 WB: HIC1 (325) WB: CtBP1 (E-12) 1 2 3 456 C GALF 1CIH-GALF 1PBtC 2P BtC 1PBtC+1CIH-GALF 2PBtC+1CIH-GALF GALF 1CIH-GALF 1PBtC 2 P Bt C 1 PBtC+1CIH-GALF 2P B tC+1CIH-GALF WB: CtBP1 WB: CtBP2 WB: HIC1 (325) Input 5% 1 2 3 4 5 6 7 8 9 10 11 12 IP FLAG D + CtBP1 + CtBP1 G ALF 1 C IH -GA L F GALF 1CIH-GALF GAL F 1CIH - GAL F GALF 1 CIH-G A LF +CoCl 2 +CoCl 2 WB: CtBP1 WB: FLAG 1 2 3 4 5 6 7 8 Input 5% IP: HIC1(2563) Fig. 2. In vivo, HIC1 can interact with C-terminal binding protein 1 (CtBP1) or CtBP2. (A) Endogenous HIC1 and CtBP1 interact. DAOY cells were lysed with IPH buffer, and 2% of the lysates were kept as input (lane 1). Equal amounts of lysate were then immunoprecipitated with normal rabbit immunoglobulins (lane 2: IgG) or the rabbit HIC1 antibodies (lane 3: HIC1 (2563)). The immunoprecipates were divided in two and analysed in parallel by immunoblot with CtBP1 (top panel) or CtBP2 (middle panel) monoclonal antibodies. The anti-CtBP1 membrane was stripped and analysed with the HIC1 polyclonal antibodies as control (bottom panel). *Nonspecific band. (B) Endogenous HIC1 and CtBP1 interact. DAOY cells were lysed with RIPA buffer in stringent conditions, and lysates were immunoprecipitated with the rabbit CtBP antibodies (lane 1: aCtBP1(1128)) [38], with normal rabbit immunoglobulins (lane 2: IgG) or another rabbit HIC1 antibody (lane 3: aHIC1 (325)). The same amount of DAOY cells as used in (A) were lysed with IPH buffer, and 2% of the lysates were kept as input (lane 4). Equal amounts of lysate were then immunoprecipitated with normal rabbit immunoglobulins (lane 5: IgG) or the other rabbit HIC1 antibodies (lane 6: aHIC1 (325)). The immunoprecipates were loaded and analysed directly by immunoblot with the polyclonal HIC1 325 (top panel) or the monoclonal CtBP1 E-12 (bottom panel) antibodies. (C) In vivo, HIC1 interacts with either CtBP1 or CtBP2. COS7 cells were transfected with the above indicated expression vectors. Five per cent of each lysate was directly resolved by SDS ⁄ PAGE and immunoblotted with the indica- ted antibodies (input 5%, lanes 1–6). Each cell lysate was immunoprecipitated with the FLAG M2 antibody (IP FLAG, lanes 7–12). The immu- noprecipitates were then analysed by western blotting with a CtBP1 monoclonal antibody (top panel). The membrane was then stripped and reprobed with a CtBP2 polyclonal antibody (middle panel). Finally, the presence of HIC1 in the immunoprecipitates was confirmed by immu- noblotting with the HIC1 polyclonal antibody (lower panel). (D) Treatment with CoCl 2 increases the interaction between HIC1 and CtBP1. COS7 cells were transfected with the indicated expression vectors. Forty-eight hours after transfection, cells were either treated with 200 l M CoCl 2 or mock-treated for 3 h and lysed in IPH buffer. Immunoprecipitates were analysed by western blotting as described above with CtBP1 or FLAG monoclonal antibodies. HIC1 interacts with CtBP N. Stankovic-Valentin et al. 2882 FEBS Journal 273 (2006) 2879–2890 ª 2006 The Authors Journal compilation ª 2006 FEBS residue, is replaced by a Gly [14]. The interaction between HIC1 and CtBPs could thus involve residues different from those involved in the interaction via a consensus PIDLSKK peptide. To address this question, the equivalent point mutations were introduced by site- directed mutagenesis into CtBP2 [29] to yield A58E and V72R. Like wild-type (wt) CtBP2, these mutants are able to dimerize normally (data not shown). We first used the yeast two-hybrid assay to investigate the interaction between the central region (CR) of HIC1 (amino acids 135–422) and wt or mutant CtBP2. Yeast cotransformed with the HIC1 CR fused to the Gal4 DNA-binding domain (DBD) and the CtBP2 point mutants fused to the Gal4 activation domain (AD) were unable to grow on His-selective medium (Fig. 3A, right panel), similar to those transfected with the empty Gal4 vectors as negative control. As expected, the inter- action between the HIC1 CR and wt CtBP2 restores the growth on selective medium. These results were confirmed in the context of the full-length proteins by coimmunoprecipitation analyses after transient transfection in COS7 cells. In this assay, a strong interaction is observed between wt HIC1 and CtBP2 (Fig. 3B, lane 12), whereas the A58E and V72R point mutants fail to interact with HIC1 (Fig. 3B, lanes 14 and 16). Thus, binding of a CtBP-interacting partner contain- ing a PxDLS or a GxDLS motif is mediated by the same peptide recognition cleft in the CtBP N-terminal region. Point mutation of the only invariant residue in the CtBP-interacting domain is sufficient to abolish the HIC1–CtBP interaction Having established that the interaction between the HIC1 GxDLS motif and CtBP1 or CtBP2 occurs by binding to the same peptide cleft that binds typical A Gal4DBD Gal4DBD HIC1 CR SD-Leu -Trp SD-Leu -Trp -His Gal4AD Gal4AD CtBP2 Gal4AD CtBP2 A58E Gal4AD CtBP2 V72R Gal4DBD Gal4DBD HIC1 CR Gal4AD Gal4AD CtBP2 Gal4AD CtBP2 A58E Gal4AD CtBP2 V72R B GALF 1CIH-GALF 2PBtC 2PBtC + 1CIH-G A L F E85A 2PB t C E85A 2PBtC + 1CIH-GALF R27V 2PBtC R 27V 2 PBt C + 1CIH-GALF GALF 1 C IH-G ALF 2 P BtC 2PBtC + 1 C IH-GALF E8 5 A 2PB t C E8 5 A 2PBt C + 1CI H- G A L F R 27 V 2 P B t C R 27V 2 PB tC + 1 C I H -GALF * 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 WB:CtBP2 WB: HIC1 Input 5% IP HIC1 (2563) Fig. 3. The GLDLSKK motif of HIC1 con- tacts the same residues in CtBP2 as the consensus PIDLSKK motif. (A) In yeast two- hybrid assays, CtBP2 A58E and CtBP2 V72R fail to interact with the central region of HIC1. The yeast two-hybrid assay was used to assess the interaction between the central region of HIC1 containing the GLDLSKK motif and murine CtBP2 mutants A58E and V72R. Yeast cotransformed with the plasmids shown grew on SD-Leu-Trp media (left panel). These transformants were patched onto SD-Leu-Trp-His selective media (right panel). Growth after 48 h at 30 °C is shown. (B) Effect of the CtBP2 mutants A58E or V72R on HIC1–CtBP2 inte- raction in vivo. COS7 cells were transfected with the indicated expression vectors. Forty- eight hours after transfection, cells were directly lysed in IPH buffer. Five per cent of each lysate was directly resolved by SDS ⁄ PAGE and immunoblotted with the indicated antibodies to control for HIC1 and CtBP2 protein expression (input 5%, lanes 1–8). Lysates were immunoprecipitated with anti- HIC1 (lanes 9–16) and analysed by western blotting with anti-CtBP2 (upper panel) and with HIC1 polyclonal antibody (lower panel). *Nonspecific band detected by anti-CtBP2 in each extract under the conditions used. N. Stankovic-Valentin et al. HIC1 interacts with CtBP FEBS Journal 273 (2006) 2879–2890 ª 2006 The Authors Journal compilation ª 2006 FEBS 2883 PxDLS-containing partners, we next investigated the role of the central Leu in the HIC1 GxDLS motif, which is now the sole invariant residue in the CID. This Leu was thus mutated to Ala (mutation L225A) to yield a GxDAS motif (Fig. 4A). We first conducted mammalian two-hybrid assays in rabbit kidney cells (RK13). Chimeras between the Gal4 DBD and a trun- cated CR of HIC1 (amino acids 135–296) [14] contain- ing or not containing the L225A point mutation were tested for their ability to interact with full-length CtBP1 fused to the VP16 AD. A chimera between the Gal4 DBD and the HIC1 BTB ⁄ POZ domain was used as a negative control (Fig. 4A, lane 2). As previously described [14], this truncated CR of HIC1 strongly interacts with CtBP1 (Fig. 4A, lane 3), whereas the point mutation of the central Leu to Ala abolished this interaction (Fig. 4A, lane 4). These results were obtained using the isolated CR of HIC1. To confirm the essential role of the central Leu225 in the context of the full-length protein, we next performed coimmunoprecipitation experiments. As shown above, the full-length HIC1 protein can interact with CtBP1 (Fig. 4B, lane 4) or CtBP2 (Fig. 4C, lane 5), whereas the L225A point mutant is unable to interact with CtBP1 (Fig. 4B, lane 6) or CtBP2 (Fig. 4C, lane 6). In conclusion, mutation of Leu225 of the GLD LSKK motif in the HIC1 CID domain into an Ala (GLDASKK) is sufficient to abolish the interac- tion between HIC1 and CtBP1 or CtBP2 in vivo. The HIC1 central region functions as a CtBP-dependent and CtBP-independent autonomous repression domain We next investigated the importance of this L225A point mutation for the transcriptional repression prop- erties of the whole CR of HIC1. To that end, the entire domain (amino acids 135–422) located between the BTB ⁄ POZ domain and the first zinc finger motif was cloned in frame with the Gal4 DBD and tested in the Gal4 repression assay. Upon transient transfection into RK13 cells, Gal4-HIC1 (135–422) efficiently repressed the expression of a reporter gene containing five Gal4-binding sites (Fig. 5A, lane 2). Notably, the L225A mutation, which abolishes the interaction with CtBP1 and CtBP2 (Fig. 4B,C), significantly reduced but did not totally abolish the repression potential of the CR (Fig. 5A, lane 3). CtBP is found in a large multiprotein complex con- taining HDACs [30]. When these experiments were performed in the presence of TSA, a specific inhibitor of class I and class II HDACs, the repression exhibited both by the wt and the L225A chimeras was signifi- cantly reduced (Fig. 5A). A similar effect was observed, albeit to a lesser extent, when the repression of the wt and L225A full- length HIC1 proteins were tested on a Luc reporter gene driven by the recently defined HIC1-responsive element, 5xHiRE [15] (Fig. 5B). This relatively mild effect on repression is probably explained by the pres- ence of the BTB ⁄ POZ domain, which is another potent autonomous repression domain. Thus, the HIC1 CR represses transcription through CtBP-dependent and CtBP-independent mechanisms and involves the recruitment of class I or class II HDACs. Discussion In this report, we demonstrate that the tumour sup- pressor gene and transcriptional repressor HIC1 inter- acts with the related but not fully functionally redundant CtBP1 and CtBP2 corepressors in vivo and that this interaction is regulated by CoCl 2 , hence connecting the HIC1-mediated repression to NAD + ⁄ NADH levels and hypoxia. Moreover, mutation of the invariant Leu residue, L225A, is sufficient to disrupt the interaction between HIC1 and CtBPs. CtBPs have been previously shown to bind to repres- sion domains in a number of transcription factors and other regulatory proteins. In the vast majority of CtBP partner proteins, a PxDLS motif has been shown to be the primary determinant of CtBP binding, which has led to the hypothesis that the PxDLS motif slots into an ‘accepting’ pocket in CtBP. However, some variant motifs have been reported, such as a bipartite motif located in the C-terminus of the viral EBNA3A pro- tein, where two nonconsensus sites, ALDLS and VLDLS, synergize to produce very efficient binding to CtBP [31]. Other variants include a GLDLS motif in HIC1 [14] and a GLELE motif in ArpNa, a brain-spe- cific actin-related protein found in many chromatin- remodelling and histone acetyltransferase complexes [32]. Using the HIC1 GxDLS motif as a paradigm for these nonconsensus motifs, we investigated the proper- ties of its binding to CtBPs. In their elegant work on the crystal structure of rat CtBP ⁄ BARS in a ternary complex with NADH and a PIDLSKK peptide, Nard- ini et al. [28] identified the peptide-binding site as a hydrophobic surface cleft in the N-terminal part of the substrate-binding domain. As this cleft is lined with hydrophobic residues that are fully conserved between CtBP1 and CtBP2, two different point mutants were constructed in the PIDLS-accepting pocket of CtBP2. In directed yeast two-hybrid assays or in transient HIC1 interacts with CtBP N. Stankovic-Valentin et al. 2884 FEBS Journal 273 (2006) 2879–2890 ª 2006 The Authors Journal compilation ª 2006 FEBS tranfection assays in mammalian cells, these two point mutants are unable to interact with HIC1 (Fig. 3). These results indicate that this cleft can accommodate peptides with some variability in their amino acid sequences and could be considered to be a general binding site for (P ⁄ G ⁄ V ⁄ A)xDLS-containing partners. A VP16 VP16-CtBP1 1 2 3 4 296 296 DBD-Gal4 1 Fold activation 135 GLD LSKK 135 GLD ASKK 1 140 POZ 2 3 4 5 x gal4 Luc WB: CtBP1 WB: FLAG II I PIPI PI GALF 1CIH-GALF 1CIH- G ALF A522L B + CtBP1 IP HIC1(2563) 1 2 3 4 5 6 GALF 1CIH-GALF 1CIH-GALF A 5 2 2L + CtBP1 CtBP2 FLAG-HIC1 FLAG-HIC1 L225A IP: FLAG WB: CtBP2 WB:HIC1 (325) WB: CtBP2 WB: HIC1 (325) Input 5% 12345 6 C 78 9 101112 WB: CtBP1 Input 5% WB: FLAG 7 8 9 Fig. 4. Mutation of the central invariant Leu225 to Ala in the GLDLSKK motif abolishes the interaction between HIC1 and C-terminal binding protein 1 (CtBP1). (A) In mammalian two-hybrid assays, HIC1 mutant L225A does not interact with CtBP1. Left panel: schematic structures of the Gal4 DNA-binding domain (construct 1) and of the various Gal4-HIC1 chimeras (constructs 2–4). Numbering refers to HIC1 residues. Black box, GLDLSKK motif; hatched box, mutated GLDASKK motif. Right panel: Luc and b-galactosidase assays were performed on total extracts from RK13 cells that had been transiently transfected with 250 ng of the pG5-luc reporter (schematically drawn), 50 ng of the pSG5-lacZ construct as a control of transfection efficiency, 50 ng of the indicated Gal4 construct and 150 ng of the VP16 activation domain (grey bars) or VP16 activation domain-tagged murine CtBP1 (black bars). After normalization to b-galactosidase activity, the data were expressed as Luc activity relative to the activity of the pG5-luc with empty control vectors, which was given an arbitrary value of 1. Results presented are the mean values and standard deviations from two independent transfections in triplicate. (B) HIC1 L225A mutation disrupts its interaction with murine CtBP1. COS7 cells were transfected with expression vectors for CtBP1 and the indicated FLAG construct. Forty- eight hours after transfection, lysates were split into two and immunoprecipitated with rabbit preimmune serum (PI: lanes 1, 3 and 5) or the rabbit HIC1 2563 polyclonal antibody (I: lanes 2, 4 and 6). The resulting immunoprecipitates were analysed by western blotting with the indi- cated monoclonal antibodies (anti-CtBP1, upper panel; and anti-FLAG M2, lower panel). Five per cent of each total cell extract (input) was similarly analysed with CtBP1 and FLAG M2 antibodies to control for CtBP1 and HIC1 expression. *Nonspecific band. (C) HIC1 L225A muta- tion disrupts its interaction with CtBP2. COS7 cells were transfected with expression vectors for CtBP2, FLAG-HIC1 and FLAG-HIC1 L225A alone or in combination as indicated and the indicated FLAG. Input (lanes 7–12) and immunoprecipitates (lanes 1–6) were analysed as des- cribed above with the CtBP2 or HIC1 (325) antibodies. N. Stankovic-Valentin et al. HIC1 interacts with CtBP FEBS Journal 273 (2006) 2879–2890 ª 2006 The Authors Journal compilation ª 2006 FEBS 2885 Mutagenesis of the first Pro, of the Pro-Leu or of the Asp-Leu residues in the PLDLS CtBP-binding motif from various proteins has been widely used to severely impair their interaction with CtBP, at least in some assays. Based on the cocrystal structure [28], binding of a PLDLS motif can be driven by docking of the two Leu side chains into the conserved hydro- phobic surface groove. However, to the best of our knowledge, our work provides the first demonstration that a unique point mutation of the central Leu resi- due, which is the sole invariant residue in CID motifs, is sufficient to ablate the interaction between a transcription factor and CtBPs. Our results are thus not only in perfect agreement with the structural data but also provide experimental clues to the universal conservation of this Leu residue in all CtBP-binding motifs described so far. The HIC1 CR appears to be a second repression domain exhibiting both CtBP-dependent and CtBP- independent repression mechanisms, both of which are sensitive to TSA. Indeed, the L225A point mutation (Fig. 5A) as well as the deletion of the GLDLS motif [14] impaired but did not fully abolish the transcrip- tional repression mechanisms of the CR. The other corepressors and complexes interacting with the HIC1 CR are currently being investigated. Along these lines, we have recently identified a SUMOylation site at Lys314 that plays a role in the repression potential of this region (Stankovic-Valentin et al., unpublished results). In addition, a yeast two-hybrid screen per- formed with the HIC1 CR as bait identified not only full-length CtBP1 and CtBP2 as HIC1 partners but also some proteins clearly associated with HDAC- containing complexes (C. Fleuriel and D. Leprince, unpublished results). Finally, we are currently generating conditional mouse knock-in (KI) mutants harbouring the critical Leu-to-Ala substitution at position 225, in the CtBP- interacting domain of HIC1. These animal models could be very useful for directly addressing in vivo the role played by the HIC1–CtBP interaction in two mutually nonexclusive pathways: the HIC1 tumour suppressor properties, which are altered in many human cancers, and normal development. CtBP appears to be a potential modulator of apop- tosis and epithelial-to-mesenchymal transition (EMT), an important feature of embryonic development and tumorigenesis [33]. The heterozygous Hic1 + ⁄ – mice are viable, and have no obvious developmental defects, but spontaneously develop tumours late in their life with a predominance of sarcomas and lymphomas in females and of carcinomas in males [2]. It would thus be interesting to determine if heterozygous mice carry- ing the L225A point mutation in the CtBP-binding domain, Hic1 + ⁄ KI, will also develop tumours, especi- ally the males. More importantly, the homozygous Hic1 – ⁄ – mice are embryonic lethal and display severe developmental anomalies, some of which are found in MDS patients [9]. In Drosophila, CtBP is a corepressor for several short-range repressors essential for early embryonic development, such as Kru ¨ ppel, Giant, Knirps and Snail [34]. In vertebrates, Ctbp1-orCtbp2-deficient embryos exhibit a large variety of developmental defects, consis- tent with the fact that they interact with a multitude of A RK13 5 x gal4 Luc DBD-Gal4 1 GLDLSKK 422 135 2 GLDASKK 422 135 1 2 3 4 5 6 7 DMSO TSA 3 Fold repression B U2OS 5 x HiRE Luc 1234 FLAG FLAG-HIC1 FLAG-HIC1 L225A Fold repression Fig. 5. Mutation L225A in the CtBP-binding motif impaired the HIC1-mediated transcriptional repression. (A) The HIC1 central region contains C-terminal binding protein (CtBP)-dependent and CtBP-independent repression activities which are both trichostatin A (TSA)-sensitive. Left panel: schematic structure of the Gal4 DNA- binding domain and the two Gal4-HIC1 chimeras. Numbering refers to HIC1 residues. Black box, GLD LSKK motif; hatched box, mutated GLD ASKK motif. Right panel: RK13 cells were transiently transfected in triplicate with 100 ng of the indicated constructs, 350 ng of the pG5-Luc reporter and 50 ng of the pSG5-LacZ vector. The cells were treated 24 h later with 300 n M TSA (dissolved in dimethyl sulfoxide (DMSO)) (white boxes) or mock-treated with an equal volume of DMSO (black boxes) for a further 24 h before har- vesting. Luc and b-galactosidase assays were conducted as des- cribed in Fig. 4A. (B) The L225A mutation affects the transcriptional repression potential of full-length HIC1. U2OS cells were transfect- ed with 225 ng of the indicated expression vector, 225 ng of the reporter 5xHiRE-luc plasmid and 50 ng of the pSG5-lacZ construct as control of transfection efficiency. Luc and b-galactosidase assays were done as described above. HIC1 interacts with CtBP N. Stankovic-Valentin et al. 2886 FEBS Journal 273 (2006) 2879–2890 ª 2006 The Authors Journal compilation ª 2006 FEBS transcription factors involved in many signalling path- ways [21]. For all these reasons, it is tempting to specu- late that the Hic1 KI ⁄ KI embryos could phenocopy, at least in part, the abnormalities found in the Hic1 – ⁄ – mice. For example, GATA2 KI ⁄ KI mice carrying a Val-to-Gly point mutation in the GATA2 N-terminal zinc finger that ablates the interaction with cofactors of the Friend of GATA (FOG) family have been gener- ated. These mutant mice display complete megakaryo- poietic failure, a phenocopy of Fog1 – ⁄ – mice [35]. Focusing on CtBP, the best example in favour of our working hypothesis is holoprosencephaly (HPE), the most common structural defect of the developing forebrain in humans, frequently accompanied by cra- niofacial anomalies. HPE4, one of the loci associated with this disease, maps to TGIF, a gene encoding a homeodomain transcriptional repressor modulating NODAL (a member of the transforming growth factor-b family) signalling. Individuals with HPE carry heterozygous mutations either in the DNA-binding domain, the SMAD-binding domain, or a CtBP-inter- action motif [36]. This latter S28C mutation converting a canonical PLDLS motif into a PLDLC motif is suffi- cient to disrupt the interaction between TGIF and CtBP [37], as does the L225A in HIC1. In summary, we have shown that HIC1 is able to interact with CtBP1 and CtBP2. We have demonstra- ted that point mutation of the central Leu225 in the CtBP-interacting motif is sufficient to abolish the inter- action with CtBP, which is in perfect agreement with the structural data and the universal conservation of this residue in all CID motifs. This point mutation could also provide useful KI animal models to study the role of the HIC1–CtBP interaction in tumorigen- esis as well as in development. Experimental procedures Constructs The full-length FLAG-HIC1 L225A point mutant was gen- erated by the two-round PCR mutagenesis strategy using the following two mutagenic oligonucleotides, which introduced an Nsi1 restriction site (underlined) (5¢-CGG CGGGCTCTTCTTGG ATGCATCCAGGCC-3¢ and 5¢-GG CCTGG ATGCATCCAAGAAGAGCCCGCCG-3¢) and convenient flanking oligonucleotides. The StuI–XhoI frag- ment containing the L225A mutation was exchanged with the same restriction fragment in the previously described FLAG-HIC1 wt expression vector [14]. The Gal4-HIC1 135–296 wt and L225A were generated by PCR using the wt or L225A full-length clones as matri- ces and the following oligonucleotides: sense 5¢-GGAATT CG GGATCCCAAAGTACTGCCACCTGCGG-3¢ with a BamH1 site, and antisense 5¢-AGT GGTACCGTCGACTC ATCCCGGGCTGCCGCT-3¢, with a KpnI site. The Gal4- HIC1 135–422 wt and L225A were generated by PCR as described above with the same sense oligonucleotide and an antisense oligonucleotide containing an SstI site 5¢-AT GCACACACGTAAGGCACTCAGCTGAGAT CTCGAG- 3¢. The BamHI–KpnI and BamHI–SstI restriction fragments were cloned in frame with the Gal4 DBD in the pSG5424 vector. A58E and V72R mutations were introduced into mCtBP2 by overlap PCR mutagenesis (mCtBP2.A58E.F, GACCTGGCCACTGTGGAATTCTGTGATGCACAG; mCtBP2.A58E.R, CTGTGCATCACAGAATTCCACAGT GGCCAGGTC; mCtBP2.V72R.F, GAAATCCATGAGA AGCGGTTGAATGAAGCTGTG; and mCtBP2.V72R.R, CACAGCTTCAT TCAACCGCTTCTCATG GATTTC). BglII- and SalI-digested mutant inserts were ligated into the BamHI–SalI sites of pGAD10 vector to generate Gal4AD-CtBP2-A58E and Gal4AD-CtBP2-V72R. Second, wt CtBP2, CtBP2-A58E and CtBP2-V72R mutant inserts were reamplified by PCR using appropriate primers and cloned into the NotI–SalI sites of pMT3 (derived from pMT2). PCR fragments were systematically verified by sequen- cing on both strands. All clones were checked by appropri- ate restriction enzyme digestion, and the vector–insert junctions were verified by sequencing. Yeast two-hybrid system The yeast two-hybrid system was used as described in the manufacturer’s protocol (Clontech, Saint Quentin en Yve- lines, France). Briefly, the CR of HIC1 [14] was cloned in- frame into the Gal4 DBD plasmid pGBT9. These plasmids were cotransfected with the Gal4 AD plasmid pGAD10 fused to mCtBP2, A58E and V72R mutants into the yeast strain HF7c, and transformants were selected on Trp ⁄ Leu- deficient media (SD-Leu-Trp). Colonies were patched onto Trp ⁄ Leu ⁄ His-deficient media (SD-Leu-Trp-His). Cell culture and transfection COS7, DAOY, U2OS and RK13 cells were maintained in Dulbecco medium supplemented with 10% fetal bovine serum. Cells were transfected in OptiMEM (Gibco, Paisley, UK) by the PEI (Euromedex, Souffelweyersheim, France) method as previously described [14] in either 100 mm diameter dishes (in vivo interaction in COS7 cells) with 2.5 lgof DNA or in 12-well plates (repression and mammalian two- hybrid assays) with 500 ng of DNA for RK13 cells and for U2OS cells. Cells were transfected for 6 h and were then incubated in fresh complete medium. They were rinsed in cold NaCl ⁄ P i 48 h after transfection and processed for N. Stankovic-Valentin et al. HIC1 interacts with CtBP FEBS Journal 273 (2006) 2879–2890 ª 2006 The Authors Journal compilation ª 2006 FEBS 2887 coimmunoprecipitation, repression or mammalian two- hybrid assays as described below. Immunoprecipitation and coimmunoprecipitation Total DAOY cell extracts were immunoprecipitated in stringent conditions using RIPA buffer as previously des- cribed [14]. For coimmunoprecipitation experiments, DAOY cells or COS7 cells (48 h after transfection) were rinsed twice in cold NaCl ⁄ P i and lysed in cold IPH buffer (50 mm Tris pH 8, 150 mm NaCl, 5 mm EDTA, 0.5% NP-40, protease inhibitor cocktail (Roche)). Cell lysates were cleared by cen- trifugation (20 000 g, 30 min). The supernatants were incu- bated overnight with 4 lL of antibody. Then, protein A Sepharose beads (Amersham Biosciences, Orsay, France) were added for 1 h. The beads were washed three times with IPH buffer. Proteins were eluted by boiling in Lae- mmli loading buffer and separated by SDS ⁄ PAGE before western blotting. For experiments using CoCl 2 , 3 h before lysis, cells were either treated with 200 lm CoCl 2 diluted in fresh medium or mock-treated with fresh medium. Repression and mammalian two-hybrid assays Forty-eight hours after transfection, cells were rinsed in NaCl ⁄ P i and lysed with the Luc assay buffer (25 mm glycyl- glycine, pH 7.8; 15 mm MgSO 4 ;4mm EGTA; 1% Triton X-100). Luciferase and b-galactosidase activities were meas- ured by using, respectively, beetle luciferin (Promega, Char- bonnieres, France) and the Galacto-light kit (Tropix, Bedford, MA, USA) with a Berthold (Thoiry, France) chemioluminometer. After normalization to b-galactosidase activity, the data were expressed as Luc activity relative to the activity of pG5-Luc with empty control vector, which was given an arbitrary value of 1. Results represent the mean values and standard deviations from two independent transfections in triplicate [12]. Western blot and antibodies Western blots were performed essentially as previously des- cribed [14]. The HIC1 2563 and HIC1 325 antibodies have been previously described [14]. For CtBP1, the CtBP1 monoclonal antibody (E-12) raised against amino acids 1– 440 of human CtBP1 (Santa Cruz Biotechnology, Le perray en Yvelines, France) was used. To detect endogenous CtBP2, we used two different antibodies: a monoclonal antibody raised against amino acids 361–445 of mouse CtBP2 (BD Biosciences, Pharmingen, Le Pont de Claix, France) or a goat polyclonal antibody raised against a pep- tide near the C-terminus of CtBP2 of human origin (sc-5966; Santa Cruz Biotechnology). In the immunoprecip- itation experiment, we used the CtBP1 rabbit polyclonal 1128 antibodies raised against the ovalbumin-coupled pep- tide corresponding to amino acids 352–374 of murine CtBP1 [38] and kindly provided by B. Wasylyk. Anti-Flag M2 is a monoclonal antibody (F3165; Sigma, Lyon, France). The secondary antibodies were horseradish peroxi- dase-linked antibodies raised against either rabbit or mouse immunoglobulins (Amersham Biosciences). Acknowledgements We thank Drs Se ´ bastien Pinte and Brian R. Rood for critically reading the manuscript. This work was sup- ported by funds from CNRS, the Pasteur Institute, the Ligue Nationale contre le Cancer (Comite ´ Interre ´ gio- nal du Septentrion), the Association pour la Recherche contre le Cancer (ARC) and a grant from the Austra- lian National Health and Medical Research Council. N. Stankovic-Valentin was supported by a fellowship from the Ministe ` re de la Recherche et de la Technolo- gie and by the Association pour la Recherche contre le Cancer (ARC). References 1 Wales MM, Biel MA, el Deiry W, Nelkin BD, Issa JP, Cavenee WK, Kuerbitz SJ & Baylin SB (1995) p53 activates expression of HIC-1, a new candidate tumour suppressor gene on 17p13.3. Nat Med 1, 570–577. 2 Chen WY, Zeng X, Carter MG, Morrell CN, Chiu-Yen RW, Esteller M, Watkins DN, Herman JG, Mankowski JL & Baylin SB (2003) Heterozygous disruption of Hic1 predisposes mice to a gender- dependent spectrum of malignant tumors. Nat Genet 33, 197–202. 3 Guerardel C, Deltour S, Pinte S, Monte D, Begue A, Godwin AK & Leprince D (2001) Identification in the human candidate tumor suppressor gene HIC-1 of a new major alternative TATA-less promoter positively regulated by p53. J Biol Chem 276, 3078–3089. 4 Britschgi C, Rizzi M, Grob TJ, Tschan MP, Hugli B, Reddy VA, Andres AC, Torbett BE, Tobler A & Fey MF (2005) Identification of the p53 family-responsive element in the promoter region of the tumor suppressor gene hypermethylated in cancer 1. Oncogene 25, 2030– 2039. 5 Chen W, Cooper TK, Zahnow CA, Overholtzer M, Zhao Z, Ladayni M, Karp JE, Gokgoz N, Wunder JS, Andrulis IL et al. (2004) Epigenetic and genetic loss of Hic1 function accentuates the role of p53 in tumorigen- esis. Cancer Cell 6, 387–398. 6 Chen WY, Wang DH, Yen RC, Luo J, Gu W & Baylin SB (2005) Tumor suppressor HIC1 directly regulates HIC1 interacts with CtBP N. Stankovic-Valentin et al. 2888 FEBS Journal 273 (2006) 2879–2890 ª 2006 The Authors Journal compilation ª 2006 FEBS [...]... 422, 735–738 Hickabottom M, Parker GA, Freemont P, Crook T & Allday MJ (2002) Two nonconsensus sites in the Epstein–Barr virus oncoprotein EBNA 3A cooperate to bind the co-repressor carboxyl-terminal-binding protein (CtBP) J Biol Chem 277, 47197–47204 Oma Y, Nishimori K & Harata M (2003) The brainspecific actin-related protein ArpN alpha interacts with the transcriptional co-repressor CtBP Biochem Biophys... NODAL signalling to human neural axis determination Nat Genet 25, 205– 208 Melhuish TA & Wotton D (2000) The interaction of the carboxyl terminus-binding protein with the Smad corepressor TGIF is disrupted by a holoprosencephaly mutation in TGIF J Biol Chem 275, 39762–39766 Criqui-Filipe P, Ducret C, Maira SM & Wasylyk B (1999) Net, a negative Ras-switchable TCF, contains a second inhibition domain, the. .. 2879–2890 ª 2006 The Authors Journal compilation ª 2006 FEBS 2889 HIC1 interacts with CtBP 30 31 32 33 34 N Stankovic-Valentin et al basic Kruppel-like factor and other mammalian transcriptional regulators EMBO J 17, 5129–5140 Shi Y, Sawada J, Sui G, Affar el B, Whetstine JR, Lan F, Ogawa H, Luke MP & Nakatani Y (2003) Coordinated histone modifications mediated by a CtBP co-repressor complex Nature 422, 735–738... SUMOylation and PDZ binding Mol Cell 11, 1389– 1396 Zhao LJ, Subramanian T, Zhou Y & Chinnadurai G (2006) Acetylation by p300 regulates nuclear localization and function of the transcriptional corepressor CtBP2 J Biol Chem 281, 4183–4189 ` Verger A, Quinlan KGR, Crofts LA, Spano S, Corda D, Kable EPW, Braet F & Crossley M (2006) Mechanisms directing the nuclear localization of the CtBP family proteins... Kerckaert JP, Evans RM & Leprince D (1997) HIC1 interacts with CtBP 18 19 20 21 22 23 24 2 4a 25 26 27 28 29 Corepressor SMRT binds the BTB ⁄ POZ repressing domain of the LAZ3 ⁄ BCL6 oncoprotein Proc Natl Acad Sci USA 94, 10762–10767 Melnick A, Carlile G, Ahmad KF, Kiang CL, Corcoran C, Bardwell V, Prive GG & Licht JD (2002) Critical residues within the BTB domain of PLZF and Bcl-6 modulate interaction with. .. serve as a metabolic sensor Proc Natl Acad Sci USA 100, 9202–9207 Nardini M, Spano S, Cericola C, Pesce A, Massaro A, Millo E, Luini A, Corda D & Bolognesi M (2003) CtBP ⁄ BARS: a dual-function protein involved in transcription co-repression and Golgi membrane fission EMBO J 22, 3122–3130 Turner J & Crossley M (1998) Cloning and characterization of mCtBP2, a co-repressor that associates with FEBS Journal... Chang AN, Cantor AB, Fujiwara Y, Lodish MB, Droho S, Crispino JD & Orkin SH (2002) GATA-factor dependence of the multitype zinc-finger protein FOG-1 for its essential role in megakaryopoiesis Proc Natl Acad Sci USA 99, 9237–9242 Gripp KW, Wotton D, Edwards MC, Roessler E, Ades L, Meinecke P, Richieri-Costa A, Zackai EH, Massague J, Muenke M, et al (2000) Mutations in TGIF cause holoprosencephaly and link... interaction with corepressors Mol Cell Biol 22, 1804–1818 Turner J & Crossley M (2001) The CtBP family: enigmatic and enzymatic transcriptional co-repressors Bioessays 23, 683–690 Chinnadurai G (2003) CtBP family proteins: more than transcriptional corepressors Bioessays 25, 9–12 Hildebrand JD & Soriano P (2002) Overlapping and unique roles for C-terminal binding protein 1 (CtBP1 ) and CtBP2 during mouse development... Firestein BL (2001) Binding of neuronal nitric-oxide synthase (nNOS) to carboxyl-terminal-binding protein (CtBP) changes the localization of CtBP from the nucleus to the cytosol: a novel function for targeting by the PDZ domain of nNOS J Biol Chem 276, 48262–48268 Lin X, Sun B, Liang M, Liang YY, Gast A, Hildebrand J, Brunicardi FC, Melchior F & Feng XH (2003) Opposed regulation of corepressor CtBP by... suppressor gene HIC1 Biochim Biophys Acta 1678, 57–66 Deltour S, Guerardel C & Leprince D (1999) Recruitment of SMRT ⁄ N-CoR-mSin 3A- HDAC-repressing complexes is not a general mechanism for BTB ⁄ POZ transcriptional repressors: the case of HIC-1 and gammaFBP-B Proc Natl Acad Sci USA 96, 14831– 14836 Deltour S, Pinte S, Guerardel C & Leprince D (2001) Characterization of HRG22, a human homologue of the . -His Gal4AD Gal4AD CtBP2 Gal4AD CtBP2 A5 8E Gal4AD CtBP2 V72R Gal4DBD Gal4DBD HIC1 CR Gal4AD Gal4AD CtBP2 Gal4AD CtBP2 A5 8E Gal4AD CtBP2 V72R B GALF 1CIH-GALF 2PBtC 2PBtC. mutation of the only invariant residue in the CtBP- interacting domain is sufficient to abolish the HIC1 CtBP interaction Having established that the interaction